Pseudomonas chlororaphis subsp. Aurantii NEAU-L04 and application thereof in prevention and treatment of lonicera caerulea leaf spot disease

Abstract

The invention relates to the technical field of microorganisms, in particular to pseudomonas chlororaphis subsp. Aurantii NEAU-L04 and application of the pseudomonas chlororaphis subsp. Aurantii NEAU-L04 in prevention and treatment of lonicera caerulea leaf spot. The pseudomonas chlororaphis subsp. Aurantiaca NEAU-L04 is preserved in the China General Microbiological Culture Collection Center (CGMCC), the address is Institute of Microbiology, Chinese Academy of Sciences, 3 #, 1 # yard, West Beichen Road, Chaoyang District, Beijing, the preservation date is October 23, 2024, and the preservation number is CGMCC No.32309. The invention further discloses a preparation method of the pseudomonas chlororaphis subsp. Aurantiaca NEAU-L04. The strain NEAU-L04 disclosed by the invention has an antagonistic effect on nine kinds of pathogenic fungi. The strain NEAU-L04 has a prevention and treatment effect on the lonicera caerulea leaf spot disease, and provides a basis for prevention and treatment of the lonicera caerulea leaf spot disease.

Description

Technical Field

[0001] The present invention relates to the field of microbial technology, and in particular to a strain of Pseudomonas chlororaphis subsp. aurantiaca NEAU-L04 and its application in the control of blue honeysuckle leaf spot disease. Background Art

[0002] Blue honeysuckle, scientifically known as Lonicera caerulea, is a deciduous shrub crop of the genus Lonicera in the family Caprifoliaceae. The cultivation of blue honeysuckle has become an important cash crop, bringing significant economic benefits.

[0003] Alternaria tenuissima leaf spot is the main disease source of blue honeysuckle leaf spot, causing serious losses in blue honeysuckle yield. The pathogenic bacterium is Alternaria tenuissima ( Alternaria tenuissima ). At present, chemical control is a commonly used method for plant disease control, but chemical control has side effects such as polluting the soil and water sources.

[0004] In recent years, biological control has developed rapidly. Biological control has good environmental protection, has less impact on the environment and ecosystem, is conducive to maintaining ecological balance and biodiversity, targets the pathogen, has a continuous effect, and helps to control diseases in the long term. Due to its advantages such as safety, economy and high efficiency, biological control has attracted more and more attention.

[0005] The genus Pseudomonas ( Pseudomonas spp.) is widely distributed in the rhizosphere soil of plants. Many strains can effectively inhibit pathogens while promoting plant growth and increasing yield. The genus Pseudomonas ( Pseudomonas spp.) has been found to be able to control infectious diseases of various plants such as ginseng, Rehmannia glutinosa, and tomato, greatly expanding the application range of Pseudomonas. However, no Pseudomonas has been found that can be used to control blue honeysuckle leaf spot. Therefore, a biocontrol strain that can control blue honeysuckle leaf spot is needed to meet the deficiencies of the existing technology. Summary of the Invention

[0006] The purpose of the present invention is to provide a strain of Pseudomonas chlororaphis subsp. aurantiaca NEAU-L04 and its application in the control of blue honeysuckle leaf spot disease.

[0007] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions: The present invention provides a strain of Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04, which is deposited in the China General Microbiological Culture Collection Center, with the address being Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 23, 2024, and the deposit number is CGMCC No. 32309.

[0008] The present invention also provides the use of Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 in the preparation of a product for inhibiting plant pathogenic bacteria.

[0009] Preferably, the plant pathogenic bacteria include Epicoccum sorghinum ( Epicoccum sorghinum ), Epicoccum nigrum ( Epicoccum nigrum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria alternata ( Alternaria alternata ), Pleospora cucumerina ( Stagonosporopsis cucurbitacearum ), Pseudopezicula tracheiphila ( Pseudopithomyces chartarum ), Fusarium asiaticum ( Fusarium asiaticum ), Cladosporium pseudocladosporioides ( Cladosporium pseudocladosporioides ), Pestalotiopsis rosae ( Neopestalotiopsis rosae ) and one or more of them.

[0010] The present invention also provides a microbial inoculant, including the Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 and its bacterial suspension or fermentation broth.

