Application of Carbohydrate-Binding Protein BnaCARB in Regulating 1000-Grain Weight

Abstract

The present invention discloses the application of carbohydrate-binding protein BnaCARB in regulating 1000-grain weight, belonging to the technical field of genetic engineering. The present invention provides the application of carbohydrate-binding protein BnaCARB or its coding gene, or the related biological material of the coding gene in regulating the 1000-grain weight of rapeseed or cultivating high-yield rapeseed. The present invention finds through research that the BnaCARB gene (BnaA09.CARB and BnaC08.CARB) in rapeseed can regulate the 1000-grain weight of rapeseed, and the gene knockout mutant can cause a significant increase in the 1000-grain weight of rapeseed. By using this gene, the 1000-grain weight of rapeseed can be increased, and high-yield rapeseed germplasm can be obtained. The present invention provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasm, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to the application of the carbohydrate-binding protein BnaCARB in regulating the thousand-grain weight. Background Art

[0002] Rapeseed (Brassica napus L.) is an important crop for oil production. Research shows that the thousand-grain weight, as one of the three major yield factors, is regulated by multiple genes and affected by the environment. Meanwhile, the redistribution of carbon sources during seed filling also plays a key role. At present, although hundreds of QTLs related to the thousand-grain weight have been mapped in rapeseed, the number of genes that have been verified and cloned is still insufficient.

[0003] Carbohydrate-binding proteins are a class of proteins that contain a carbohydrate-binding module (CBM) domain but do not have catalytic activity. They assist the corresponding catalytic enzymes to enhance the binding efficiency with the substrate by specifically recognizing and binding to polysaccharide substrates, thereby regulating enzyme activity and localization. Existing research shows that CBMs in microorganisms play a key role in the degradation of plant cell walls. For example, CBM1 of Magnaporthe oryzae regulates the activity of glycoside hydrolase by binding to cellulose and destroys the host cell wall. In animals and plants, similar domains are involved in the recognition of exogenous polysaccharides and cell signal transduction, regulating various biological processes such as cell wall construction and metabolic regulation. However, the research on the specific regulation of carbohydrate metabolism and its spatial localization by CBM proteins is still relatively scattered, and no systematic theoretical framework has been formed. Therefore, identifying key carbon source regulatory genes and analyzing their action mechanisms are of great significance for guiding the molecular breeding of high-yield rapeseed varieties.

[0004] Although existing research has revealed the important role of CBM proteins in plant cell wall regulation and carbohydrate degradation, their functions in seed filling and grain weight regulation are still unclear. For example, although the CBM48 mutant in rice shows a defect in starch accumulation, there is still a lack of research directly linking CBM proteins to seed development regulation. At present, the background technology mainly focuses on analyzing the binding characteristics of CBM proteins to polysaccharide substrates, and there are still significant deficiencies in the aspects of carbon source redistribution, metabolic flux regulation, and their mechanisms affecting the thousand-grain weight of seeds. Therefore, in-depth analysis of the role of CBM proteins in rapeseed in regulating metabolic flux distribution and grain weight formation will provide a new breakthrough for revealing the molecular mechanism of rapeseed high yield. Summary of the Invention

[0005] The object of the present invention is to provide the application of the carbohydrate-binding protein BnaCARB in regulating the 1000-grain weight, so as to solve the problems existing in the above-mentioned prior art. The present invention has found through research that the BnaCARB genes (BnaA09.CARB and BnaC08.CARB) in rapeseed can regulate the 1000-grain weight of rapeseed. The gene knockout mutants can cause a significant increase in the 1000-grain weight of rapeseed. By using this gene, the 1000-grain weight of rapeseed can be increased, and high-yield rapeseed germplasms can be obtained. The present invention provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasms, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides the application of the carbohydrate-binding protein BnaCARB or its coding gene, or the related biological material of the coding gene in regulating the 1000-grain weight of rapeseed or cultivating high-yield rapeseed. The carbohydrate-binding protein BnaCARB includes BnaA09.CARB with the amino acid sequence shown in SEQ ID NO.3 and BnaC08.CARB with the amino acid sequence shown in SEQ ID NO.4;

[0008] The coding gene includes the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.2.

