Application of SlHDT3 gene in regulating drought resistance in tomato

Knocking out the tomato SlHDT3 gene through CRISPR/Cas9 gene editing technology solved the problem of poor growth of tomatoes under drought stress, and cultivated highly drought-tolerant tomato varieties, improving their drought resistance and survival rate.

CN120173971BActive Publication Date: 2025-09-02HAINAN RES INST OF ZHEJIANG UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510646530.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-09-02
Estimated Expiration
2045-05-20

AI Technical Summary

Technical Problem

Tomatoes grow slowly under drought stress, wilt leaves, and poor fruit development. The function and regulatory mechanism of histone deacetylase in tomatoes in the prior art are unclear, which affects its drought resistance.

Method used

The expression of SlHDT3 gene in tomatoes is knocked out or inhibited by CRISPR/Cas9 gene editing technology, and the targeted knockout of the SlHDT3 gene is reduced by using CRISPR/Cas9 vector and sgRNA. Combined with Agrobacterium-mediated genetic transformation methods, highly drought-tolerant tomato varieties are cultivated.

Benefits of technology

The drought tolerance of tomatoes was significantly improved, and mutant plants showed better growth phenotype and survival rate under drought stress, reducing water loss and cell damage, and enhancing drought resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120173971B_ABST
    Figure CN120173971B_ABST
Patent Text Reader

Abstract

The present invention belongs to the field of modern agricultural technology and specifically relates to <h2 style=";text-align:left;direction:ltr">SlHDT3 The present invention discloses an application of a gene in regulating drought resistance of tomatoes. <h2 style=";text-align:left;direction:ltr"> SlHDT3 The application of genes in regulating drought resistance in tomatoes. <h2 style=";text-align:left;direction:ltr"> SlHDT3 Gene overexpression plants, CRISPR / Cas9 gene editing technology was used to construct <h2 style=";text-align:left;direction:ltr"> SlHDT3 A series of experiments showed that the gene knockout mutant had a significant effect on the drought resistance of tomatoes. <h2 style=";text-align:left;direction:ltr"> SlHDT3 The gene knockout mutants had significantly higher survival rates under drought stress than wild-type tomatoes and overexpression plants. Their leaves also showed lower H₂O₂ accumulation, lower MDA content, and lower leaf relative electrical conductivity, thereby improving drought resistance in tomatoes. This research provides an important foundation for the breeding of drought-resistant tomato varieties and research on drought resistance mechanisms.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of modern agricultural technology and specifically relates to SlHDT3 Application of genes in regulating drought resistance in tomato. Background Art

[0002] tomato( Solanum lycopersicum Tomato (tomato) is one of the most important cash crops cultivated worldwide. However, with the intensification of global climate change, drought has become a major limiting factor in tomato yields. Drought stress can lead to slow growth, leaf wilting, poor fruit development, and even death. Therefore, research on methods to improve tomato drought resistance is crucial to ensure stable tomato production and supply.

[0003] In natural environments, plants are able to adapt to a variety of environmental conditions, which is attributed to the combined effects of genetic and epigenetic variation (Grativol C, Hemerly AS, Ferreira P. 2012. Genetic and epigenetic regulation of stress responses in natural plant populations. Biochimica et Biophysica Acta (BBA) -Gene Regulatory Mechanisms, 1819: 176-185). Histone acetylation, as an important epigenetic mechanism, regulates gene expression and participates in plant growth and development and environmental stress responses. Numerous studies have shown that histone acetyltransferases (HATs) and histone deacetylases (HDACs) regulate gene transcription levels by dynamically controlling histone acetylation, playing a key role in plant response to drought stress (Kim JM, ToT K, Ishida J, et al. 2012. Transition of chromatin status during the process of recovery from drought stress in Arabidopsis thaliana . Plant and CellPhysiology, 53: 847-856).

