Application of glycosyl hydrolase BnaGH in regulating 1000-grain weight

Through CRISPR/Cas9 gene editing technology, the BnaA09.GH and BnaC08.GH genes were targeted, and the problem of regulating the weight of 1,000 rapeseed was solved, and the significant increase in the weight of 1,000 rapeseed was achieved, providing a theoretical basis and genetic resource for high-yield rapeseed breeding.

CN120173916BActive Publication Date: 2025-07-11YAZHOUWAN NATIONAL LABORATORY
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510661684.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-22
Publication Date
2025-07-11
Estimated Expiration
2045-05-22

AI Technical Summary

Technical Problem

The genetic basis of rapeseed 100-grain weight is complex, and it is significantly affected by the environment, and it is difficult to improve breeding. In the existing research, the number of localized 100-grain weight related QTLs in rapeseed is limited, and the mechanism of action of GH1 family genes in seed development has not yet been clarified.

Method used

利用CRISPR/Cas9基因编辑技术,靶向油菜中BnaA09.GH和BnaC08.GH基因,降低其糖基水解酶的含量或活性,从而调控油菜千粒重,提高油菜产量。

Benefits of technology

By knocking out the BnaA09.GH and BnaC08.GH genes, the weight of rapeseed 100 grains has increased significantly, providing the theoretical basis and genetic resources for the creation and breeding of high-yield rapeseed germplasm, and supporting the selection and breeding of high-yield rapeseed varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173916B_ABST
    Figure CN120173916B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of glycosyl hydrolase BnaGH in regulating 1000-grain weight, belonging to the technical field of genetic engineering. The present invention provides the application of glycosyl hydrolase BnaGH or its coding gene, or the related biological material of the coding gene in regulating the 1000-grain weight of rapeseed or cultivating high-yield rapeseed. The present invention finds through research that the BnaGH gene (BnaA09.GH and BnaC08.GH) in rapeseed can regulate the 1000-grain weight of rapeseed, and the gene knockout mutant can cause a significant increase in the 1000-grain weight of rapeseed. By using this gene, the 1000-grain weight of rapeseed can be increased, and high-yield rapeseed germplasm can be obtained. The present invention provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasm, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of glycosyl hydrolase BnaGH in regulating 1000-grain weight. Background Art

[0002] 1000-grain weight is one of the key limiting factors for increasing the yield per unit area of rapeseed. Its genetic basis is complex, significantly affected by the environment, with low heritability and great difficulty in breeding improvement. Existing studies have shown that 1000-grain weight is co-regulated by multiple signaling pathways, including ubiquitination modification, hormone signaling, cell cycle regulation, and transcriptional regulation, etc. In model crops such as rice and wheat, a number of key genes have been cloned, such as GW2, DEP1, and OsSPL13 in rice, revealing the core role of cell proliferation and seed swelling in grain weight formation. In contrast, rapeseed is an allopolyploid crop, with highly redundant genomes and subgenome differentiation, and the grain weight regulation mechanism is more complex. Currently, more than 100 QTLs related to 1000-grain weight have been mapped in rapeseed, but the number of cloned genes is limited, only covering pathways such as hormone signaling, cell division, and developmental regulation, such as BnARF18, BnaCYP78A9, and BnDA1, etc.

[0003] β-glucosidases in plants mainly belong to the GH1, GH3, GH5, and GH16 glycoside hydrolase families, among which the members of the GH1 family are the most abundant, and 48, 40, and 26 genes have been identified in Arabidopsis thaliana, rice, and maize, respectively. The proteins of this family usually contain conserved functional domains (such as RFSIWSRIFP and TF / LNEP), and their core catalytic module releases glucose by hydrolyzing β-1,4-glycosidic bonds, participating in processes such as plant hormone activation, cell wall remodeling, and stress response. Currently, the functions of some GH1 members have been analyzed: AtBGLU45 / 46 in Arabidopsis thaliana regulates the formation of secondary cell walls by degrading lignin monomer glycosides; AtBGLU26 (PEN2) specifically cleaves glucosinolates (I3G / 4MI3G), mediating the synthesis of antibacterial metabolites to resist pathogen invasion; while AtBG1 regulates the drought response of plants by activating the abscisic acid precursor (ABA-GE). Nevertheless, the in vivo substrates and functions of most GH1 genes have not been elucidated, especially the mechanism of their action in key agronomic traits such as seed development remains to be studied urgently.