[0009] Further, the related biological material is the CRISPR / Cas9 gene editing vector of the coding gene or a recombinant microorganism containing the CRISPR / Cas9 gene editing vector.

[0010] Further, the method for regulating the 1000-grain weight of rapeseed is: using the CRISPR / Cas9 gene editing technology to simultaneously edit the BnaA09.CARB gene and the BnaC08.CARB gene, so that the functions of the BnaA09.CARB gene and the BnaC08.CARB gene are lost, reducing the content or activity of the carbohydrate-binding protein BnaCARB, and increasing the 1000-grain weight of rapeseed.

[0011] Further, the method for cultivating high-yield rapeseed is: using the CRISPR / Cas9 gene editing technology to simultaneously edit the BnaA09.CARB gene and the BnaC08.CARB gene to obtain high-yield rapeseed plants in which the functions of the BnaA09.CARB gene and the BnaC08.CARB gene are lost, and the content or activity of the carbohydrate-binding protein BnaCARB is reduced.

[0012] The present invention also provides a CRISPR / Cas9 gene editing vector for the gene encoding the carbohydrate-binding protein BnaCARB. The construction method of the CRISPR / Cas9 gene editing vector comprises the following steps:

[0013] (1) Screening out gene editing targets as shown in SEQ ID NO.5 and SEQ ID NO.6 according to the gene encoding the carbohydrate-binding protein BnaCARB;

[0014] (2) Designing primers as shown in SEQ ID NO.7-10 according to the gene editing targets;

[0015] (3) Using the pCBC-DT1T2 plasmid as a template, amplifying the target gene by using the primers; ligating the target gene to the CRISPR / Cas9 vector to obtain the CRISPR / Cas9 gene editing vector;

[0016] The gene encoding the carbohydrate-binding protein BnaCARB includes the BnaA09.CARB gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.CARB gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0017] The present invention also provides a recombinant microorganism containing the above CRISPR / Cas9 gene editing vector.

[0018] The present invention also provides a method for increasing the 1000-seed weight of rapeseed, which comprises the step of introducing the above CRISPR / Cas9 gene editing vector or the above recombinant microorganism into rapeseed to cause the loss of function of the gene encoding the carbohydrate-binding protein BnaCARB so as to increase the 1000-seed weight of rapeseed;

[0019] The gene encoding the carbohydrate-binding protein BnaCARB includes the BnaA09.CARB gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.CARB gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0020] The present invention also provides a method for cultivating high-yield rapeseed, which comprises the step of introducing the above CRISPR / Cas9 gene editing vector or the above recombinant microorganism into rapeseed to obtain a high-yield rapeseed plant with the loss of function of the gene encoding the carbohydrate-binding protein BnaCARB;

[0021] The gene encoding the carbohydrate-binding protein BnaCARB includes the BnaA09.CARB gene with a nucleotide sequence as shown in SEQ ID NO.1 and the BnaC08.CARB gene with a nucleotide sequence as shown in SEQ ID NO.2.

[0022] The present invention also provides a mutant gene of the carbohydrate-binding protein BnaCARB-encoding gene, and the mutant gene is carb-1 or carb-2;

[0023] The carb-1 includes the BnaA09.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.21 and the BnaC08.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.22;

[0024] The carb-2 includes the BnaA09.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.23 and the BnaC08.CARB mutant gene with the nucleotide sequence shown in SEQ ID NO.24.

[0025] The present invention also provides the application of the above mutant gene in regulating the 1000-seed weight of rapeseed or cultivating high-yield rapeseed.

[0026] The present invention discloses the following technical effects:

[0027] The present invention studies and discovers that the BnaCARB gene (BnaA09.CARB and BnaC08.CARB) in rapeseed can regulate the 1000-seed weight of rapeseed. The gene knockout mutant can cause a significant increase in the 1000-seed weight of rapeseed. Using this gene can increase the 1000-seed weight of rapeseed and obtain high-yield rapeseed germplasm. The present invention reveals the regulatory mechanism of the rapeseed BnaCARB gene in regulating the 1000-seed weight and yield, provides a theoretical basis for further in-depth study of the physiological mechanism of rapeseed yield, and also provides genetic resources and technical support for the creation and cultivation of high-yield rapeseed germplasm, and has very important application prospects in the breeding and improvement of high-yield rapeseed varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained according to these drawings.

