Application of ED pathway regulation gene for ensifer adhesion in industrial production of vitamin B12

Abstract

The invention discloses a method for obtaining and culturing ED pathway regulated and controlled engineering bacteria for fermentation production of vitamin B12, a mutant strain is based on ensifer adhesion, an ED pathway key gene edd gene in the ensifer adhesion of a vitamin B12 production strain is overexpressed by a homologous recombination single exchange method, an edd gene overexpressed mutant strain is constructed, and the edd gene overexpressed mutant strain is used for producing the vitamin B12. The purpose of disturbing the ED pathway to realize the metabolic migration of central carbon is achieved, and the method is applied to the production of vitamin B12. A shake flask fermentation experiment proves that overexpression of the edd gene can remarkably promote synthesis of a VB12 product, and the edd gene has good commercial and scientific research values.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to a method for constructing an overexpressed mutant strain of the edd gene of Ensifer adhaerens and optimizing the process for fermentative production of vitamin B 12 . Background Art

[0002] Vitamin B 12 is an important nutrient for humans and animals and plays a key role in hematopoiesis and maintaining the health of the nervous system. Since the molecular structure of vitamin B 12 is extremely complex, its total chemical synthesis route involves more than 70 reaction steps and is costly. Therefore, at present, vitamin B is mainly produced by microbial fermentation 12 . Ensifer adhaerens is a typical strain in the aerobic biosynthetic pathway of vitamin B 12 and is applied to industrial production due to its simple fermentation process and relatively simple culture conditions

[0003] Vitamin B 12 is a complex macromolecular compound. During its synthesis, a large amount of NADPH is required. Therefore, a certain flux of reducing power and energy charge level are crucial for the synthesis of the product. In recent years, numerous studies have shown that after the reconstruction of the secondary metabolic pathway in industrial production strains, the imbalance in the supply levels of reduced coenzymes NADH and NADPH and energy charge under oxygen-limited conditions has gradually been proven to be an important limiting factor in the metabolic process of recombinant bacteria in industrial production. By means of genetic engineering and metabolic engineering, regulating the enzymes and reaction pathways related to NADPH metabolism to increase the intracellular NADPH concentration is a widely adopted regulatory strategy in recent years. The activity of the Embden Meyerhof-Parnas (EMP) pathway in Ensifer adhaerens is very low, and sugar metabolism mainly occurs through the Pentose Phosphate Pathway (PPP) and the Entner Doudoroff (ED) pathway. Compared with the EMP pathway, the ED pathway of sugar metabolism can generate one more molecule of NADPH, and the adjustment of the related sugar catabolic flux also meets the large demand for NADPH in the synthesis of VB 12 . So far, there has been no research on the metabolic regulation of NADPH synthesis during the biosynthesis of VB 12 by Ensifer adhaerens in industrial fermentation

[0004] Current metabolic engineering transformation strategies for vitamin B 12 production strains mainly focus on enhancing the expression of secondary metabolic pathway genes such as CobU, CobT, CobS, and CobC, but for vitamin B 12The improvement of fermentation yield is still limited. Therefore, it is necessary to develop new engineering bacteria construction strategies to further improve the fermentation yield of vitamin B 12 . SUMMARY OF THE INVENTION

[0005] The object of the present invention is to provide an application of the ED pathway regulatory gene for Ensifer adhaerens in the industrial production of vitamin B12 to solve the problems existing in the above-mentioned prior art. This mutant strain can improve the fermentation yield of vitamin B 12 and has certain industrial application value.

[0006] The first object of the present invention is to provide an overexpressing mutant strain of the edd gene. To achieve the above object, the present invention provides the following solutions:

[0007] An overexpressing mutant strain of the edd gene of Ensifer adhaerens, which is obtained by overexpressing the edd gene of Ensifer adhaerens;

[0008] Furthermore, the nucleotide sequence of the edd gene is as shown in SEQ ID NO.2;

[0009] Further, in the overexpression vector of the mutant strain, the P1 gene is used as the promoter for overexpressing the edd gene, and the nucleotide sequence of the P1 gene is as shown in SEQ ID NO.1.