[0011] The present invention also provides the use of the microbial inoculant in the preparation of a product for inhibiting plant pathogenic bacteria.

[0012] Preferably, the plant pathogenic bacteria include Epicoccum sorghinum ( Epicoccum sorghinum ), Epicoccum nigrum ( Epicoccum nigrum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria alternata ( Alternaria alternata ), Pleospora cucumerina ( Stagonosporopsis cucurbitacearum ), Pseudopezicula tracheiphila ( Pseudopithomyces chartarum ), Fusarium asiaticum ( Fusarium asiaticum ), Cladosporium pseudocladosporioides ( Cladosporium pseudocladosporioides ), Pestalotiopsis rosae ( Neopestalotiopsis rosae ) and one or more of them.

[0013] The present invention also provides a biocontrol inoculant for preventing and treating Alternaria tenuissima leaf spot of Lonicera caerulea, including the Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 and its bacterial suspension.

[0014] The present invention also provides a preparation method of a biocontrol inoculant for preventing and treating Alternaria tenuissima leaf spot of Lonicera caerulea, including the following steps: Taking the Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp. aurantiaca )NEAU-L04 was inoculated into LB liquid medium and cultured until the OD 600 was 0.7 - 0.9 to obtain; The LB liquid medium uses water as a solvent and includes components with the following concentrations: yeast extract powder 4 - 6 g / L, tryptone 9 - 11 g / L, sodium chloride 4 - 6 g / L.

[0015] The present invention also provides a method for preventing and controlling Alternaria tenuissima leaf spot of blue honeysuckle, including the following steps: Dilute the biocontrol agent and spray and / or drench the blue honeysuckle; The biocontrol agent is the above-mentioned biocontrol agent or the biocontrol agent prepared according to the above-mentioned preparation method.

[0016] Preferably, the dilution multiple of the biocontrol agent is 50 - 150 times.

[0017] The present invention provides a strain of Pseudomonas chlororaphis subsp. aurantiaca NEAU-L04 and its application in preventing and controlling Alternaria tenuissima leaf spot of blue honeysuckle. A strain NEAU-L04 with obvious antagonistic effect against Alternaria tenuissima leaf spot of blue honeysuckle was isolated from the rhizosphere soil of blue honeysuckle plants. Through the analysis of the morphological characteristics, electron microscopy scanning, physiological and biochemical indexes and multi-gene phylogenetic tree of the strain, the strain NEAU-L04 was identified as Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp. aurantiaca ). In the antibacterial spectrum determination test, the strain NEAU-L04 showed broad-spectrum resistance and had antagonistic effects on 9 pathogenic fungi. In the greenhouse pot experiment for control efficacy determination, the control efficacy of the strain NEAU-L04 against Alternaria tenuissima leaf spot of blue honeysuckle reached 56.02% in 7 days. It shows that the strain NEAU-L04 has good application prospects and provides a certain theoretical basis and technical support for further development and utilization.

[0018] Preservation certificate

[0019] Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp. aurantiaca ), NEAU-L04, was deposited in the China General Microbiological Culture Collection Center, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date was October 23, 2024, and the deposit number was CGMCC No. 32309. Description of the drawings

[0020] Figure 1 are the morphological observation results of the strain NEAU-L04; Figure 2Phylogenetic tree of strain NEAU-L04; Figure 3 For the confrontation-contact test on the antibacterial activity of strain NEAU-L04 against 9 pathogenic bacteria; Figure 4 Detection results of cellulase test; Figure 5 Detection results of protease test; Figure 6 Intuitive diagram of the control effect of strain NEAU-L04 in pot experiments (from left to right, representing healthy Lonicera caerulea plants, model control group, treatment group 2, and treatment group 1); Figure 7 Statistical results of the disease index and the inhibition of Alternaria tenuissima in pot experiments of strain NEAU-L04. Detailed implementation mode

[0021] The present invention provides a strain of Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04, which is deposited in the China General Microbiological Culture Collection Center, located at the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is October 23, 2024, and the deposit number is CGMCC No. 32309.

[0022] The present invention also provides the application of the above-mentioned Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 in the preparation of products for inhibiting plant pathogenic bacteria.