[0004] In Arabidopsis, HDA9 and ABI4 form an inhibitory complex that regulates the expression of CYP707A1 and CYP707A2 under drought stress (Baek D, Shin G, Kim MC, et al. 2020. Histone deacetylase HDA9with ABI4 contributes to abscisic acid homeostasis in drought stress response. Frontiers in Plant Science, 11: 143). In Brachypodium, a homolog of AtHDA19 represses the expression of the drought-responsive gene BdWRKY24 by deacetylation, thereby regulating drought stress resistance mechanisms (Song J, Henry HAL, Tian L. 2019. Brachypodium histone deacetylase BdHD1 positively regulates ABA and drought stress responses. Plant Science, 283: 355-365). In tobacco, overexpression of the histone deacetylase gene HDA903 in the poplar genome can upregulate the expression of drought-responsive genes and enhance the drought resistance of the plant (Ma X, Zhang B, Liu C, et al. 2017. Expression of apopulus histone deacetylase gene 84KHDA903 in tobacco enhances drought tolerance. Plant Science, 265: 1-11). In Arabidopsis, overexpression of AtHD2C (a member of the HD2 subfamily) makes the plant insensitive to ABA and improves the plant's tolerance to drought stress (Sridha S, Wu KQ. 2006. Identification of AtHD2C as a novel regulator of abscisic acid responses in Arabidopsis. Frontiers I in Plant Science, 46(1):124-133).

[0005] Thus, while histone deacetylases have been extensively studied in other species, relatively few reports have been published in tomato. Most studies have focused on the regulation of fruit ripening, while their functions and regulatory mechanisms in response to abiotic stresses, such as drought, remain unclear. Summary of the Invention

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is:

[0007] The first aspect of the present invention provides an inhibitory SlHDT3 Application of genes in improving drought tolerance of tomatoes, including SlHDT3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0008] In some embodiments of the present invention, the inhibition SlHDT3 Gene knockout methods include SlHDT3 Gene, knockdown SlHDT3 Genes, or SlHDT3 Methods for generating inactivating mutations.

[0009] The second aspect of the present invention provides and inhibits SlHDT3 The application of genetically related biological materials in the development of tomato varieties, including SlHDT3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1.

[0010] In some embodiments of the present invention, the application is to construct and inhibit SlHDT3 Genetically related biological materials to obtain tomato varieties with improved drought tolerance.

[0011] In some embodiments of the invention, the biological material does not include propagation material.

[0012] In some embodiments of the present invention, the biological material includes nucleic acid molecules, vectors, and cells.

[0013] In some embodiments of the invention, the nucleic acid molecule comprises an inhibitory SlHDT3 functional microRNA, siRNA, shRNA, dsRNA, sgRNA and / or antisense oligonucleotides.

[0014] In some embodiments of the present invention, the sequence of the sgRNA is shown in SEQ ID NO: 2.

[0015] In some embodiments of the present invention, the sgRNA is used in conjunction with a CRISPR / Cas9 vector to achieve the purpose of gene knockout.

[0016] In some embodiments of the present invention, the CRISPR / Cas9 vector further includes an expression vector containing the sgRNA, and of course may also include a Cas9 protein or an expression vector for expressing the Cas9 protein.

[0017] In some embodiments of the present invention, the vector includes but is not limited to pCAMBIA1301, pAC007 and other common vectors in the art.

[0018] In some embodiments of the present invention, the cell comprises at least one of Escherichia coli and Agrobacterium tumefaciens, wherein Escherichia coli is a common host cell for constructing vectors and plasmids in the art, and Agrobacterium tumefaciens is a common tool for delivering DNA molecules to plants in the art.

[0019] The third aspect of the present invention provides a method for cultivating a tomato variety with high drought tolerance, comprising reducing SlHDT3 The step of measuring the expression level and / or activity of a gene.

[0020] In some embodiments of the present invention, the tomato variety comprises the following characteristics: drought tolerance is increased relative to a reference level; the reference level is the level of the wild type.

[0021] In some embodiments of the present invention, the reduction of SlHDT3 The step of increasing the expression level and / or activity of the gene is to increase the expression level and / or activity of the gene according to the second aspect of the present invention. SlHDT3 Genetically related biological material is introduced into tomato tissue or tomato cells.

[0022] In some embodiments of the present invention, the introduction method comprises using at least one of Ti plasmid, Ri plasmid, plant virus vector, direct DNA transformation, microinjection, and electroporation.

[0023] In some embodiments of the present invention, reducing SlHDT3 The steps for measuring protein expression and / or activity are as follows:

[0024] (1) Design SlHDT3 Gene target sequence sgRNA, construct tomato SlHDT3 CRISPR / Cas9 vectors for gene editing.

[0025] (2) The CRISPR / Cas9 vector described in step (1) is transferred into Agrobacterium competent cells to obtain Agrobacterium containing the CRISPR / Cas9 vector.

[0026] (3) The Agrobacterium infection solution obtained in step (3) was used to infect the cotyledons of common wild-type tomatoes, and seedlings were obtained again through tissue culture. Tomato SlHDT3 A stably inherited mutant strain with a gene mutation, no exogenous Cas9 protein, and a target sequence mutation.