[0010] The second object of the present invention is to provide a method for constructing an overexpressing mutant strain of the edd gene of Ensifer adhaerens, comprising the following steps:

[0011] (1) Amplify the P1 and edd gene fragments by PCR technology;

[0012] (2) Perform double digestion on the vector pOJ260, and then carry out homologous recombination with the P1 and edd gene fragments to obtain an overexpression vector of the edd gene;

[0013] (3) Transform the overexpression vector of the edd gene into the competent cells of Escherichia coli S17-1. Co-culture the Escherichia coli S17-1 successfully introduced with the overexpression vector of the edd gene with Ensifer adhaerens, and transfer the overexpression vector of the edd gene into Ensifer adhaerens by means of Escherichia coli-mediated conjugation transfer technology;

[0014] (4) Using the Apr resistance gene as a screening marker, obtain overexpressing conjugants, separate and verify the conjugants to obtain the mutant strain edd-P1.

[0015] Further, in the Ensifer adhaerens edd-P1, the overexpression vector uses the P1 promoter as the promoter for overexpressing the edd gene;

[0016] Furthermore, the nucleotide sequence of the edd gene of the Xanthophyllales adhering to the mitochondria is shown in SEQ ID NO.2;

[0017] Furthermore, the nucleotide sequence of the P1 gene of the sticky sword fungus is shown in SEQ ID NO.1;

[0018] Furthermore, the sticky sword fungus is the sticky sword fungus edd-P1, and has apramycin resistance.

[0019] The third object of the present invention is to provide a mutant strain of the edd gene overexpressing the adhesiomycetes to produce vitamin B 12 The fermentation production process comprises the following steps:

[0020] (1): Streak culture the edd gene overexpression mutant of Xanthophyll sticky bacteria on a slant medium for 4-5 days, scrape about 1 / 3 of the bacteria on the slant and inoculate it into the primary seed medium. Culture the primary seed at 30°C and 260 rpm for 24 h.

[0021] (2): The primary seeds were inoculated into the secondary seed culture medium at a rate of 1%, and the secondary seeds were cultured at 30°C and 260 rpm for 20 h.

[0022] (3): Inoculate the secondary seeds in the fermentation medium at a rate of 10%, and culture at 32°C and 260 rpm for 96 hours. At 48 hours of fermentation, add sodium gluconate once.

[0023] Furthermore, the mass concentration range of the one-time addition of sodium gluconate is 0.5-5 g / L;

[0024] Furthermore, the mass concentration range of the one-time addition of sodium gluconate is 2-4.5 g / L;

[0025] Optimally, the mass concentration of the one-time addition of different concentrations of sodium gluconate is 4 g / L; BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 Verification of edd-P1 gene overexpression plasmid

[0027] Figure 2 Verification of edd-P1 gene overexpression mutant

[0028] Figure 3 Batch fermentation of vitamin B12 by wild-type strain and edd gene overexpression mutant 12 Production comparison

[0029] Figure 4 Batch fermentation of vitamin B12 by wild-type strain and edd gene overexpression mutant 12 Comparison of unit bacterial yield

[0030] Figure 5 Fed-batch fermentation of wild-type strain and edd gene overexpression mutant strain of vitamin B 12 Yield comparison

[0031] Figure 6 Fed-batch fermentation of wild-type strain and edd gene overexpression mutant strain of vitamin B 12 Yield comparison per unit cell

[0032] Figure 7 OD comparison after adding sodium gluconate during the middle and late growth stages of wild-type strain and edd gene overexpression mutant strain 700 Comparison

[0033] Figure 8 pH comparison after adding sodium gluconate during the middle and late growth stages of wild-type strain and edd gene overexpression mutant strain

[0034] Figure 9 Vitamin B yield comparison after adding sodium gluconate during the middle and late growth stages of wild-type strain and edd gene overexpression mutant strain 12 Yield comparison

[0035] Figure 10 Vitamin B yield comparison after adding sodium gluconate during the middle and late growth stages of wild-type strain and edd gene overexpression mutant strain 12 Yield comparison per unit cell Detailed implementation mode

[0036] The technical solutions of the present invention will be described in detail below in conjunction with the embodiments.