[0004] In addition, phylogenetic analysis showed that Arabidopsis BGLU27 was most closely related to the key enzyme BGLU26 (PEN2) in glucosinolate metabolism, but their expression patterns and functions were significantly differentiated - BGLU26 was induced by pathogens, while BGLU27 was highly specifically expressed in seeds. This indicates that there is no obvious pattern in the regulatory role of GH genes in plants. Current research on the functions of GH genes mostly focuses on the dynamic regulation of cell walls. For example, maize ZmBGLU17 affects endosperm development through lignin metabolism, while there is no report on BnaGH regulating the formation of 1000-grain weight. Summary of the Invention

[0005] The object of the present invention is to provide the application of glycosyl hydrolase BnaGH in regulating the 1000-grain weight to solve the problems existing in the above-mentioned prior art. The present invention has found that the BnaGH genes (BnaA09.GH and BnaC08.GH) in rapeseed can regulate the 1000-grain weight of rapeseed. The knockout mutants of this gene can cause a significant increase in the 1000-grain weight of rapeseed. Using this gene can increase the 1000-grain weight of rapeseed and obtain high-yield rapeseed germplasm. The present invention provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasm, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the application of glycosyl hydrolase BnaGH or its coding gene, or related biological materials of the coding gene in regulating the 1000-grain weight of rapeseed or cultivating high-yield rapeseed. The glycosyl hydrolase BnaGH includes BnaA09.GH with an amino acid sequence shown in SEQ ID NO.3 and BnaC08.GH with an amino acid sequence shown in SEQ ID NO.4;

[0008] The coding gene includes the BnaA09.GH gene with a nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.GH gene with a nucleotide sequence shown in SEQ ID NO.2;

[0009] The related biological materials are gene editing tools, gene editing vectors, tool enzymes or recombinant microorganisms.

[0010] Those skilled in the art can understand that the relevant biological materials described in the present invention include gene editing tools (including but not limited to CRISPR-Cas9, ZFNs, TALENs), gene editing vectors (including but not limited to plasmids, phages, viral vectors, artificial chromosomes), tool enzymes (including but not limited to restriction enzymes, ligases, polymerases), recombinant microorganisms (including but not limited to Escherichia coli, yeast, Agrobacterium), etc. The technical effects do not depend on the limitation of specific biological materials. Based on the general principle of gene editing technology, any biological material that can achieve targeted DNA sequence recognition, cleavage, and editing can be applied to the present invention and achieve the same technical effects.

[0011] Further, the relevant biological material is the CRISPR / Cas9 gene editing vector encoding the gene or a recombinant microorganism containing the CRISPR / Cas9 gene editing vector.

[0012] Further, the method for regulating the thousand-seed weight of rapeseed is as follows: Using the CRISPR / Cas9 gene editing technology, simultaneously editing the BnaA09.GH gene and the BnaC08.GH gene, causing the loss of function of the BnaA09.GH gene and the BnaC08.GH gene, reducing the content or activity of the glycosyl hydrolase BnaGH, and increasing the thousand-seed weight of rapeseed.

[0013] Further, the method for cultivating high-yield rapeseed is as follows: Using the CRISPR / Cas9 gene editing technology, simultaneously editing the BnaA09.GH gene and the BnaC08.GH gene to obtain high-yield rapeseed plants with the loss of function of the BnaA09.GH gene and the BnaC08.GH gene and the reduction of the content or activity of the glycosyl hydrolase BnaGH.

[0014] The present invention also provides a CRISPR / Cas9 gene editing vector for the glycosyl hydrolase BnaGH encoding gene. The construction method of the CRISPR / Cas9 gene editing vector includes the following steps:

[0015] (1) Screening out gene editing targets as shown in SEQ ID NO.5 and SEQ ID NO.6 according to the glycosyl hydrolase BnaGH encoding gene;

[0016] (2) Designing primers as shown in SEQ ID NO.7-10 according to the gene target genes;

[0017] (3) Using the pCBC-DT1T2 plasmid as a template, amplifying the target gene with the primers; connecting the target gene to the CRISPR / Cas9 vector to obtain the CRISPR / Cas9 gene editing vector;

[0018] The glycoside hydrolase BnaGH-encoding gene includes the BnaA09.GH gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.GH gene with the nucleotide sequence shown in SEQ ID NO.2.

[0019] The present invention also provides a recombinant microorganism containing the above CRISPR / Cas9 gene editing vector.