[0023] In the present invention, the plant pathogenic bacteria include Epicoccum sorghinum ( Epicoccum sorghinum ), Epicoccum nigrum ( Epicoccum nigrum ), Alternaria tenuissima ( Alternaria tenuissima ), Alternaria alternata ( Alternaria alternata ), Pleospora cucumerina ( Stagonosporopsis cucurbitacearum ), Pithomyces chartarum ( Pseudopithomyces chartarum ), Fusarium asiaticum ( Fusarium asiaticum ), Cladosporium pseudocladosporioides ( Cladosporium pseudocladosporioides ), Pestalotiopsis rosae ( Neopestalotiopsis rosae ) and one or more of them.

[0024] The present invention also provides a microbial inoculant, including the above-mentioned Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 and its bacterial suspension or fermentation broth.

[0025] The present invention also provides an application of the microbial inoculant in preparing a product for inhibiting plant pathogenic bacteria.

[0026] In the present invention, the plant pathogenic bacteria include Epicoccum sorghinum Epicoccum sorghinum Epicoccum nigrum , Epicoccum nigrum Alternaria tenuissima , Alternaria tenuissima Alternaria alternata , Alternaria alternata Stagonosporopsis cucurbitacearum , Pseudoseptoria cucurbitacearum Pseudopithomyces chartarum , Pseudopyricularia sp. Fusarium asiaticum , Fusarium asiaticum Cladosporium pseudocladosporioides , Cladosporium pseudocladosporioides Neopestalotiopsis rosae , Pestalotiopsis rosae

[0027] The present invention also provides a biocontrol inoculant for controlling Alternaria tenuissima leaf spot of Lonicera caerulea, including the Pseudomonas chlororaphis subsp. aurantiaca Pseudomonas chlororaphis subsp . aurantiaca NEAU-L04 and its bacterial suspension.

[0028] The present invention also provides a preparation method of a biocontrol inoculant for controlling Alternaria tenuissima leaf spot of Lonicera caerulea, including the following steps: Inoculate the Pseudomonas chlororaphis subsp. aurantiaca Pseudomonas chlororaphis subsp. aurantiaca NEAU-L04 into an LB liquid medium, and culture until the OD 600 is 0.7 - 0.9 to obtain; the OD 600 value of the culture is preferably 0.8.

[0029] The LB liquid medium uses water as a solvent and includes components with the following concentrations: yeast extract powder 4 - 6 g / L, preferably 5 g / L; tryptone 9 - 11 g / L, preferably 10 g / L; sodium chloride 4 - 6 g / L, preferably 5 g / L.

[0030] The present invention also provides a method for controlling Alternaria tenuissima leaf spot of Lonicera caerulea, including the following steps: Dilute the biocontrol inoculant and spray and / or irrigate the roots of Lonicera caerulea; The biocontrol inoculant is the above-mentioned biocontrol inoculant or the biocontrol inoculant prepared according to the above-mentioned preparation method.

[0031] In the present invention, the dilution multiple of the biocontrol inoculant is 50 - 150 times, preferably diluted 100 times.

[0032] The following is a detailed description of the solution provided by the present invention in conjunction with embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] In the embodiment of the present invention, the LB solid medium uses water as a solvent and includes components with the following concentrations: yeast extract powder 5 g / L, tryptone 10 g / L, sodium chloride 5 g / L, agar powder 20 g / L. This medium is used for the isolation and purification of strains. In the embodiment of the present invention, the LB liquid medium uses water as a solvent and includes components with the following concentrations: yeast extract powder 5 g / L, tryptone 10 g / L, sodium chloride 5 g / L. This medium is used for the propagation of strains. In the embodiment of the present invention, the PDA solid medium uses water as a solvent and includes components with the following concentrations: potato 200 g / L, glucose 20 g / L, agar powder 20 g / L. This medium is used for the activation culture of strains. In the embodiment of the present invention, the gelatin medium uses water as a solvent and includes components with the following concentrations: sodium chloride 5 g / L, tryptone 10 g / L, beef extract 3 g / L, gelatin 120 g / L. This medium is used for the gelatin liquefaction test. In the embodiment of the present invention, the glucose peptone water medium uses water as a solvent and includes components with the following concentrations: peptone 5 g / L, glucose 5 g / L, dipotassium hydrogen phosphate 2 g / L. This medium is used for the V-P reaction and methyl red test. In the embodiment of the present invention, the starch hydrolysis determination agar medium uses water as a solvent and includes components with the following concentrations: soluble starch 10 g / L, potassium nitrate 1 g / L, dipotassium hydrogen phosphate 0.3 g / L, magnesium carbonate 1 g / L, sodium chloride 0.5 g / L, agar 20 g / L, pH 7.2. This medium is used for the starch hydrolysis test.