[0037] Example 1: Discovery of the P1 gene.

[0038] Through whole-genome data analysis and transcriptome data analysis, a gene with continuously increasing expression level was found in the whole-genome sequence of Gluconacetobacter adherens, and it was named the P1 gene.

[0039] Example 2: Construction of Gluconacetobacter adherens edd-P1 gene overexpression mutant strain

[0040] First, construct the overexpression plasmid pOJ260-edd-P1 of the edd gene. Through the analysis of the transcriptome data of Adhesibacter sp., a P1 gene with continuously increasing transcriptional level was selected as the promoter for the overexpression of the edd gene. A fragment containing left and right homologous arms, namely the promoter fragment, with a size of 271 bp was cloned using the primer pair pro-F / pro-R. A 600-bp edd gene fragment was cloned from the genome of Adhesibacter sp. using the primer pair edd-A / edd-S. The linearized vector pOJ260 was obtained by double digestion with EcoRⅠ and BamHⅠ. The two obtained fragments and the digested plasmid were subjected to gel recovery. The linearized vector pOJ260 and the two recovered fragments were added to the recombination reaction system at a molar ratio of 1:3:3, and heat shock was performed at 50 °C for 45 min. The recombinant product was transformed into DH5α competent cells for amplification culture. Single colonies were picked from the recombinant plate and inoculated into an LB test tube containing 100 μg / mL Apr resistance for culture. Verification was carried out using the primers YZ-S / YZ-A. The nucleic acid electrophoresis results of the PCR verification were as Figure 1 shown. Lanes 1-5 were positive clones, and lane 6 was the negative control. Further sequencing verification confirmed the obtained target plasmid pOJ260-edd-P1.

[0041] The recombinant plasmid pOJ260-edd-P1 was electrotransformed into E. coli S17-1 competent cells and subjected to conjugation transfer with the industrial strain of Adhesibacter sp. E. coli S17-1 is a kanamycin-sensitive strain and has the ability to efficiently accept exogenous DNA, and can efficiently accept the exogenous recombinant plasmid pOJ260-edd-P1 to achieve the purpose of constructing an overexpression strain of the edd gene. The recipient bacterium, the industrial strain of Adhesibacter sp., was picked as a single colony into a TSB liquid test tube and cultured at 30 °C for 24 h, and then centrifuged and concentrated to 2 mL. At the same time, a single colony of the donor bacterium E. coli S17-1 transfected with the recombinant plasmid was picked into an LB liquid test tube and cultured overnight, the supernatant was centrifuged off and washed twice with fresh LB liquid medium, and then suspended with 1 mL of the medium. The donor bacterium and the recipient bacterium were fully mixed in a ratio of 1:1 and spread on a corn steep liquor composite medium plate. After culturing at 30 °C for 16 h, antibiotics were overlaid (the final concentration of Apr resistance was 100 μg / mL, and the final concentration of Kan resistance was 50 μg / mL). Conjugants grew on the plate after about 4 days of culture. Single colonies were picked into a TSB liquid test tube medium containing Apr and Kan resistance for culture. Peripheral primers VP-S / VP-A were designed to verify the genotype of the conjugants. The nucleic acid electrophoresis results of the PCR verification were as Figure 2 shown. Lane 7 was the control of the industrial strain of Adhesibacter sp., and lanes 1-6 were positive clones. Sequencing verification showed that the edd gene was indeed overexpressed through homologous recombination single crossover, and the position where the single crossover occurred was on the edd gene fragment.