[0020] The present invention also provides a method for increasing the 1000-seed weight of rapeseed, including the step of introducing the above CRISPR / Cas9 gene editing vector or the above recombinant microorganism into rapeseed to cause the loss of function of the glycoside hydrolase BnaGH-encoding gene so as to increase the 1000-seed weight of rapeseed;

[0021] The glycoside hydrolase BnaGH-encoding gene includes the BnaA09.GH gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.GH gene with the nucleotide sequence shown in SEQ ID NO.2.

[0022] The present invention also provides a method for cultivating high-yield rapeseed, including the step of introducing the above CRISPR / Cas9 gene editing vector or the above recombinant microorganism into rapeseed to obtain a high-yield rapeseed plant with the loss of function of the glycoside hydrolase BnaGH-encoding gene;

[0023] The glycoside hydrolase BnaGH-encoding gene includes the BnaA09.GH gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.GH gene with the nucleotide sequence shown in SEQ ID NO.2.

[0024] The present invention also provides a mutant gene of the glycoside hydrolase BnaGH-encoding gene for increasing the 1000-seed weight of rapeseed, and the mutant gene is gh-1 or gh-2;

[0025] The gh-1 includes the BnaA09.GH mutant gene with the nucleotide sequence shown in SEQ ID NO.17 and the BnaC08.GH mutant gene with the nucleotide sequence shown in SEQ ID NO.18;

[0026] The gh-2 includes the BnaA09.GH mutant gene with the nucleotide sequence shown in SEQ ID NO.19 and the BnaC08.GH mutant gene with the nucleotide sequence shown in SEQ ID NO.20.

[0027] The present invention also provides the application of the above mutant gene in regulating the 1000-seed weight of rapeseed or cultivating high-yield rapeseed.

[0028] The present invention discloses the following technical effects:

[0029] The research of the present invention has found that the BnaGH genes (BnaA09.GH and BnaC08.GH) in rapeseed can regulate the 1000-seed weight of rapeseed. The gene knockout mutants can cause a significant increase in the 1000-seed weight of rapeseed. By using this gene, the 1000-seed weight of rapeseed can be increased, and high-yield rapeseed germplasms can be obtained. The present invention reveals the regulatory mechanism of the rapeseed BnaGH gene in regulating the 1000-seed weight and yield, provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasms, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties. Brief Description of the Drawings

[0030] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0031] Figure 1 It is an analysis diagram of the expression pattern of the BnaGH gene in different development stages of rapeseed seeds;

[0032] Figure 2 It is a target position diagram of the BnaGH gene and a gene structure diagram of the BnaGH mutant material; wherein, A is the target position of the BnaGH gene; B is the gene structure diagram of the BnaGH mutant material;

[0033] Figure 3 It is a statistical analysis result diagram of the 1000-seed weight of wild-type rapeseed (WT) and rapeseed BnaGH mutant materials (gh-1 and gh-2). Detailed Embodiments

[0034] Now, various exemplary embodiments of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0035] It should be understood that the terms described in the present invention are only for describing specific embodiments and are not used to limit the present invention.

[0036] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0037] Without departing from the scope or spirit of this invention, various improvements and changes can be made to the specific embodiments of the specification of this invention, which are obvious to those skilled in the art. Other embodiments obtained from the specification of this invention are obvious to those skilled in the art. The specification and examples of this invention are merely exemplary.

[0038] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0039] For the experimental methods involved in the following examples, unless otherwise specified, they are all conventional experimental methods in the art; for the materials or reagents involved, unless otherwise specified, they can all be purchased from conventional channels.

[0040] Example 1 Expression Pattern of BnaGH Gene

[0041] Research shows that in the Westar variety genome, the BnaGH gene is distributed on chromosomes A09, C08, and C02 in single-copy form, with corresponding gene numbers BnaA09.GH (BnaA09T0530800WE), BnaC08.GH (BnaC08G0360700WE), and BnaC02.GH (BnaC02T0506300WE). In the Shuang 11 rapeseed variety, the BnaGH gene is scattered on six chromosomes, namely A09, C08, A04, A07, C04, and C03. To more comprehensively analyze the expression pattern of the BnaGH gene, this example uses Shuang 11 rapeseed as the research object. During the period from 14 days after pollination (14 DAP) to 64 days after pollination (64 DAP) of seed development, developing seeds are collected once every day, with three biological replicates set at each time point. Total RNA is extracted, a library is constructed, and clean reads are aligned to the ZS11 reference genome using HISAT2. StringTie is used to quantify gene expression (TPM); finally, the time-series expression of BnaA09.GH and BnaC08.GH is visualized as a line graph based on the TPM matrix to reveal the expression pattern of the target gene during the entire seed development process. The results are as Figure 1As shown, the results show that BnaA09.GH and BnaC08.GH are highly expressed in developing seeds, while the expression level of BnaC02.GH remains low.

