A cellulase mutant

By performing V45A single point mutation on cellulase, its specific vitality under 50°C is improved, the problem of high production cost of cellulase is solved, and its application in the industrial field is promoted.

CN120173922BActive Publication Date: 2025-09-02WEIFANG KANGDIEN BIOTECH LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510673747.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-23
Publication Date
2025-09-02
Estimated Expiration
2045-05-23

AI Technical Summary

Technical Problem

The production cost of existing cellulases is high and it is difficult to widely use in the industrial field.

Method used

By mutating the amino acid sequence of the cellulase, especially mutating the 45th position Val to Ala, V45A single point mutant is formed, and its specific vitality at 50°C is improved.

Benefits of technology

The specific vitality of cellulase mutants is increased by 22.78%, reducing production costs and contributing to their widespread use in the industrial field.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present invention relates to the fields of genetic engineering and protein engineering, and more specifically to a cellulase mutant. Compared to wild-type cellulase, the V45A single-point mutant provided by the present invention exhibits a 22.78% increase in specific activity at 50°C, effectively reducing cellulase production costs and enzyme usage, thereby promoting its widespread industrial application.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering and protein engineering, and in particular to a cellulase mutant. Background Art

[0002] Lignocellulose is the most abundant renewable resource in nature, primarily composed of cellulose (40-50%), hemicellulose (20-30%), and lignin (15-25%). Cellulose is a linear polymer of glucose linked by β-1,4-glycosidic bonds, forming a highly crystalline microfibril structure; hemicellulose is a heterogeneous polysaccharide containing monomers such as xylose and mannose; and lignin is a complex aromatic polymer composed of phenylpropane units, covalently cross-linked with carbohydrates to form a dense barrier. This complex structure makes lignocellulose extremely resistant to degradation, a major bottleneck in its industrial utilization.

[0003] Traditional degradation methods (such as acid / alkaline treatment, high temperature and high pressure) suffer from high energy consumption, high pollution, and product inhibition. In contrast, enzymatic degradation has become a research hotspot due to its mild conditions, high specificity, and environmental friendliness. Cellulase is the core catalyst in this process.

[0004] Cellulase is a complex induced enzyme system composed of multiple hydrolases. It refers to a group of enzymes that can degrade cellulose to produce small molecules such as cellobiose and glucose. It can directly degrade cellulose, the most abundant component of wood cellulose, into energy that can be directly utilized. It has been widely used in food processing, textile industry, paper production, feed additives, biofuel manufacturing, detergents and other industries, and has important industrial value.

[0005] Cellulase production currently relies primarily on microbial fermentation, using enzyme-producing strains such as bacteria, fungi, and actinomycetes. Among these, filamentous fungi such as Trichoderma (such as Trichoderma reesei) and Aspergillus (such as Aspergillus niger) have become the mainstream industrial strains due to their high enzyme production. Production utilizes both solid-state fermentation and submerged fermentation, the latter being more amenable to scalable control. In recent years, genetic engineering and metabolic engineering techniques have significantly improved enzyme production efficiency, helping to reduce cellulase production costs and promote its widespread application. Summary of the Invention

[0006] In view of this, the present invention provides a cellulase mutant. Compared with the wild type, the mutant has significantly improved specific activity, which can effectively reduce the production cost of cellulase and promote its wide application in industrial fields such as textiles.

[0007] One aspect of the present invention relates to a cellulase mutant, which is obtained by mutating the 45th amino acid of the cellulase with the amino acid sequence of SEQ ID NO: 1 from Val to Ala.

[0008] The present invention also relates to a DNA molecule encoding the above cellulase mutant.

[0009] The present invention also relates to a recombinant expression plasmid comprising the above DNA molecule.

[0010] The present invention also relates to a host cell comprising the above-mentioned recombinant expression plasmid.

[0011] When the above plasmid is transferred into host cells, the specific activity of the recombinantly expressed cellulase mutant is significantly improved.

[0012] In some embodiments of the present invention, the host cell is Trichoderma reesei ( Trichoderma reesei ).

[0013] Compared with the wild-type cellulase NT45, the V45A single-point mutant provided by the present invention has a specific activity increased by 22.78% at 50°C, achieving an unexpected technical effect.