[0029] Figure 1 It is an analysis diagram of the expression pattern of the BnaCARB gene during different development stages of rapeseed seeds;

[0030] Figure 2 It is a target position diagram of the BnaCARB gene and a gene structure diagram of the BnaCARB mutant material; wherein, A is the target position of the BnaCARB gene; B is the gene structure diagram of the BnaCARB mutant material;

[0031] Figure 3 Statistical analysis results of 1000-seed weight for wild-type rapeseed (WT) and rapeseed BnaCARB mutant materials (carb-1 and carb-2). Detailed implementation manners

[0032] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.

[0033] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0034] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0035] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0036] Regarding "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0037] The experimental methods involved in the following examples, unless otherwise specified, are all conventional experimental methods in the art; the materials or reagents involved, unless otherwise specified, can be purchased from conventional channels.

[0038] Example 1 Expression pattern of BnaCARB gene

[0039] The BnaCARB gene family shows a multi-copy distribution pattern in the Brassica napus genome. A total of four paralogous genes were identified: BnaA09.CARB (BnaA09G0531600WE) located on chromosome A09, BnaC08.CARB (BnaC08G0361500WE) on chromosome C08, and BnaC06.CARB-1 (BnaC06G0262000WE) and BnaC06.CARB-2 (BnaC06G0262100WE) tandemly arranged on chromosome C06. In the rapeseed genome, the genes of the BnaCARB family are distributed on three chromosomes, A09, C08, and C06. To systematically investigate their expression dynamics during seed development, developing seed samples were collected every other day from 14 days to 64 days after seed development. Three biological replicates were set at each time point, and total RNA was extracted and sequencing libraries were constructed according to the standard procedure. The obtained clean reads were first aligned to the WESTAR reference genome using the HISAT2 software, and then the StringTie software was used to quantitatively analyze the gene expression levels based on the TPM (Transcripts Per Million) metric. Finally, the time-series expression data of BnaA09.CARB and BnaC08.CARB were visualized as line charts based on the obtained TPM matrix to intuitively reveal the expression patterns of the target genes during the entire seed development process. The results are as Figure 1 shown. The members of this gene family exhibit a significant tissue-specific expression pattern - BnaA09.CARB and BnaC08.CARB show high-abundance expression during the seed development stage (FPKM value > 50), while the expression levels of BnaC06.CARB-1 and BnaC06.CARB-2 are always below the detection threshold (FPKM < 1). Based on this expression feature, the present invention focuses on these two functional candidate genes, BnaA09.CARB and BnaC08.CARB. The nucleotide sequences (genomic sequences) of these two genes are shown as SEQ ID NO.1 and SEQ ID NO.2 respectively, consisting of 7055 bp and 7494 bp; the protein sequences encoded by these genes are shown as SEQ ID NO.3 and SEQ ID NO.4 respectively, encoding 1197 and 1197 amino acids.

[0040] SEQ ID NO.1:

[0041]

[0042] SEQ ID NO.2:

[0043]

[0044] SEQ ID NO.3:

[0045]

[0046] SEQ ID NO.4:

[0047]

[0048] Example 2 Construction of Brassica napus BnaCARB Mutant Materials

[0049] 1. Construction of BnaCARB-CRISPR Vector

[0050] The BnaCARB-CRISPR vector of Brassica napus was created using the sgRNA-Cas9 system of the team led by Chen Qijun from the College of Biology, China Agricultural University. The specific operation process is as follows:

[0051] (1) Log in to the website http: / / crispr.hzau.edu.cn / CRISPR2 / , and screen out the target sites sgRNA1 and sgRNA2, which are located in the 5th and 25th exon regions of genes BnaA09.CARB and BnaC08.CARB respectively, targeting BnaA09.CARB and BnaC08.CARB (these two genes are highly expressed in developing seeds), as shown in Figure 2 A of

[0052] sgRNA1: TATTAACTTCCGCTTCACG (SEQ ID NO.5);

[0053] sgRNA2: CCACTGGTTACTGGCATTG (SEQ ID NO.6).