[0034] In the embodiment of the present invention, the skim milk powder plate medium uses water as a solvent and includes components with the following concentrations: potassium chloride 2 g / L, magnesium sulfate heptahydrate 1 g / L, calcium chloride dihydrate 0.48 g / L, sodium bicarbonate 0.06 g / L, ferric chloride 0.001 g / L, sodium chloride 40 g / L, skim milk powder 10 g / L, agar 15 g / L, pH 7.5. This medium is used for the protease test.

[0035] In the embodiment of the present invention, the CMC medium uses water as a solvent and includes components with the following concentrations: dipotassium hydrogen phosphate 2.5 g / L, disodium hydrogen phosphate 2.5 g / L, sodium carboxymethyl cellulose 20.0 g / L, peptone 2.0 g / L, yeast extract powder 0.5 g / L, agar 20 g / L.

[0036] The above-mentioned culture media are all sterile culture media. The LB solid medium and LB liquid medium are obtained by sterilizing at 121°C for 30 min.

[0037] The PDA solid medium, gelatin medium, and starch hydrolysis assay agar medium are obtained by sterilizing at 121°C for 20 min.

[0038] The glucose peptone water medium and skim milk powder plate medium are obtained by sterilizing at 115°C for 20 min.

[0039] The sterilization conditions for the CMC medium are 121°C for 15 min.

[0040] The Congo red solution described in the embodiments of the present invention is a 0.2 wt% Congo red solution. The specific preparation method is as follows: 2 g of Congo red powder and 1 L of distilled water, and a small amount of alcohol can be added to help dissolve evenly.

[0041] The sodium chloride solution described in the embodiments of the present invention is a 1 M sodium chloride solution. The specific preparation method is as follows: 58.5 g of sodium chloride is mixed with 1 L of distilled water and stirred evenly to obtain the sodium chloride solution.

[0042] Example 1

[0043] Isolation, identification, and preservation of strain NEAU-L04

[0044] I. Isolation and purification of strain NEAU-L04 Collect the rhizosphere soil on the surface of 1 - 10 cm of healthy blue honeysuckle plants in the Xiangyang Base of Northeast Agricultural University and store it at 4°C for later use. Weigh 0.3 g of each soil sample, add it to 30 mL of sterile water, and place it on a constant temperature shaker at 30°C for 30 min. Then pipette 30 μL and spread it on the LB solid medium, and culture it in an incubator at 30°C for 48 h. After single colonies grow on the spread plate, use a sterilized toothpick to pick single colonies with different morphologies and streak them on the LB solid medium plate for purification, and place them in a constant temperature incubator at 30°C until single colonies with consistent morphology grow, and store them in a refrigerator at 4°C for later use. Strain NEAU-L04 was isolated.

[0045] II. Identification of strain NEAU-L04 1. Morphological identification Observe the morphological characteristics of strain NEAU-L04. The results are as Figure 1 shown. The results show that the colonies are round and slightly raised, the surface and edges are smooth, easy to pick up, the colonies are orange-yellow, can produce orange-red pigments around the colonies, and can cover the surface of the colonies.

[0046] 2. Physiological and biochemical identification Refer to the methods in "Common Bacterial System Identification Booklet" and "Bergey's Manual of Determinative Bacteriology" to conduct the following physiological and biochemical tests on strain NEAU-L04: Gram test, growth temperature test, salt tolerance test, gelatin liquefaction test, methyl red test, V-P test, lecithinase test, catalase test, starch hydrolysis test, protease test, etc. The results are shown in Table 1, and the results indicate that: the test results of salt tolerance, catalase, V-P reaction, starch hydrolysis, etc. of strain NEAU-L04 are consistent with the reaction characteristics of Pseudomonas chlororaphis, and it is preliminarily determined to be Pseudomonas chlororaphis.

