Preparation method and application of genetically modified non-human mammal for producing humanized antibody

Abstract

The invention provides a preparation method and application of a genetically modified non-human mammal for producing a humanized antibody. The preparation method comprises the following steps: (1) destroying an endogenous heavy chain immune globulin locus of a non-human mammal; and (2) introducing a human IGHV gene, a human IGHD gene, a human IGHJ gene, and an endogenous IgHG gene, an endogenous IgHE gene, an endogenous IgHA gene and an endogenous LCR region of the non-human mammal into the non-human mammal obtained in the step (1). The non-human mammal prepared by the preparation method disclosed by the invention can efficiently generate a humanized complete antibody or a single-chain antibody or a nano antibody after being immunized by an antigen, and has relatively high immune titer, and moreover, the preparation method disclosed by the invention can be used for obtaining a positive animal with relatively high efficiency, so that the non-human mammal can be used for preparing the non-human mammal. Therefore, humanized mice with different antibody diversity can be easily prepared, and the nanometer antibody sequence diversity can be realized by using various strains of mice.

Description

[0001] Cross-reference

[0002] This application claims the priority of a Chinese patent application with the application number 202410190410.0, titled "Preparation Method and Application of Genetically Modified Non-Human Mammals for Producing Humanized Antibodies", filed on February 20, 2024, the entire content of which is incorporated herein by reference. Technical Field

[0003] The present invention belongs to the field of biotechnology and specifically relates to a preparation method and application of genetically modified non-human mammals for producing humanized antibodies. Background Art

[0004] In camelids and sharks, a uniquely structured antibody, the heavy-chain-only antibody, is produced. This antibody consists only of the heavy chain, and the molecular weight of its variable region fragment (15 kDa) is approximately one-tenth of that of traditional antibodies (150 - 160 kDa). The variable region fragment of the heavy-chain-only antibody is also known as the nanobody. Nanobodies have been widely used in the development of bispecific / multispecific antibodies, CAR-T cell therapy, etc. As of January 2023, 4 nanobody-based therapeutic drugs have been launched, and the nanobody-based BCMA CAR-T therapy developed by Legend Biotech has achieved excellent clinical results. In addition, more than 10 molecules of nanobodies developed as neutralizing antibodies have entered clinical phase II / III. The drug research and development and application of nanobodies are still in a relatively early stage, with great application potential and development prospects.

[0005] The fully human nanobody mouse is a fully human nanobody mouse used for the development of nanobody drugs. Based on the independently developed humanization technology of genomic fragments at the scale of hundreds of kilobases to megabase pairs (mega base pair, abbreviated as megabase pair), the humanization of the antibody heavy-chain gene has been achieved, covering the main human heavy-chain variable region genes. Using the HuNano Mouse, fully human nanobodies, bispecific antibodies, antibody gene sequences for CAR-T, etc. for the treatment of major diseases can be directly screened. The fully human nanobody sequences generated do not need to be further humanized in vitro for drug development, saving a large amount of time and cost, and reducing the risk of subsequent drug development. Using fully human nanobody mice has become an inevitable trend in the development of therapeutic nanobody drugs.

[0006] Common techniques for preparing large - fragment (over 100 Kb) gene humanized animal models include chromosome engineering, RMCE (recombinase - mediated cassette exchange), and single - BAC transgenic technology. Chromosome engineering has a high technical threshold, with a research and development cycle of about 5 years. It also relies on embryonic stem cells of the recipient species and is only applicable to species capable of isolating highly efficient embryonic stem cells, such as mice. The size of the target fragment recombined onto the genome each time by RMCE technology is about 200 kb. If gene modification at the megabase level is to be completed, at least 5 - 6 gene recombinations of embryonic stem cells are required, and it takes about 5 years to construct the animal model. The fragment size of single - BAC transgenic is restricted by the size of BAC. Generally, the gene transferred each time is 200 kb, and megabase gene transfer cannot be achieved.

[0007] In addition, the immune titer of fully human nanobody mice is generally lower than that of wild mice, which also means less diversity in the antibody sequences screened.

[0008] Therefore, how to improve the immune titer of fully human nanobody mice and increase the diversity of the antibodies produced is a technical problem urgently to be solved in this field.

[0009] The information disclosed in this background - art section is only intended to enhance the overall understanding of the present invention and should not be regarded as an admission or any form of implication that this information constitutes prior art already known to those of ordinary skill in the art. Summary of the Invention

[0010] Object of the Invention

[0011] Aiming at the problems existing in the above - mentioned prior art, the object of the present invention is to provide a method for preparing a genetically modified non - human mammal capable of efficiently producing humanized antibodies (including full antibodies, single - chain antibodies, and nanobodies), a method for preparing a humanized antibody specifically binding to an antigen based on the non - human mammal produced by this preparation method, and a method for obtaining a biological sample.