[0054] (2) Design primers

[0055] DT1-BsF: ATATATGGTCTCGATTGTATTAACTTCCGCTTCACGGTT (SEQ ID NO.7);

[0056] DT1-F0: TGTATTAACTTCCGCTTCACGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.8);

[0057] DT2-R0: AACCTGGTTACTGGCATTGCGGCAATCTCTTAGTCGACTCTAC (SEQ ID NO.9);

[0058] DT2-BsR: ATTATTGGTCTCGAAACCTGGTTACTGGCATTGCGGCAA (SEQ ID NO.10).

[0059] (3)PCR amplification: Using the pCBC-DT1T2 diluted 100 times as the template for four-primer PCR amplification. DT1–BsF and DT2-BsR were at normal primer concentrations; DT1-F0 and DT2-R0 were diluted 20 times. The amplification system is shown in Table 1, and the PCR amplification program: total denaturation at 94°C for 2 min; denaturation at 98°C for 15 sec, annealing at 56°C for 30 sec, extension at 68°C for 30 sec, for 34 cycles; total extension at 68°C for 5 min.

[0060] Table 1 Amplification system

[0061]

[0062] (4)Purify and recover the PCR product, and establish the digestion-ligation system as shown in Table 2. After the reaction, collect the recombinant vector.

[0063] Table 2 Digestion-ligation system

[0064]

[0065] (5)Transform Escherichia coli DH5α: Take 5 μL of transformed Escherichia coli competent cells and transfer the recombinant vector into Escherichia coli. Screen for positive clones on a Kan plate, and identify and sequence them by PCR. The vector with correct sequencing is the BnaCARB-CRISPR vector.

[0066] (6)Introduce the correctly constructed BnaCARB-CRISPR vector into the Agrobacterium strain GV3101, and select positive monoclonal clones for storage in an -80°C refrigerator. The introduction method is as follows:

[0067] a. Take 50 μL of Agrobacterium competent cells GV3101;

[0068] b. Take 1 μL of the correctly constructed recombinant plasmid and add it to 50 μL of competent cells;

[0069] c. Place the washed and dried electroporation cuvette on ice for pre-cooling, and then pipette the above mixture along the wall of the cuvette;

[0070] d. Adjust the electroporator to 1800 V;

[0071] e. Put the electroporation cuvette into the instrument for electroporation;

[0072] h. After successful electroporation, add 400 μL of antibiotic-free LB to the electroporation cuvette and transfer it to a sterile centrifuge tube;

[0073] i. Activate at 28°C for about 2 h, take 100 μL and spread it on a plate containing double antibiotics, seal it with a sealing film, invert it and culture it in a 28°C incubator for 2 days, and pick colonies for detection.

[0074] (7)Agrobacterium colony detection

[0075] Pick colonies into LB with double antibiotics and culture at 28 °C for 2 hours. Take an appropriate amount of bacterial liquid for PCR detection and preserve the positive Agrobacterium bacterial liquid.

[0076] 2. Genetic transformation experiment

[0077] (1)Genetic transformation of rapeseed

[0078] Using Brassica napus Westar as the receptor plant, the positive Agrobacterium (containing the BnaCARB-CRISPR vector) constructed in the above process was transferred into the receptor plant by the Agrobacterium-mediated genetic transformation method. For the specific operation process, please refer to the reference (Dai C, Li Y, Li L, et al. An efficient Agrobacterium-mediated transformation method using hypocotyl as explants for Brassica napus[J]. Molecular Breeding, 2020, 40(10). DOI: 10.1007 / s11032-020-01174-0.).

[0079] (2)Identification of CRISPR-transformed single plants

[0080] The obtained rapeseed CRISPR-transformed single plants were sequenced to screen for rapeseed mutants. First, the Cas9 protein was identified using the primer pair Cas9-570-F / Cas9-570-R. Then, the primer pairs CARB(A09)-CRISPR-F1 / CARB(A09)-CRISPR-R1, CARB(A09)-CRISPR-F2 / CARB(A09)-CRISPR-R2 were used to amplify the BnaA09.CARB gene in the Cas9 protein-positive single plants, and the primer pairs CARB(C08)-CRISPR-F1 / CARB(C08)-CRISPR-R1, CARB(C08)-CRISPR-F2 / CARB(C08)-CRISPR-R2 were used to amplify and determine the BnaC08.CARB gene in the Cas9 protein-positive single plants.