[0042] Based on the above analysis results of the expression patterns of BnaGH genes, the present invention focuses on two genes, BnaA09.GH and BnaC08.GH, and will further study their correlation with rapeseed yield. The nucleotide sequences of the selected BnaA09.GH and BnaC08.GH are shown as SEQ ID NO.1 (1899bp) and SEQ ID NO.2 (1983bp), respectively, and the encoded protein sequences are shown as SEQ ID NO.3 (632aa) and SEQ ID NO.4 (661aa), respectively.

[0043] SEQ ID NO.1:

[0044]

[0045] SEQ ID NO.2:

[0046]

[0047] SEQ ID NO.3:

[0048] MAEAQYVRAKTAVWWDIENCQVPKGVDAHGIAQNISSALEKMNYLGTVSISAFGDTNRIPPAIQQALNSTGIALNHVPAGAKDASDKKILVNMFCWALDNPAPANFMLISGDRDFSDALHQLRLRRYNVLLAQPRKASVPLVHAARTVWLWTSLSAGGMPLSKSESLQLIANAPTQECVPSSQPQDSNKFKAKYLPKPPPPAPNNYQQRQQQQNTQGKLIKKPHELFRISEPSSSTTIPAPPILPTTNVNAMSNPQNQYNYAPRPGPYPPRQPYHNPDPSWNNGGSIPNYYPNASRPGSPNMRPPYGNVFRPYRPENLHPPMNNGFRPRNDGPRFMTPPDLSNLSVSQYPSQTQTQNRPNFYPQVRQEFRPKMESSSSSLSLNSGNKVYLPRSSSAPVTSTTTTTVNTTNSTTHGVSPPQPPVVTSGSGSSNGTWGTTQECPQPPSEYVQGLIGVILHALNILKTEKVSPTEPNISDCIQYGDPKHHGTDVKKALESAAEHQMIMVVNMGKLKLYLVKDEPLWNCVNPLGGNPKQYPKAAWDRLHQFLTSSSGRVAIMATQCRYEAAQILKKQCLKEYAIGDIVQILDITATWKKWITYNQTGWKPITVNLAAAETTNKKATETVTGIQPVV。

[0049] SEQ ID NO.4:

[0050] MNAAGEGDVETKPTMVVAAEEMAEAQYVRAKTAVWWDIENCQVPKGVDAHGIAQNISSALEKMNYLGTVSISAFGDTNRIPPAIQQALNSTGIALNHVPAGAKDASDKKILVNMFCWALDNPAPANFMLISGDRDFSDALHQLRLRRYNVLLAQPRKASVPLVHAARTVWLWTSLSAGGMPLSKSESLQLIANAPTQECVPSSQPQDSNKFKAKYLPKPPPPAPNNYQRQQQQNSQGKLIKKPHELFRGSEPSSSTTIPAPPILPTTNVNTFTGNNAMSNPQNQYNYAPRPGPYPHRQPYPNPDPSWNNGSSIPNYYPNASRPGAPNMRPPYGNVFRPYRPENLHPPMNNGFRPRNDGPRFMSPPDLSNLSVSQYPSQTQTQTQNRPNFYPQVRQEFRPKMESSSSSLSLNSGNKVYLPRSTSAPVTSTTTTTVNTTNSTTHGVSAPQPPVVTSGSGSSNGTWGTTQECPQPPSEYVQGLIGVILHALNILKTEKVSPTEPNISDCIQYGDPKHHGTDVKKALESAAEHQMIMVVNMGKLKLYLVKEEPLWNCVNPLGGNPKQYPKAAWDRLHQFLTSSSGRVAIMATQCRYEAAQILKKQCLKEYAIGDIVRILDITASWKKWITYNQTGWKPITVNLAAAETTNKKATETVTGIQPVA。