[0027] In some embodiments of the present invention, the vector is pCAMBIA1301.

[0028] In some embodiments of the present invention, the host cell is Agrobacterium GV3101.

[0029] In some embodiments of the present invention, the tomato variety is Condine Red (CR).

[0030] The beneficial effects of the present invention are:

[0031] The present invention discovered SlHDT3 The gene plays a significant role in regulating the drought tolerance of tomatoes. CRISPR / Cas9 gene editing technology was used to knock out the tomato gene. SlHDT3 , and obtained a knockout SlHDT3 A series of experiments have shown that compared with the wild type, SlHDT3 The gene knockout mutant has a better drought-resistant phenotype. Therefore, the present invention provides a new method for breeding drought-resistant tomato varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, in which:

[0033] Figure 1 for SlHDT3 The detection results of gene knockout tomato and overexpression tomato, where A is SlHDT3 The detection results of gene-knockout tomato plants. B is the result of anti-HA protein immunoblotting to identify HDT3 protein overexpressing transgenic positive lines. Ponceau red staining shows the protein loading amount.

[0034] Figure 2 For overexpression, SlHDT3 Knockout and wild-type tomato SlHDT3 Gene expression results.

[0035] Figure 3 The growth status of different types of tomato plants before and after drought treatment; WT, wild type; hdt3 -1#, mutant line 1; hdt3 -2#, mutant line 2; OE- HDT3 -2#, overexpression plant line 2; OE- HDT3 -5#, overexpression plant line No. 5.

[0036] Figure 4 The figures show the survival rate and water loss rate of different types of tomato plants, where A shows the survival rate after drought treatment and B shows the water loss rate of leaves in vitro.

[0037] Figure 5 The DAB and conductivity results of different types of tomato plants, where A is the DAB staining result and B is the conductivity test result.

[0038] Figure 6 Results of H2O2 (A) content and MDA (B) content after drought treatment. DETAILED DESCRIPTION

[0039] The following will clearly and completely describe the concept and technical effects of the present invention in conjunction with the embodiments to fully understand the purpose, features and effects of the present invention. Obviously, the embodiments described are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0040] Example 1 SlHDT3 Obtaining gene knockout plants

[0041] Gene knockout mutants were constructed using CRISPR / Cas9 technology. Tomato was searched from the NCBI (http: / / www.ncbi.nlm.nih.gov / ) database. HDT3 CDS sequence.

[0042] The nucleotide sequence of the S1HDT3 gene is as follows:

[0043]

[0044] Using CRISPR-P ( https: / / www.genome.arizona.edu / crispr / CRISPRsearch.html) design HDT3 The gene sgRNA sequence (CAAGCTCATTCATATTTCTC, SEQ ID NO: 2) was annealed to a double-stranded sgRNA using a PCR instrument. The double-stranded sgRNA was then digested with the Bpi1 restriction endonuclease at 37°C for 30 minutes. The fragment was ligated to the CRISPR / sgRNA vector using T4 ligase. After successful plasmid ligation, the target fragment was then ligated into the pCAMBIA1301 vector using a double digestion with KpnI and HindIII.

[0045] After successful sequencing verification, the pCAMBIA1301-HDT3 vector was electroporated into Agrobacterium tumefaciens GV3101 for tomato genetic transformation. Cotyledons of the wild-type tomato cultivar CR (Condine Red) were infected with Agrobacterium and subsequently cultured to generate complete transgenic tomato plants. Primers were then designed upstream and downstream of the target site based on the location of the target site: cri-HDT3-F (GCAATTGTTTGCCAGATTTTAT, SEQ ID NO: 3) and cri-HDT3-R (ACATCATCTCCAGAGTCAATTTC, SEQ ID NO: 4).

[0046] After obtaining transgenic plants, DNA from T0 leaves was extracted and genomic DNA fragments of approximately 800 bp, including sgRNA, were amplified using PCR technology and sent to the company for sequencing. The sequencing results were compared with the original genome sequence using Snapgene software to screen out mutant plants, which were then self-fertilized to obtain homozygous plants. hdt3 Mutants. Two strains with different mutation types were selected for the following experiments.

[0047] Knockout results are as follows Figure 1 As shown in Figure A, the gene-edited mutant has a base deletion at the sgRNA position compared to a non-gene-edited tomato. The non-gene-edited tomato is referred to as the control. hdt3 #1 inserts one base A compared to the control. hdt3 #2 lacks 7 bases compared to the control.