[0081] The sequences of each primer are as follows:

[0082] Cas9-570-F: 5’ -AGACCGTGAAGGTTGTGGAC-3’ (SEQ ID NO.11);

[0083] Cas9-570-R: 5’-TAGTGATCTGCCGTGTCTC-G-3’ (SEQ ID NO.12);

[0084] CARB(A09)-CRISPR-F1: 5’- CCTCCACCGTCTACAAC-3’ (SEQ ID NO.13);

[0085] CARB(A09)-CRISPR-R1: 5’- CTCCATCAGAAGACAGTAAT-3’ (SEQ ID NO.14);

[0086] CARB(A09)-CRISPR-F2: 5’-CAAGGATCCGTCTCTCCC-3’ (SEQ ID NO.15);

[0087] CARB(A09)-CRISPR-R2: 5’-TCTCTTGGTAGATGATGCAC-3’ (SEQ ID NO.16);

[0088] CARB(C08)-CRISPR-F1: 5’-GGCGTTTCCGCGGATTT-3’ (SEQ ID NO.17);

[0089] CARB(C08)-CRISPR-R1: 5’- CGATGTGAGAACAGAAGCAATT-3’ (SEQ ID NO.18);

[0090] CARB(C08)-CRISPR-F2: 5’-CCAAGCTGCTGTTTCTG-3’ (SEQ ID NO.19);

[0091] CARB(C08)-CRISPR-R2: 5’- CTCTTGGTAGATGATGCTG-3’ (SEQ ID NO.20).

[0092] The amplification method is as follows:

[0093] The PCR system is: 2×Taq Master Mix 20 μL, DNA template 2 μL, F primer 1.6 μL, R primer 1.6 μL, supplemented with ddH2O to 40 μL. PCR conditions: total denaturation at 94°C for 3 min; denaturation at 94°C for 30 sec, annealing at 52°C for 30 sec, extension at 72°C for 30 sec, 34 cycles; total extension at 72°C for 5 min.

[0094] PCR product sequencing was performed on the amplified target fragment, and the sequencing results were analyzed using the online website DSDecode (http: / / skl.scau.edu.cn / dsdecode / ) to determine the editing status of the target site. Finally, two independent mutant lines in which both homologous genes of BnaCARB (BnaA09.CARB and BnaC08.CARB) were edited were obtained, named carb-1 and carb-2 respectively. The sequencing results are as shown in Figure 2 Panel B. By sequencing, the nucleotide sequence of the BnaA09.CARB gene in carb-1 is shown in SEQ ID NO.21, and the nucleotide sequence of the BnaC08.CARB gene is shown in SEQ ID NO.22. The nucleotide sequence of the BnaA09.CARB gene in carb-2 is shown in SEQ ID NO.23, and the nucleotide sequence of the BnaC08.CARB gene is shown in SEQ ID NO.24. The two independent mutant lines are loss-of-function mutants of the BnaCARB gene.

[0095] SEQ ID NO.21:

[0096]

[0097] SEQ ID NO.22:

[0098]

[0099] SEQ ID NO.23:

[0100]

[0101] SEQ ID NO.24:

[0102]

[0103] Example 3 Phenotypic Analysis of Wild-Type and Mutant Materials

[0104] To evaluate the regulatory effect of the BnaCARB gene on rapeseed grain weight, wild-type (WT) and two gene-edited mutants (carb-1, carb-2) were selected in this experiment. Both of these mutant materials were obtained by CRISPR / Cas9 technology. Seeds were planted in the field experimental station of Huazhong Agricultural University in September 2024. A completely randomized block design was used, with three rows for each material (each row was 1.5 m wide and 5 m long), and the plant spacing was 30 cm × 10 cm. Other field management measures were the same.

[0105] At the seed maturity stage, materials from each row were harvested uniformly, air-dried to a moisture content of 15%, and then kept in a constant dry state at room temperature. After harvesting, 100 representative seeds (excluding broken and deformed seeds) were taken from each row of materials, and the thousand-seed weight was measured using the SC-G type automatic seed analyzer (model: SC-G2000) provided by the National Rapeseed Engineering and Technology Research Center of Huazhong Agricultural University. Each sample was measured five times in the same batch, and the average value was taken as the thousand-seed weight of the sample. Finally, three groups of independent data were obtained for each of the three rows of materials.