[0051] Example 2 Construction of Brassica napus BnaGH Mutant Materials

[0052] 1. Construction of BnaGH-CRISPR Vector

[0053] The BnaGH-CRISPR vector was created using the sgRNA-Cas9 system of the team led by Chen Qijun from the College of Biological Sciences, China Agricultural University. The specific operation process is as follows:

[0054] (1)Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / , screen out the target sgRNAs sgRNA1 and sgRNA2, which are located in the second and third exon regions of the BnaA09.GH gene and the BnaC08.GH gene respectively. sgRNA1 and sgRNA2 can target the BnaA09.GH gene and the BnaC08.GH gene (these two genes are highly expressed in developing seeds), as shown in Figure 2 A of

[0055] sgRNA1: TCCGGCGATTCAGCAAGCT (SEQ ID NO.5);

[0056] sgRNA2: CTGGGCGTGTGGCGATTAT (SEQ ID NO.6).

[0057] (2)Design the following primers according to the target:

[0058] DT1-BsF: ATATATGGTCTCGATTGTACGTGAGGGCGAAGACGGGTT (SEQ ID NO.7);

[0059] DT1-F0: TGTACGTGAGGGCGAAGACGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.8);

[0060] DT2-R0: AACGGTTGCTGTTATATCCAAGCAATCTCTTAGTCGACTCTAC (SEQ ID NO.9);

[0061] DT2-BsR: ATTATTGGTCTCGAAACGGTTGCTGTTATATCCAAGCAA (SEQ ID NO.10).

[0062] (3)PCR amplification: Perform four-prime PCR amplification using the pCBC-DT1T2 plasmid diluted 100 times as the template. DT1-BsF and DT2-BsR are at normal primer concentrations; DT1-F0 and DT2-R0 are diluted 20 times. The amplification system is shown in Table 1. PCR amplification program: Total denaturation at 94°C for 2 min; denaturation at 98°C for 15 sec, annealing at 56°C for 30 sec, extension at 68°C for 30 sec, 34 cycles; total extension at 68°C for 5 min.

[0063] Table 1 Amplification system

[0064]

[0065] (4)Purify and recover the PCR product, and establish the digestion-ligation system as shown in Table 2. The reaction conditions are: 37°C for 5 h, 50°C for 5 min, and 80°C for 10 min. After the reaction, collect the recombinant vector.

[0066] Table 2 Digestion-ligation system

[0067]

[0068] (5)Transform Escherichia coli DH5α: Take 5 μL of the transformed Escherichia coli competent cells and transfer the recombinant vector into Escherichia coli. Screen for positive clones on the Kan plate, and identify and sequence them by PCR. The vector with correct sequencing is the BnaGH-CRISPR vector.

[0069] (6)Introduce the BnaGH-CRISPR vector with correct sequencing into the Agrobacterium strain GV3101, and select positive monoclonal colonies for storage in an -80°C refrigerator. The introduction method is as follows:

[0070] a. Wash the electroporation cuvette: First wash it with pure water, then with ultrapure water, pour out the water, then wash it with absolute ethanol (pipette with a 1 ml pipette tip), pour out the absolute ethanol, and place it in the laminar flow hood to dry.

[0071] b. Take 50 μL of Agrobacterium competent cells GV3101.

[0072] c. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of the competent cells, gently pipette and mix well to avoid generating bubbles.

[0073] d. Place the washed and dried electroporation cuvette on ice for pre-cooling, and then pipette the above mixture along the wall of the cuvette.

[0074] e. Set the electroporator to 1800 V.

[0075] f. Take the electroporation cuvette out of the ice and wipe the outer wall of the cuvette with absorbent paper.

[0076] g. Put the electroporation cuvette into the instrument and press the "push" button twice continuously. If you hear a "beep" sound after a few seconds, it is successful.

[0077] h. After successful electroporation, add 400 μL of antibiotic-free LB to the electroporation cuvette, pipette a few times, and transfer it to a sterile centrifuge tube.

[0078] i. Activate at 28°C for 2 h, take 100 μL and spread it on a plate containing double antibiotics, seal it with a sealing film, invert it and culture it in a 28°C incubator for 2 days, and pick colonies for detection.

[0079] (7)Agrobacterium colony detection

[0080] Pick positive colonies into LB medium containing double antibiotics and culture at 28 °C for 2 hours. Take an appropriate amount of bacterial liquid for PCR detection and preserve the positive Agrobacterium liquid.