[0014] The specific activity of the cellulase mutant of the present invention is greatly improved compared with the wild type, which can effectively reduce the production cost of cellulase and the amount of enzyme used, and is conducive to promoting its wide application in the industrial field. DETAILED DESCRIPTION

[0015] The present invention has used the conventional techniques and methods used in genetic engineering and molecular biology fields, for example, the method described in MOLECULAR CLONING: A LABORATORY MANUAL, 3rd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, the present invention is not limited to any of the described concrete methods, experimental protocols and reagents.

[0016] The culture medium formula used in the embodiment of the present invention is as follows:

[0017] LB+Amp medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0;

[0018] Upper medium: 0.1% MgSO4, 1% KH2PO4, 0.6% (NH4)2SO4, 1% glucose, 18.3% sorbitol, 0.35% agarose;

[0019] Lower medium: 2% glucose, 0.5% (NH4)2SO4, 1.5% KH2PO4, 0.06% MgSO4, 0.06% CaCl2, 1.5% agar;

[0020] Fermentation medium: 1.5% glucose, 1.7% lactose, 2.5% corn steep liquor, 0.44% (NH4)2SO4, 0.09% MgSO4, 2% KH2PO4, 0.04% CaCl2, 0.018% Tween 80, 0.018% trace elements.

[0021] The present invention is described in detail below with reference to specific embodiments.

[0022] Example 1 Screening of cellulase mutants

[0023] In order to improve the specific activity of wild-type cellulase NT45 (amino acid sequence of SEQ ID NO: 1, encoding nucleotide sequence of SEQ ID NO: 2), the applicant conducted a large number of mutation screenings on amino acids near the active site of the enzyme.

[0024] Using the wild-type cellulase NT45 gene (SEQ ID NO: 2) as a template, the mutation site was designed using AI technology. Shanghai Sangon Biosynthesis Co., Ltd. synthesized the upstream and downstream primers of the mutation site. The upper and lower arms of the mutation site were PCR amplified using the corresponding primers, and the amplified products were recovered from the gel. The upper arm, lower arm, and vector were connected in a PCR instrument at 50°C for 0.5-1h, transformed into Escherichia coli BL21 (DE3), spread on LB+Amp plates, and cultured inverted at 37°C overnight. After the transformants appeared, they were picked one by one with a toothpick to a 96-well plate, and 150 μL of LB+Amp medium containing 0.1 mM IPTG was added to each well. The cells were cultured at 37°C and 220 rpm for about 6 h. The supernatant was discarded after centrifugation, and the cells were resuspended in buffer and repeatedly frozen and thawed to obtain E. coli cell lysate containing cellulase.

[0025] Take out 50 μL of lysate to two new 96-well plates, measure the cellulase activity and protein content at 50°C, and calculate the specific activity of different mutants.

[0026] Experimental results showed that some mutations had no effect on the specific activity of cellulase at 50°C; some mutations even worsened it. Still others, while improving the specific activity of cellulase, significantly altered its enzymatic properties, failing to meet the requirements. Ultimately, the applicant identified a mutation site, V45A, that significantly improved specific activity at 50°C.

[0027] Based on the wild-type cellulase NT45, the present invention provides a cellulase mutant containing a single mutation site V45A.

[0028] Example 2 Expression of cellulase mutants in Trichoderma reesei

[0029] According to the codon preference of Trichoderma reesei, the gene sequences of wild-type cellulase NT45 and its mutants were optimized and synthesized.

[0030] 2.1 Expression plasmid construction

[0031] Using the cellulase NT45 gene (SEQ ID NO: 2) as a template, Shanghai Sangon Biosynthesis Co., Ltd. synthesized upstream and downstream primers for the mutation site. PCR amplification was performed using the corresponding primers for the upper and lower arms of the mutation site, respectively. The amplified products were recovered from gels and ligated using U-cloning in a PCR instrument at 50°C for 0.5-1 hour. The ligated products were transformed into Escherichia coli DH5α, incubated for 0.5 hour, and then plated on LB+Amp plates and incubated inverted at 37°C overnight. Transformants were then screened by colony PCR. Positive transformants were selected for sequencing. Strains with correct sequencing results were cultured in LB+Amp liquid medium at 37°C and 220 rpm for 14 hours. The plasmid was then extracted using the OMEGA Plasmid Rapid Extraction Kit to obtain a recombinant plasmid containing the target cellulase gene.