[0047] Table 1 Physiological and Biochemical Identification Results of Strain NEAU-L04

[0048] In Table 1, "+" indicates positive and "-" indicates negative.

[0049] 3. Molecular Biology Identification of Strain NEAU-L04 Use a bacterial genomic DNA extraction kit to extract the genomic DNA of strain NEAU-L04, and use primers to PCR amplify the 16S rDNA gene sequence of strain NEAU-L04.

[0050] 16S rDNA gene amplification primers: 27F (SEQ ID NO.1): 5' AGAGTTTGATCCTGGCTCAG 3'; 1492R (SEQ ID NO.2): 5' AAGGAGGTGATCCAGCCGCA 3'.

[0051] PCR amplification system: 25 μL, including 1 μL of each upstream primer and downstream primer, 1 μL of template DNA; 12.5 μL of T-Taq Mix; 9.5 μL of sterile water. PCR reaction program: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 55 °C for 30 s, extension at 72 °C for 90 s, 35 cycles; extension at 72 °C for 10 min.

[0052] After amplification, aspirate 3 μL of the PCR product and perform gel electrophoresis on a 1.5% agarose gel by mass fraction. Send the PCR product to Sangon Biotech (Shanghai) Co., Ltd. for sequencing, and conduct a preliminary BLAST comparison in the NCBI database. Obtain the gene sequences related to constructing the phylogenetic tree through the GenBank database. Use the Neighbor-Joining Tree (neighbor-joining method) in MEGA 7.0 software to construct the phylogenetic tree and determine the genus and species relationship of strain NEAU-L04.

[0053] Based on the 16S rDNA gene sequence (SEQ ID NO.3) of strain NEAU-L04, a phylogenetic tree of the NEAU-L04 gene was constructed, and the results are as Figure 2 shown. The results indicate that strain NEAU-L04 clusters together with Pseudomonas chlororaphis subsp. Pseudomonas chlororaphis subsp. Aurantiaca zm-1 with a bootstrap support rate of 100%.

[0054] Based on the comprehensive observation of the growth characteristics, morphological features, physiological and biochemical tests, and molecular biological identification of strain NEAU-L04, it is determined to be Pseudomonas chlororaphis subsp. Pseudomonas chlororaphis subsp. Aurantiaca。

[0055]

[0056] III. Preservation of Strain NEAU-L04 Pseudomonas chlororaphis subsp. aurantiaca Pseudomonas chlororaphis subsp. Aurantiaca NEAU-L04 was preserved in the China General Microbiological Culture Collection Center (CGMCC), No. 3, Institute of Microbiology, Chinese Academy of Sciences, 1 Beichen West Road, Chaoyang District, Beijing 100101, China. The preservation date was October 23, 2024, and the preservation number was CGMCC No. 32309.

[0057] Example 2

[0058] Identification of the Antibacterial Spectrum of Strain NEAU-L04

[0059] The antibacterial activity of strain NEAU-L04 against 9 pathogens of blue honeysuckle leaf spot was detected by the plate confrontation-contact test. The antibacterial results are shown in Table 2 and Figure 3 as follows. Antibacterial rate (%) = [(control colony diameter - treated colony diameter) / (control colony diameter - 5 mm)] × 100%.

[0060] Table 2 Antibacterial Results of Strain NEAU-L04 against 9 Pathogens of Blue Honeysuckle Leaf Spot

[0061] Data are presented as mean ± standard error.

[0062] The results showed that strain NEAU-L04 could effectively inhibit 9 fungi, namely Alternaria tenuissima, Alternaria alternata, Cladosporium cladosporioides, Epicoccum nigrum, Epicoccum sorghinum, Fusarium asiaticum, Pestalotiopsis microspora, Phoma glomerata, and Septoria cucurbitacearum, with inhibition rates all greater than 50%.

[0063] Figure 3 From left to right in the first row represent Alternaria tenuissima, Alternaria alternata, Cladosporium cladosporioides; from left to right in the second row represent Phoma glomerata, Epicoccum nigrum, Epicoccum sorghinum; from left to right in the third row represent Fusarium asiaticum, Pestalotiopsis microspora, Septoria cucurbitacearum.