[0081] 2. Genetic transformation experiment

[0082] (1) Genetic transformation of rapeseed

[0083] Using Brassica napus Westar as the recipient plant, the positive Agrobacterium (containing the BnaGH-CRISPR vector) constructed in the above process was transferred into the recipient plant by the Agrobacterium-mediated genetic transformation method. For the specific operation process, please refer to the reference (Dai C, Li Y, Li L, et al. An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus [J]. Molecular Breeding, 2020, 40(10). DOI: 10.1007 / s11032-020-01174-0.).

[0084] (2) Identification of CRISPR-transformed single plants

[0085] The obtained rapeseed CRISPR-transformed single plants were sequenced to screen for rapeseed mutants. First, the Cas9 protein was identified using the primer pair Cas9-570-F / Cas9-570-R. Then, for the single plants positive for Cas9 protein identification, specific amplification and sequencing identification of the target gene were performed using the primer pairs GH(A09 / C08)-CRISPR-F1 / GH(A09 / C08)-CRISPR-R1 and GH(A09 / C08)-CRISPR-F2 / GH(A09 / C08)-CRISPR-R2.

[0086] The sequences of each primer are as follows:

[0087] Cas9-570-F: 5’-AGACCGTGAAGGTTGTGGAC-3’ (SEQ ID NO.11);

[0088] Cas9-570-R: 5’-TAGTGATCTGCCGTGTCTCG-3’ (SEQ ID NO.12);

[0089] GH(A09 / C08)-CRISPR-F1: 5’- GCCCTGGAGAAGATGAACTATCTC-3’ (SEQ ID NO.13);

[0090] GH(A09 / C08)-CRISPR-R1: 5'-TTGCTGCTGACGTTGTTGGTAG-3' (SEQ ID NO.14);

[0091] GH(A09 / C08)-CRISPR-F2: 5'-CAAACTCAAACTCAGAATCG-3' (SEQ ID NO.15);

[0092] GH(A09 / C08)-CRISPR-R2: 5'-GTTGCTGTTATATCCAAGATCT-3' (SEQ ID NO.16).

[0093] The amplification method is as follows:

[0094] The PCR reaction system is: 2×Taq Master Mix 20 μL, DNA template 2 μL, F primer 1.6 μL, R primer 1.6 μL, supplemented with ddH2O to 40 μL. The PCR reaction conditions are: total denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 30 sec, for 34 cycles; total extension at 72°C for 5 min.

[0095] The PCR products of the amplified target fragments were sequenced, and the sequencing results were analyzed for the editing of the target sites using the online website DSDecode (http: / / skl.scau.edu.cn / dsdecode / ). Finally, two independent mutant lines in which two homologous genes of BnaGH (BnaA09.GH and BnaC08.GH) were edited were obtained, named gh-1 and gh-2, and their sequencing results are as shown in Figure 2 Figure B. By sequencing, the nucleotide sequence of the BnaA09.GH gene of gh-1 is shown in SEQ ID NO.17, and the nucleotide sequence of the BnaC08.GH gene is shown in SEQ ID NO.18. The nucleotide sequence of the BnaA09.GH gene of gh-2 is shown in SEQ ID NO.19, and the nucleotide sequence of the BnaC08.GH gene is shown in SEQ ID NO.20. The two independent mutant lines are loss-of-function mutants of the BnaGH gene.

[0096] SEQ ID NO.17:

[0097]

[0098] SEQ ID NO.18:

[0099]

[0100] SEQ ID NO.19:

[0101]

[0102] SEQ ID NO.20:

[0103]

[0104] Example 3 Phenotypic Analysis of Wild-Type and Mutant Materials

[0105] The wild-type rapeseed (WT) and rapeseed BnaGH mutant materials (gh-1 and gh-2) were planted until harvest. Using the SC-G type automatic seed analyzer, the thousand-seed weight analysis of rapeseed seeds harvested at maturity was carried out to obtain the thousand-seed weight data of wild-type and mutant materials. The measuring instrument was provided by the National Rapeseed Engineering and Technology Research Center of Huazhong Agricultural University.

[0106] The results of the thousand-seed weight analysis are as Figure 3 shown. The thousand-seed weight of wild-type rapeseed (WT) was 3.48 ± 0.50 g, and the thousand-seed weights of mutant materials gh-1 and gh-2 were 4.25 ± 0.98 g and 4.14 ± 0.50 g, respectively. The results of statistical analysis showed that the thousand-seed weights of the two mutant materials were significantly higher than that of the wild-type. It is indicated that the two homologous genes of BnaGH (BnaA09.GH and BnaC08.GH) have the function of regulating the thousand-seed weight of rapeseed, providing a theoretical support for further in-depth study of the action mechanism of rapeseed yield, and also laying a foundation for the creation and cultivation of high-yield rapeseed varieties.