[0032] 2.2 Protoplast preparation

[0033] Take a spore suspension of the cellulase gene-deficient host fungus Trichoderma reesei, inoculate it on a PDA plate, and culture it at 30°C for 6 days. After the spores are abundant, cut a colony of approximately 1 cm × 1 cm and place it in a liquid culture medium containing 120 mL of YEG+U (0.5% yeast powder, 1% glucose, 0.1% uridine) and culture it at 30°C and 220 rpm for 14-16 hours. Collect the mycelium by filtering with sterile gauze and wash it once with sterile water. Place the mycelium in a conical flask containing 20 mL of 10 mg / mL lytic enzyme solution (Sigma L1412) and incubate it at 30°C and 90 rpm for 1-2 hours. Observe the progress of protoplast transformation under a microscope.

[0034] Add 20 mL of pre-cooled 1.2 M sorbitol (1.2 M sorbitol, 50 mM Tris-Cl, 50 mM CaCl2) to the above-mentioned conical flask, shake gently, filter the filtrate with sterile Miracloth filter cloth, centrifuge at 3000 rpm, 4 ° C for 10 min; discard the supernatant, add 5 mL of pre-cooled 1.2 M sorbitol solution to suspend the cells, centrifuge at 3000 rpm, 4 ° C for 10 min; discard the supernatant, add appropriate amount of pre-cooled 1.2 M sorbitol to suspend and package (200 μL / tube, the protoplast concentration is 108 cells / mL).

[0035] 2.3 Expression plasmid transformation and strain verification

[0036] All following procedures were performed on ice. 10 μg of recombinant plasmid was added to a sterile 7 mL centrifuge tube containing 200 μL of protoplast solution. Then, 50 μL of 25% PEG (25% PEG, 50 mM Tris-HCl, 50 mM CaCl2) was added. Mix thoroughly by gently flicking the tube bottom and incubate on ice for 20 min. 2 mL of 25% PEG was added, mixed thoroughly, and incubated in a clean hood at room temperature for 5 min. 4 mL of 1.2 M sorbitol was added, mixed gently, and then poured into the melted top layer culture medium maintained at 55°C. After gentle mixing, the culture medium was plated onto the prepared bottom layer culture medium and incubated at 30°C for 5–7 days until transformants emerged. Transformants were screened on the bottom layer culture medium plates and incubated at 30°C for 2 days. Strains with smooth colony edges were considered positive transformants.

[0037] Take an appropriate amount of mycelium and place it in a 2 mL centrifuge tube, add 100 mg of sterile quartz sand and 400 μL of extraction buffer (100 mM Tris-HCl, 100 mM EDTA, 250 mM NaCl, 1% SDS); shake vigorously with a bead beater for 2 min; after a 65 ° C water bath for 20 min, add 200 μL of 10 M NH4AC and ice bath for 10 min; centrifuge at 13000 rpm for 10 min; take the supernatant, add 2 times the volume of anhydrous ethanol, and place at -20 ° C for 30 min; centrifuge at 13000 rpm for 10 min, discard the supernatant; wash twice with 70% ethanol; dry, dissolve in water, and store at -20 ° C.

[0038] The target gene was amplified by PCR using primers M6-F and M6-R using the genomic DNA of the transformants extracted above as a template for verification.

[0039] M6-F: ATGCGCTCCTCCACCATTC (as shown in SEQ ID NO: 3);

[0040] M6-R: TTAGGCGCACTGGTGGTAGTAGTC (as shown in SEQ ID NO: 4).

[0041] The PCR amplification conditions were as follows: 94°C for 4 min; 94°C for 40 s; 58°C for 40 s, 72°C for 1 min, 30 cycles; 72°C for 7 min, 16°C; the PCR amplification products were recovered using a gel recovery kit and sequenced.

[0042] According to the above method, the applicant constructed and obtained engineered strains of Trichoderma reesei that recombinantly expressed cellulase NT45 and its mutants.

[0043] Example 3 Fermentation Verification

[0044] The engineered strain of Trichoderma reesei constructed above was inoculated onto a 6-well PDA plate and cultured at 30°C for 5–7 days. After abundant spore production, spores (approximately 1 cm × 1 cm) were inoculated into a 24-well plate (each well containing 2.5 mL of fermentation medium) using a cotton swab. The plate was incubated at 30°C and 500 rpm for 48 hours and then at 25°C and 500 rpm for an additional 72 hours. The fermentation broth was centrifuged at 4°C and 3700 rpm for 3 minutes to obtain the fermentation supernatant containing cellulase NT45 and its mutants. The cellulase activity and protein content of the supernatant were determined, and specific activity was calculated.