[0064] Example 3

[0065] Determination of Biocontrol Factors of Strain NEAU-L04

[0066] 1. Detection of Cellulase Pick a single colony of strain NEAU-L04 and spot-inoculate it at the center of the CMC medium. After culturing at 28 °C for 24 h, add 3 mL of 0.2 wt% congo red solution, stain for 30 min, pour out the dye, and then add 5 mL of 1 M sodium chloride solution for decolorization for 15 min. Observe the hydrolysis zone. Each treatment is repeated 3 times. The results are as Figure 4 shown.

[0067] 2. Detection of protease Pick a single colony of strain NEAU-L04 and spot-inoculate it at the center of the skim milk powder medium. Observe the hydrolysis zone after culturing at 28 °C for 24 h. Each treatment is repeated 3 times. The results are as Figure 5 shown.

[0068] Figures 4 - 5 shown that there is no hydrolysis zone of strain NEAU-L04 on the CMC medium, but there is a hydrolysis zone in the skim milk powder medium. It shows that strain NEAU-L04 has protease activity.

[0069] Example 4

[0070] Determination of the control effect of strain NEAU-L04 against Alternaria tenuissima leaf spot of Lonicera caerulea

[0071] Treatment group 1: Dilute the bacterial suspension of strain NEAU-L04 with an OD 600 = 0.8 by 100 times with sterile water, and spray it on the Lonicera caerulea plants respectively until the leaves are covered with the liquid medicine and there is no dripping. At the same time, irrigate the roots of each plant with 50 mL of the treatment solution (the bacterial suspension of strain NEAU-L04 with an OD 600 = 0.8 diluted by 100 times).

[0072] Model control group: Replace the bacterial suspension of strain NEAU-L04 with an OD 600 = 0.8 in treatment group 1 with distilled water, and the other treatment methods are the same as those in treatment group 1.

[0073] Treatment group 2: Replace the NEAU-L04 strain in treatment group 1 with a commercially available microbial agent (the main active strain is Pseudomonas fluorescens ( Pseudomonas fluorescens ))), and the other treatment methods are the same as those in treatment group 1.

[0074] After 24 h of implementation of each treatment group and the model control group, spray and inoculate Alternaria tenuissima ( 8 ) LD-12 with a concentration of 1×10 Alternaria tenuissima cfu / mL on the plants of each treatment. There are 8 plants in each treatment, with 3 replicates. Keep the humidity at 28 °C. Investigate the disease incidence after 7 d of treatment, and use healthy Lonicera caerulea plants as the blank control. Grade the diseases according to the "Guidelines for Field Efficacy Trials of Pesticides", and calculate the disease index and control effect.

[0075] Disease index = ∑(number of diseased leaves at each level × disease level) / (total number of leaves surveyed × highest disease level) × 100. Disease level classification criteria: Grade 0: No disease spots; Grade 1: Disease spot area accounts for less than 5% of the entire leaf area; Grade 2: Disease spot area accounts for 6% - 25% of the entire leaf area; Grade 3: Disease spot area accounts for 26% - 50% of the entire leaf area; Grade 4: Disease spot area accounts for 51% - 75% of the entire leaf area; Grade 5: Disease spot area accounts for more than 75% of the entire leaf area.

[0076] Control effect (%) = (disease index of model control - disease index of treatment) / disease index of model control × 100%.

[0077] The results are as Figures 6 - 7 shown. The results show that Pseudomonas chlororaphis subsp. aurantiaca Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 has a 7-day control effect of 56.02% on the leaf spot disease of Lonicera caerulea caused by Alternaria tenuissima, which is better than the control effect (36.11%) of the commercially available fungicide Pseudomonas fluorescens Alternaria tenuissima ). Pseudomonas fluorescens