[0107] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. Use of the gene encoding glycosyl hydrolase BnaGH in increasing the 1000-seed weight of rapeseed or cultivating rapeseed with increased 1000-seed weight, characterized in that, The glycoside hydrolase BnaGH is BnaA09.GH with the amino acid sequence shown in SEQ ID NO.3 and BnaC08.GH with the amino acid sequence shown in SEQ ID NO.4; The encoding genes are the BnaA09.GH gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.GH gene with the nucleotide sequence shown in SEQ ID NO.2; The method for increasing the 1000-seed weight of rapeseed is as follows: Using the CRISPR / Cas9 gene editing technology, editing the BnaA09.GH gene and the BnaC08.GH gene simultaneously to cause the loss of function of the BnaA09.GH gene and the BnaC08.GH gene.

2. The application according to claim 1, wherein The method for increasing the 1000-seed weight of rapeseed is as follows: Using the CRISPR / Cas9 gene editing technology, editing the BnaA09.GH gene and the BnaC08.GH gene simultaneously to cause the loss of function of the BnaA09.GH gene and the BnaC08.GH gene, reducing the content or activity of the glycoside hydrolase BnaGH, and increasing the 1000-seed weight of rapeseed.

3. The application according to claim 1, wherein The method for cultivating rapeseed with increased 1000-seed weight is as follows: Using the CRISPR / Cas9 gene editing technology, editing the BnaA09.GH gene and the BnaC08.GH gene simultaneously to obtain rapeseed plants with increased 1000-seed weight in which the BnaA09.GH gene and the BnaC08.GH gene have lost their functions and the content or activity of the glycoside hydrolase BnaGH is reduced.

4. A CRISPR / Cas9 gene editing vector for the glycosyl hydrolase BnaGH encoding gene, characterized in that, The method for constructing the CRISPR / Cas9 gene editing vector includes the following steps: (1) Screening out gene editing targets shown in SEQ ID NO.5 and SEQ ID NO.6 according to the glycoside hydrolase BnaGH encoding gene; (2) Designing primers shown in SEQ ID NO.7-10 according to the gene editing targets; (3) Using the pCBC-DT1T2 plasmid as a template, amplifying the target gene with the primers; connecting the target gene to the CRISPR / Cas9 vector to obtain the CRISPR / Cas9 gene editing vector; The glycoside hydrolase BnaGH encoding genes are the BnaA09.GH gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.GH gene with the nucleotide sequence shown in SEQ ID NO.

2.

5. Use of the CRISPR / Cas9 gene editing vector according to claim 4 in increasing the 1000-seed weight of rapeseed or cultivating rapeseed with increased 1000-seed weight.

6. A recombinant microorganism containing the CRISPR / Cas9 gene editing vector according to claim 4.

7. A method for increasing the thousand-seed weight of rapeseed, characterized in that, It includes the step of introducing the CRISPR / Cas9 gene editing vector according to claim 4 or the recombinant microorganism according to claim 6 into rapeseed to cause the loss of function of the glycoside hydrolase BnaGH encoding gene to increase the 1000-seed weight of rapeseed; The recombinant microorganism is Agrobacterium; The glycoside hydrolase BnaGH-encoding gene is the BnaA09.GH gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.GH gene with a nucleotide sequence as shown in SEQ ID NO.

2.

8. A method for cultivating rapeseed with increased 1000-grain weight, characterized in that, It includes the step of introducing the CRISPR / Cas9 gene editing vector described in claim 4 or the recombinant microorganism described in claim 6 into rapeseed to obtain a rapeseed plant with increased 1000-grain weight and loss of function of the glycoside hydrolase BnaGH-encoding gene. The recombinant microorganism is Agrobacterium. The glycoside hydrolase BnaGH-encoding gene is the BnaA09.GH gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.GH gene with a nucleotide sequence as shown in SEQ ID NO.2.

Citation Information

Patent Citations

  • Use of trehalose-6-phosphate synthase to modulate plant growth

    CN101374952A

  • Modulation of huntingtin expression

    CN111705058A