[0042] The primer sequences are as follows:

[0043] pro-F: CGGGAATCGGCGGACATCATATGTTCTTTCTACCTGCATTCCATTG

[0044] pro-R: ACAGGAAACAGCTATGACATGATTACGAATTCCAGTCTCTCCGCTGTCAT

[0045] edd-S: CTGCAGGTCGACTCTAGAGGATCCGGCGAACAACTGGCGGAC

[0046] edd-A: GCGAAATCGATTGGCCGCACATGTCCGCCGATTCCCG

[0047] YZ-S: AATCTCGTGCTTTCAGCTTC

[0048] YZ-A: CGTTGGCCGATTCATTAATG

[0049] VP-S: GCAAGCCCGTTCGGATAGAC

[0050] VP-A: AGGACATCGCCTGGGACAAG

[0051] Example 3: Flask fermentation test of Adhesivibacter edd-P1 mutant strain

[0052] Through flask batch fermentation, the overexpressed mutant strain and wild-type strain of Adhesivibacter edd-P1 were cultured under the same conditions to investigate the differences in the synthesis of vitamin B 12 and fermentation physiological characteristics between the two strains. First, streak culture on the slant medium for 4-5 days, scrape about 1 / 3 of the bacteria on the slant and inoculate them into the first-stage seed medium, culture at 30 °C and 260 rpm for about 24 h, then inoculate them into the second-stage seed medium at an inoculation amount of 1%, culture at 30 °C and 260 rpm for about 20 h, and then inoculate them into the fermentation medium at an inoculation amount of 10%, culture at 32 °C and 260 rpm for 96 h.

[0053] The experimental results show that the overexpression of the edd gene has a certain promoting effect on the synthesis of vitamin B 12 . In batch fermentation and fed-batch fermentation cultures, the vitamin B 12 yield of the overexpressed strain of Adhesivibacter edd-P1 increased by 10.34% and 15.7% respectively compared with the control group ( Figure 3 , Figure 5), the yield per unit cell increased by 9.05% and 100%( Figure 4 、 Figure 6 ). Adhesibacter vitamin B 12 In the fermentation synthesis stage of forming porphyrin rings, synthesizing lower ligands and carrying out methylation, amination and cobalt ion chelation processes, a large amount of NADPH and ATP are required. In Adhesibacter, sugar metabolism mainly occurs through the pentose phosphate pathway (PPP) and the ED pathway. Compared with the EMP pathway, the ED pathway of sugar metabolism can generate one more molecule of NADPH. Therefore, it is speculated that the overexpression of the edd gene may enhance the flux of the ED pathway and promote the synthesis of NADPH. In summary, the overexpression of the edd gene in Adhesibacter has a promoting effect on the synthesis of vitamin B 12 .

[0054] Example 4: Comparison of physiological characteristics of Adhesibacter edd-P1 mutant strains after adding sodium gluconate in the middle and late growth stages

[0055] Through shake-flask batch fermentation, the Adhesibacter edd-P1 overexpressing mutant strain and the wild-type strain were cultured under the same conditions to investigate the differences in the synthesis of vitamin B 12 and fermentation physiological characteristics of the two strains after adding sodium gluconate in the middle and late growth stages. First, culture on a slant medium by streaking for 4-5 days, scrape about 1 / 3 of the bacteria on the slant and inoculate them into the first-stage seed medium, culture at 30 °C and 260 rpm for about 24 h, then inoculate them into the second-stage seed medium at an inoculation amount of 1%, culture at 30 °C and 260 rpm for about 20 h, and then inoculate them into the fermentation medium at an inoculation amount of 10%, culture at 32 °C and 260 rpm for 96 h. At 48 h, add different concentrations of sodium gluconate (0 g / L, 3 g / L, 4 g / L, 5 g / L) at one time to investigate its effects on the growth of the two strains and the synthesis of VB 12 .