[0106] The experimental data were statistically analyzed using GraphPad Prism 9.0 software. First, the thousand-seed weight data were tested for normality and homogeneity of variance; then, one-way analysis of variance (One-way ANOVA) was performed, followed by Dunnett's multiple comparison test, with the wild-type WT as the control to test the significant differences between the mutants and WT. The results were expressed as mean ± standard deviation, and differences were considered statistically significant when P < 0.05.

[0107] The results showed ( Figure 3 ) that the thousand-seed weight of wild-type WT was 3.48 ± 0.50 g, and those of carb-1 and carb-2 were 4.07 ± 0.61 g and 4.23 ± 0.68 g, respectively; compared with WT, the thousand-seed weights of carb-1 and carb-2 were significantly increased (P < 0.01), indicating that after the mutation of BnaCARB, the thousand-seed weight of rapeseed could be significantly increased.

[0108] This example verified the key role of BnaA09.CARB and BnaC08.CARB in regulating rapeseed grain weight, providing a solid experimental basis for further analysis of its molecular mechanism and the creation of new high-yield rapeseed varieties.

[0109] The above examples are only the preferred embodiments of the present invention and should not limit the protection scope of the present invention. Those skilled in the art can make various equivalent substitutions or modifications based on this, and all should fall within the protection scope of the claims of the present invention.

Claims

1. Use of a gene knockout encoding a carbohydrate-binding protein BnaCARB in increasing the 1000-seed weight of rapeseed or cultivating high-yield rapeseed, characterized in that, The carbohydrate-binding protein BnaCARB is BnaA09.CARB with the amino acid sequence shown in SEQ ID NO.3 and BnaC08.CARB with the amino acid sequence shown in SEQ ID NO.4; The gene encoding the carbohydrate-binding protein BnaCARB is the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.2; The application is gene negative regulation, which causes the loss of function of the BnaA09.CARB gene and the BnaC08.CARB gene, and increases the 1000-seed weight of rapeseed.

2. A CRISPR / Cas9 gene editing vector for a gene encoding a carbohydrate-binding protein BnaCARB, characterized in that, The method for constructing the CRISPR / Cas9 gene editing vector includes the following steps: (1) Screening out gene editing targets shown in SEQ ID NO.5 and SEQ ID NO.6 according to the gene encoding the carbohydrate-binding protein BnaCARB; (2) Designing primers shown in SEQ ID NO.7-10 according to the gene editing targets; (3) Using the pCBC-DT1T2 plasmid as a template, amplifying the target gene with the primers; connecting the target gene to the CRISPR / Cas9 vector to obtain the CRISPR / Cas9 gene editing vector; The gene encoding the carbohydrate-binding protein BnaCARB is the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.

2.

3. Use of the CRISPR / Cas9 gene editing vector according to claim 2 in increasing the 1000-seed weight of rapeseed or cultivating high-yield rapeseed.

4. A recombinant microorganism containing the CRISPR / Cas9 gene editing vector according to claim 2.

5. A method for increasing the 1000-seed weight of rapeseed, characterized in that, It includes the step of introducing the CRISPR / Cas9 gene editing vector according to claim 2 or the recombinant microorganism according to claim 4 into rapeseed to reduce or eliminate the function of the gene encoding the carbohydrate-binding protein BnaCARB, so as to increase the 1000-seed weight of rapeseed; The gene encoding the carbohydrate-binding protein BnaCARB is the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.

2.

6. A method for cultivating high-yield rapeseed, characterized in that, It includes the step of introducing the CRISPR / Cas9 gene editing vector according to claim 2 or the recombinant microorganism according to claim 4 into rapeseed to obtain a high-yield rapeseed plant with the loss of function of the gene encoding the carbohydrate-binding protein BnaCARB; The gene encoding the carbohydrate-binding protein BnaCARB is the BnaA09.CARB gene with the nucleotide sequence shown in SEQ ID NO.1 and the BnaC08.CARB gene with the nucleotide sequence shown in SEQ ID NO.2.

Images