[0048] Example 2 Overexpression of OE- HDT3 Construction of transgenic materials

[0049] Bundle HDT3The CDS sequence with the stop codon removed and the vector pAC004-HA were input into the software CE Design V1.03 to generate specific amplification primers.

[0050] The pAC007-FLAG vector was mixed with restriction endonucleases (AscI and KpnI) for digestion, and then the vector and the fragment were ligated by homologous recombination.

[0051] The recombinant plasmid that was successfully sequenced was electroporated into Agrobacterium competent cells GV3101. This expression vector will express and produce HDT3-HA protein in plants.

[0052] T0 generation plants were obtained after genetic transformation of tomato and verified by Western Blot HDT3 Overexpressing transgenic plants, primary antibody is HA antibody.

[0053] Western Blot results of overexpression are as follows Figure 1 As shown in B.

[0054] This example further detected the RNA expression of the transgenic plants.

[0055] qPCR primers are as follows (5'-3'):

[0056] SlHDT3-RT-F: GAAAGCAGGACAAACACTAAAGG (SEQ ID NO: 5);

[0057] SlHDT3-RT-R: CCTCCAGCAGATAGAGTTCCAATG (SEQ ID NO: 6).

[0058] The results are as follows Figure 2 As shown, the overexpression material SlHDT3 The expression level of CR is about 2 times that of CR, while in the mutant [[ID= The expression level of CR is about 10%. Lowercase letters a, b, and c represent significant differences in RNA expression levels between different plants at the 5% level.

[0059] Example 3 ​ Gene regulation of tomato drought resistance

[0060] 1. Experimental methods

[0061] Drought stress treatment:

[0062] Tomato seeds were soaked in 50°C warm water for 15 minutes and then placed in a 28°C constant speed shaker (200 rpm) for 3 days to accelerate germination. The water was changed every 12 hours. When the radicle of the seeds was about 1 cm thick, they were sown in 72-well trays with a 3:1 mixture of peat and vermiculite. The culture medium was placed in a plant factory with a temperature setting of 21 / 19°C (day / night), a photoperiod of 12 h light / 12 h dark, and a light intensity of 200 μmol m -2 s -1 When the tomato seedlings grow one true leaf, transplant them into planting pots and water them with an appropriate amount of Hoagland nutrient solution every 3 days.

[0063] When the tomatoes had three leaves and one heart, healthy plants with similar growth status were selected and dewatered. Each treatment was replicated three times, with 20 seedlings per replicate. After 12 days of drought treatment, the plants were immediately rewatered, and the survival rate was calculated after 3 days.

[0064] Moisture loss detection:

[0065] To measure fresh leaf water loss across the different genotypes, healthy leaves from plants grown under control conditions were removed and immediately weighed to determine their fresh weight. Leaves were weighed every 60 minutes for a total of 600 minutes. The result was calculated as the ratio of percent water loss to leaf fresh weight.

[0066] DAB staining:

[0067] (1) Take the plant leaves to be tested, rinse the surface dirt with clean water, and place them in a culture dish containing 5 mg / mL DAB solution.

[0068] (2) Protect from light and incubate for 12 hours.

[0069] (3) Boil the plant material in 95% ethanol for 10 minutes.

[0070] (4) Transfer the boiled material into fresh 95% ethanol, cool it to room temperature, and take photos.

[0071] Conductivity measurement:

[0072] (1) Take leaves from the same leaf position, mix them evenly, and cut them into uniform strips. Weigh 0.2 g and place them in a 50 mL centrifuge tube that has been added with 20 mL of ddH2O. Make sure that the leaves are completely immersed in ultrapure water. Take 5 replicates for each treatment.

[0073] (2) The above samples were placed in a shaker at 28°C and shaken at 200 rpm for 1-2 h. The EC1 value was measured using a digital conductivity meter (DDS-11A, Hangzhou Orion Instrument Co., Ltd.).

[0074] (3) Then place the sample in a water bath at 95°C for 15-20 minutes, cool it to room temperature, and measure the total conductivity value EC2.

[0075] (4) Calculate the relative conductivity according to the following formula: REL (%) = EC1 / EC2 × 100%.