[0056] The experimental results show that the pH of the edd-P1 mutant strain is always lower than that of the wild-type strain. At the same time, too high pH also leads to a lower overall OD of the wild-type strain than that of the edd-P1 mutant strain. pH is an environmental factor that affects the growth of bacteria and the synthesis of products, and plays an important regulatory role in the enzyme activity in metabolic reactions, which is reflected in physiological parameters such as the permeability of the cell membrane and the cell morphology. When sodium gluconate is added to the medium as a mixed carbon source, as gluconic acid enters the ED and PP pathways and is utilized, the sodium ions in the solution cause the pH of the fermentation broth to increase, thereby affecting the growth of the strain. In terms of product synthesis, as Figure 9 , as shown in Figure 10, the VB of the control strain 12The content and the yield per unit cell increased with the increase in the addition amount of sodium gluconate. The edd-P1 mutant strain was always at a relatively high level. When 4 g / L of sodium gluconate was added, the yields per unit cell of both reached the maximum values, which were 1.36 mg / g DCW and 1.41 mg / g DCW respectively.

[0057] The above results indicate that the metabolic regulation of Ensifer adhaerens can be carried out by means of genetic engineering, and the yield of vitamin B in the cells of Ensifer adhaerens can be increased by overexpressing the edd gene. 12 It has practical application potential and prospects.

[0058]

Claims

1. A novel ED pathway regulatory gene for Xanthophyllales in vitamin B 12 Application in industrial production.

2. The ED pathway regulatory gene for the sticky sword fungus according to claim 1 in vitamin B 12 Industrial production application, characterized by The application is constructed edd The gene overexpression mutant strain was used as the fermentation strain.

3. The ED pathway regulatory gene for the bacterial sticky sword fungus according to claim 1 in vitamin B 12 Industrial production application, characterized by by P 1 Gene promoter overexpression in Xanthophyll edd Gene.

4. The ED pathway regulatory gene for the bacterial sticky sword fungus according to claim 1 in vitamin B 12 Industrial production application, characterized by The mutant overexpression vector is P 1 Gene as edd Gene overexpression promoter, P 1 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

5. The ED pathway regulatory gene for the bacterial sticky sword fungus according to claim 1 in vitamin B 12 Industrial production application, characterized by Xanthophyllales edd The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

6. Construction according to claim 2 edd The gene overexpression mutant strain is used as a fermentation strain, characterized in that: The sticky sword fungus edd Gene overexpression was constructed by: (1) Amplification by PCR technology P 1 and edd Gene fragments; (2) The vector pOJ260 was double-digested and then P 1 and edd Gene fragments undergo homologous recombination to obtain edd Gene overexpression vector; (3) edd The gene overexpression vector was transformed into Escherichia coli S17-1 competent cells and successfully introduced edd The Escherichia coli S17-1 expressing the gene overexpression vector was co-cultured with X. adhensii, and the gene was transferred to edd The gene overexpression vector was transferred into Xanthophyllum adhensii; (4) Using the Apr resistance gene as a screening marker, obtaining overexpression conjugates, isolating and verifying the conjugates, and obtaining mutant strains edd-P 1 .

7. The mutant according to claims 1-6, characterized in that: The mutant strain is a edd-P 1 , and carries apramycin resistance.

8. The mutant according to claims 1-6, characterized in that: Said edd Overexpression of genes can promote vitamin B 12 synthesis.

9. A B vitamin 12 The application of fermentation production is characterized in that Including the mutant strain of Xanthophyllales according to any one of claims 1-8.

10. The method according to claim 9, characterized in that The mass concentration of sodium gluconate added in the later stage of fermentation production is 0.5-5 g / L.

11. The method according to claim 9, characterized in that In the later stage of fermentation production, sodium gluconate is added at a concentration of 2-4.5 g / L.

12. The method according to claim 9, characterized in that In the later stage of fermentation production, sodium gluconate was added at a concentration of 4 g / L.

Images