[0012] The strategy adopted by the present invention is to rearrange and combine V genes more suitable for expressing nanobodies onto a BAC (mini - Locus technical route), that is, the mini - 1G and mini - 4G schemes of the present invention. It is also possible to arrange and combine antibody V genes of other species in multiple strains, so as to achieve different diversities in different strains of mice.

[0013] The method for preparing a genetically modified non-human mammal according to the present invention adopts the MBGE introduction system, and can prepare a humanized nanobody-producing mouse with a genomic fragment of terabase level humanization within a short time (for example, within six months), and the efficiency of obtaining positive mice by single injection is as high as about 15%. Therefore, it is easy to prepare humanized mice with different antibody diversities (for example, using multiple strains of mice to improve the diversity of nanobody sequences); moreover, the prepared non-human mammal has a very high immune titer and can efficiently produce humanized antibodies (including whole antibodies, single-chain antibodies, and nanobodies).

[0014] Solution

[0015] To achieve the object of the present invention, the present invention provides the following technical solutions:

[0016] In a first aspect, the present invention provides a genetically modified non-human mammal, wherein the non-human mammal comprises a disruption of its endogenous heavy-chain immunoglobulin locus, and the endogenous heavy-chain immunoglobulin locus of the non-human mammal comprises a human IGHV gene, a human IGHD gene, a human IGHJ gene, and the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal.

[0017] In some preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy-chain immunoglobulin locus includes the deletion of the following gene fragments:

[0018] The CH1 fragment of the mouse antibody gene heavy chain IgHM, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

[0019] In a feasible embodiment, the CH1 fragment of the mouse antibody gene heavy chain IgHM is the fragment between SEQ ID NO:7 and SEQ ID NO:8 on the mouse antibody gene heavy chain IgHM.

[0020] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ is the fragment between SEQ ID NO:14 and SEQ ID NO:15 on the mouse antibody gene light chain Igλ.

[0021] In some other preferred embodiments, the non-human mammal is a mouse, and the disruption of its endogenous heavy-chain immunoglobulin locus includes the deletion of the following gene fragments:

[0022] The fragment between IgHM and IgHA-CH1 of the heavy chain of the murine antibody gene, the Igkc fragment of the light chain Igk of the murine antibody gene, and the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene.

[0023] In a feasible embodiment, the CH1 fragment of the heavy chain IgHM of the murine antibody gene is the fragment between SEQ ID NO:7 and SEQ ID NO:19 on the heavy chain IgHM of the murine antibody gene.

[0024] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene is the fragment between SEQ ID NO:14 and SEQ ID NO:15 on the light chain Igλ of the murine antibody gene.

[0025] In a feasible embodiment, the human IGHV gene includes some or all of the human IGHV genes selected from the following:

[0026] hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2, hIGHV3-74, hIGHV3-72, hIGHV3-66, hIGHV3-64, hIGHV3-35, hIGHV3-30, hIGHV3-20, hIGHV3-16, hIGHV3-15, hIGHV3-13, hIGHV3-33, hIGHV3-23, hIGHV3-7, hIGHV1-2, hIGHV6-1; optionally, the framework region of the above human IGHV gene contains mutations; further optionally, the framework regions of the hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2 genes include gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid.

[0027] Preferably, the human IGHV gene includes all of the above human IGHV genes.

[0028] Most preferably, the human IGHV genes include all of the above-mentioned human IGHV genes, wherein the framework regions of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, and hIGHV1-2 genes include gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid.

[0029] In a feasible embodiment, the human IGHD genes include some or all of the human IGHD genes selected from the following:

[0030] hIGHD1-1, hIGHD2-2, hIGHD3-3, hIGHD4-4, hIGHD5-5, hIGHD6-6, hIGHD1-7, hIGHD2-8, hIGHD3-9, hIGHD3-10, hIGHD4-11, hIGHD5-12, hIGHD6-13, hIGHD1-14, hIGHD2-15, hIGHD3-16, hIGHD4-17, hIGHD5-18, hIGHD6-19, hIGHD1-20, hIGHD2-21, hIGHD3-22, hIGHD4-23, hIGHD5-24, hIGHD6-25, hIGHD1-26, hIGHD7-27.

[0031] Preferably, the human IGHD genes include all of the above-mentioned human IGHD genes.

[0032] In a feasible embodiment, the human IGHJ genes are some or all of the human IGHJ genes selected from the following:

[0033] hIGHJ1, hIGHJ2, hIGHJ2P, hIGHJ3, hIGHJ4, hIGHJ5, hIGHJ3P, hIGHJ6;

[0034] Preferably, the human IGHJ genes include all of the above-mentioned human IGHJ genes.

[0035] In a feasible embodiment, the endogenous IgHG gene of the non-human mammal is any one selected from the following:

[0036] (i) the endogenous complete IgHG2c gene of the non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain; or,

[0037] (ii) The endogenous complete IgHG3, IgHG1, IgHG2b, and IgHG2c genes of non-human mammals, or the endogenous IgHG3, IgHG1, IgHG2b, and IgHG2c gene segments lacking the CH1 domain.