[0076] Determination of hydrogen peroxide content and MDA malondialdehyde content:

[0077] Drought stress can induce a series of changes in plants at the physiological and biochemical levels. For example, hydrogen peroxide (H2O2) will accumulate under drought stress, which will in turn increase the degree of membrane lipid peroxidation in cells and lead to cell ion leakage. Therefore, the H2O2 content and ion permeability under drought conditions are common physiological indicators for evaluating plant drought resistance.

[0078] Additionally, malondialdehyde (MDA) is a product of membrane lipid peroxidation in plant tissues under adverse conditions. Its content can be used to determine the degree of membrane lipid peroxidation. Hydrogen peroxide content was determined according to the instructions for the Suzhou Keming Biological Kit, while MDA content was determined according to the instructions for the Solarbio kit (Solarbio, China).

[0079] 2. Experimental results

[0080] The plant growth phenotype results of different groups are as follows ​ As shown. Before and after water deprivation treatment, compared with the wild type, ​ The mutant showed obvious drought resistance phenotype.

[0081] The results of plant survival rate and water loss rate in different groups are as follows ​ After drought stress was completed and rewatered, the survival rate of the wild type was 50%, ​ The survival rate of -1# mutant plants was about 71%. ​ -2# mutant plant survival rate was about 77%, OE- ​ -2# overexpression plants had a survival rate of approximately 15%, and OE- ​ The survival rate of the -5# overexpressing plants was approximately 26%. Lowercase letters a, b, and c indicate significant differences between values ​​at the 5% level. Leaf water loss rates among the overexpressing plants, wild-type plants, and mutant plants showed a linear relationship from high to low.

[0082] DAB staining ​ As shown in Figure A, the darker the color, the more H2O2 the leaves accumulate, which also indicates that the drought stress is more severe. The DAB staining degree of the overexpression plants, wild type and mutant plants showed a linear relationship from high to low. The conductivity results are shown in Figure ​As shown in Figure B, the more severe the drought stress, the higher the relative conductivity value. The relative conductivity of the overexpressing plants, wild-type plants, and mutant plants showed a linear relationship from high to low. Lowercase letters a, b, and c indicate that the relative conductivity values ​​of different plants were significantly different at the 5% level.

[0083] The test results of hydrogen peroxide and propylene glycol are as follows ​ As shown in Figure 3, the H2O2 and MDA contents of the overexpressing plants, wild-type plants, and mutant plants showed a linear relationship from high to low. Lowercase letters a, b, and c indicate significant differences in relative conductivity values ​​between different plants at the 5% level.

[0084] While the embodiments of the present invention have been described in detail above with reference to the accompanying drawings, the present invention is not limited to the embodiments described above. Various modifications may be made within the scope of knowledge possessed by a person skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof may be combined with one another unless there is a conflict.

Claims

1. Inhibition SlHDT3 Application of genes to improve drought tolerance in tomatoes; described SlHDT3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The inhibition SlHDT3 Gene applications using the CRISPR / Cas9 system SlHDT3 Inactivating mutations occur; The CRISPR / Cas9 system includes a vector and sgRNA; The sequence of the sgRNA is shown in SEQ ID NO:

2.

2. and inhibition SlHDT3 the use of genetically related biological materials in developing tomato varieties; described SlHDT3 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; The application is to construct and inhibit SlHDT3 Genetically related biomaterials to obtain tomato varieties with improved drought tolerance; The biological material does not include propagation material; The biological material includes: 1) Nucleic acid molecules; The nucleic acid molecule includes an inhibitory SlHDT3 Functional sgRNA; The sequence of the sgRNA is shown in SEQ ID NO: 2; 2) A vector comprising the nucleic acid molecule described in 1); The vector includes a CRISPR / Cas9 vector; 3) cells containing the vector described in 2); The cells include at least one of Escherichia coli and Agrobacterium.

3. A method for cultivating a tomato variety with high drought tolerance, comprising reducing SlHDT3 the step of measuring the expression level and / or activity of a gene; The tomato variety comprises the following characteristics: drought tolerance is improved relative to a reference level; the reference level is the level of the wild type; The reduction in tomato SlHDT3 The step of increasing the expression level and / or activity of the gene is to reduce the expression level and / or activity of the gene described in claim 2 SlHDT3 Genetically related biological material is introduced into tomato tissue or tomato cells.

4. The method according to claim 3, wherein: The introduction method includes using at least one of Ti plasmid, Ri plasmid, plant virus vector, microinjection, and electroporation.

Citation Information

Patent Citations

  • Cultivation method for enhancing drought resistance of tomatoes

    CN116254294A