[0078] As can be seen from the above examples, the present invention provides a strain of Pseudomonas chlororaphis subsp. aurantiaca NEAU-L04 and its application in the control of leaf spot disease of Lonicera caerulea. The present invention isolated a strain NEAU-L04 from the rhizosphere soil of Lonicera caerulea plants, which has an obvious antagonistic effect on the leaf spot disease of Alternaria tenuissima of Lonicera caerulea. Through the analysis of the morphological characteristics, electron microscopy scanning, physiological and biochemical indexes and multi-gene phylogenetic tree of the strain, the strain NEAU-L04 was identified as Pseudomonas chlororaphis subsp. aurantiaca Pseudomonas chlororaphis subsp. aurantiaca ). In the bacteriostatic spectrum determination test, the strain NEAU-L04 showed broad-spectrum resistance and had an antagonistic effect on 9 pathogenic fungi. In the greenhouse pot control effect determination test, the 7-day control effect of the strain NEAU-L04 on the leaf spot disease of Alternaria tenuissima of Lonicera caerulea reached 56.02%. It shows that the strain NEAU-L04 has good application prospects and provides a certain theoretical basis and technical support for further development and utilization.

[0079] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A strain of Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis Pseudomonas chlororaphis subsp. aurantiaca ), NEAU-L04, characterized in that, It is preserved in the General Microbiology Center of the China Committee for Culture Collection of Microorganisms, with the address being the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing. The preservation date is October 23, 2024, and the preservation number is CGMCC No. 32309.

2. The use of the Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 as claimed in claim 1 in the preparation of a product for inhibiting plant pathogenic bacteria.

3. The use of the Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 as claimed in claim 2 in the preparation of a product for inhibiting plant pathogenic bacteria, characterized in that, The plant pathogens include one or more of Epicoccum sorghinum Epicoccum sorghinum Epicoccum nigrum Epicoccum nigrum Alternaria tenuissima Alternaria tenuissima Alternaria alternata Alternaria alternata Stagonosporopsis cucurbitacearum Pleospora cucumerina Pseudopithomyces chartarum Pithomyces chartarum Fusarium asiaticum Fusarium asiaticum Cladosporium pseudocladosporioides Cladosporium pseudocladosporioides Neopestalotiopsis rosae Pestalotiopsis rosae ).

4. A microbial inoculant, characterized in that, Including Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 and its bacterial suspension or fermentation broth.

5. The use of the microbial inoculant as claimed in claim 4 in the preparation of a product for inhibiting plant pathogenic bacteria.

6. The use of the microbial inoculant as claimed in claim 5 in the preparation of a product for inhibiting plant pathogenic bacteria, characterized in that, The plant pathogens include Epichloe sorghi( Epicoccum sorghinum ), Epichloe nigra( Epicoccum nigrum ), Alternaria tenuissima( Alternaria tenuissima ), Alternaria alternata( Alternaria alternata ), Pleospora cucumerina( Stagonosporopsis cucurbitacearum ), Pseudopeziza sp.( Pseudopithomyces chartarum ), Fusarium asiaticum( Fusarium asiaticum ), Cladosporium pseudocladosporioides( Cladosporium pseudocladosporioides ), Pestalotiopsis rosae( Neopestalotiopsis rosae ) or one or more of them.

7. A biocontrol inoculant for controlling Alternaria tenuissima leaf spot of Lonicera caerulea, characterized in that, Including Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp. aurantiaca ) NEAU-L04 and its bacterial suspension.

8. A preparation method of a biocontrol inoculant for controlling Alternaria tenuissima leaf spot of Lonicera caerulea, characterized in that, It includes the following steps: Inoculate Pseudomonas chlororaphis subsp. aurantiaca ( Pseudomonas chlororaphis subsp . aurantiaca ) NEAU-L04 into LB liquid medium and culture until the OD 600 is 0.7 - 0.9 to obtain; The LB liquid medium uses water as a solvent and includes components with the following concentrations: yeast extract powder 4 - 6 g / L, tryptone 9 - 11 g / L, sodium chloride 4 - 6 g / L.

9. A method for controlling Alternaria tenuissima leaf spot of Lonicera caerulea, characterized in that, It includes the following steps: Dilute the biocontrol agent and then spray and / or irrigate the roots of Lonicera caerulea. The biocontrol agent is the biocontrol agent described in claim 7 or the biocontrol agent prepared according to the preparation method described in claim 8.

10. The method as claimed in claim 9, characterized in that, The dilution multiple of the biocontrol agent is 50 - 150 times.

Images