[0045] 3.1 Enzyme activity assay

[0046] (1) Definition of cellulase activity

[0047] At 50°C and pH 6.0, the amount of enzyme required to release 1 μmol of reducing sugar from a 5 mg / ml sodium hydroxymethyl cellulose solution per minute is one enzyme activity unit (U). Reducing sugar is expressed as glucose.

[0048] (2) Cellulase enzyme assay method

[0049] Add 0.5 mL of CMC substrate to each of three test tubes and preheat the test enzyme solution in a 50°C water bath for 5 minutes. Add 0.5 mL of the test solution to each of the first and second test tubes, and incubate at 50°C for 15 minutes while timing. After the reaction is complete, add 1.5 mL of DNS reagent to each of the three test tubes, and add 0.5 mL of the test enzyme solution to the third test tube. Remove and shake all three test tubes, then incubate in a boiling water bath for 5 minutes. Quickly cool to room temperature and bring the volume to 5.0 mL with water. Measure the absorbance of the first and second test tubes at a wavelength of 540 nm, using the solution in the third test tube as a reference. The absorbance should ideally be between 0.25 and 0.35. The absolute difference between the absorbance of the test enzyme solution and the level control enzyme solution should not exceed 0.015.

[0050] Enzyme activity: X = (glucose equivalent value / 180 / 15 / 0.5) × n.

[0051] Where: X——enzyme activity unit, IU / g (mL);

[0052] 180 – Glucose converted from micrograms to micromoles;

[0053] 15——Reaction time between the test solution and the substrate;

[0054] 0.5——the amount of enzyme solution to be tested added to the reaction;

[0055] n——dilution multiple.

[0056] 3.2 Protein content determination

[0057] The Coomassie Brilliant Blue (Bradford) binding assay for protein content determination is a hybrid method combining colorimetry and pigmentation. Coomassie Brilliant Blue G-250 appears brownish-red in acidic solutions and turns blue upon binding to protein. Within a certain protein concentration range, it conforms to Beer's law and can be measured colorimetrically at 595 nm. Substantial absorption occurs within 3-5 minutes and remains stable for at least 1 hour. Within the range of 10-1000 μg / mL, absorbance is directly proportional to protein concentration.

[0058] The enzyme solution and Coomassie Brilliant Blue solution were mixed in a volume ratio of 1:5, allowed to stand for 10 min, and the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method.

[0059] 3.3 Calculation of specific activity

[0060] Specific activity refers to the number of enzyme activity units per unit weight of protein, typically expressed as U / mg protein. Generally speaking, the higher the specific activity of an enzyme, the purer the enzyme.

[0061] The formula for calculating specific activity is: specific activity (U / mg) = enzyme activity (U / mL) / protein content (mg / mL).

[0062] The specific activities of the fermentation supernatant of the engineered Trichoderma reesei bacteria expressing the recombinant cellulase NT45 and its mutants constructed in the present invention at 50°C are shown in Table 1.

[0063] Table 1 Specific activities of cellulase NT45 and its mutants at 50℃

[0064] Cellulase Specific activity at 50℃ (U / mL) Cellulase NT45 180.0 V45A single point mutation 221.0

[0065] From the results in Table 1, it can be seen that compared with the wild-type cellulase NT45, the V45A single-point mutation provided by the present invention has a specific activity increased by 22.78% at 50°C, achieving an unexpected technical effect.

[0066] The specific activity of the cellulase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of the enzyme, thereby promoting its wide application in the industrial field.

Claims

1. A cellulase mutant, characterized in that The mutant is obtained by mutating the 45th amino acid of the cellulase with the amino acid sequence of SEQ ID NO: 1 from Val to Ala.

2. A DNA molecule encoding the cellulase mutant according to claim 1.

3. A recombinant expression plasmid comprising the DNA molecule of claim 2.

4. A host cell, characterized in that The host cell comprises the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, wherein The host cell is Trichoderma reesei ( Trichoderma reesei ).

Citation Information

Patent Citations

  • Low temperature resistant cellulase mutant

    CN112795554A

  • High-specific-activity cellulase mutant and application thereof

    CN112795555A