[0038] When the endogenous IgHG gene of the non-human mammal is the endogenous complete IgHG gene of the non-human mammal, after immunization with an antigen, the resulting product is a humanized whole antibody; when the endogenous IgHG gene of the non-human mammal is the endogenous IgHG gene segment of the non-human mammal lacking the CH1 domain, after immunization with an antigen, the resulting product is a humanized single-chain antibody.

[0039] Preferably, the human IGHV gene, human IGHD gene, and human IGHJ gene are operably linked and capable of VDJ rearrangement; more preferably, the operably linked and / or VDJ rearranged human IGHV gene, human IGHD gene, and human IGHJ gene are operably linked to the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal;

[0040] Preferably, there is a Switch region of endogenous IgHM of human mammals between the human IGHJ gene and the endogenous IgHG gene of the non-human mammal.

[0041] Most preferably, the endogenous heavy-chain immunoglobulin locus of the non-human mammal contains all the genes shown in Table 13 or Table 15.

[0042] In a second aspect, the present invention provides a method for preparing the genetically modified non-human mammal as described in the first aspect above, characterized in that the preparation method comprises the following steps:

[0043] (1) Disrupting the endogenous heavy-chain immunoglobulin locus of the non-human mammal;

[0044] (2) Introducing a human IGHV gene, a human IGHD gene, a human IGHJ gene, and the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal into the genetically modified non-human mammal obtained in step (1).

[0045] In a feasible embodiment, the non-human mammal is a mouse, and the disruption of the endogenous heavy-chain immunoglobulin locus in step (1) includes the deletion of the following gene fragments:

[0046] The CH1 fragment of the heavy chain IgHM of the mouse antibody gene, the Igkc fragment of the light chain Igk of the mouse antibody gene, and the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene;

[0047] In a feasible embodiment, the CH1 fragment of the heavy chain IgHM of the murine antibody gene is the fragment between SEQ ID NO:7 and SEQ ID NO:8 on the heavy chain IgHM of the murine antibody gene.

[0048] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene is the fragment between SEQ ID NO:14 and SEQ ID NO:15 on the light chain Igλ of the murine antibody gene.

[0049] Preferably, the above-mentioned gene fragment is deleted by gene editing techniques such as CRISPR-Cas9 technology;

[0050] More preferably, the sgRNAs for deleting the CH1 fragment of the heavy chain IgHM of the murine antibody gene include the sgRNAs shown in SEQ ID NO:1 and SEQ ID NO:2; and / or, the sgRNAs for deleting the Igkc fragment of the light chain Igk of the murine antibody gene include the sgRNA shown in SEQ ID NO:3; and / or, the sgRNAs for deleting the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene include the sgRNAs shown in SEQ ID NO:4 and SEQ ID NO:5.

[0051] In some other feasible embodiments, the non-human mammal is a mouse, and the disruption of the endogenous heavy chain immunoglobulin locus in step (1) includes the deletion of the following gene fragments:

[0052] The fragment from IgHM to IgHA-CH1 of the heavy chain of the murine antibody gene, the Igkc fragment of the light chain Igk of the murine antibody gene, the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene;

[0053] In a feasible embodiment, the CH1 fragment of the heavy chain IgHM of the murine antibody gene is the fragment between SEQ ID NO:7 and SEQ ID NO:19 on the heavy chain IgHM of the murine antibody gene.

[0054] In a feasible embodiment, the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene is the fragment between SEQ ID NO:14 and SEQ ID NO:15 on the light chain Igλ of the murine antibody gene.

[0055] Preferably, the above-mentioned gene fragment is deleted by gene editing techniques such as CRISPR-Cas9 technology;

[0056] Further preferably, the sgRNAs for deleting the fragment between IgHM and IgHA-CH1 of the heavy chain of the murine antibody gene include the sgRNAs shown in SEQ ID NO:1 and SEQ ID NO:6; and / or, the sgRNA for deleting the Igkc fragment of the light chain Igk of the murine antibody gene includes the sgRNA shown in SEQ ID NO:3; and / or, the sgRNAs for deleting the fragment between IgLc2 and IgLc1 of the light chain Igλ of the murine antibody gene include the sgRNAs shown in SEQ ID NO:4 and SEQ ID NO:5.

[0057] In some specific embodiments, the non-human mammal is a mouse, and in step (2),

[0058] The human IGHV genes include some or all of the human IGHV genes selected from the following:

[0059] hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2, hIGHV3-74, hIGHV3-72, hIGHV3-66, hIGHV3-64, hIGHV3-35, hIGHV3-30, hIGHV3-20, hIGHV3-16, hIGHV3-15, hIGHV3-13, hIGHV3-33, hIGHV3-23, hIGHV3-7, hIGHV1-2, hIGHV6-1; optionally, the framework regions of the above human IGHV genes contain mutations; further optionally, the framework regions of the hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2 genes include gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid;

[0060] Preferably, the human IGHV genes include all of the above human IGHV genes.

[0061] Most preferably, the human IGHV gene includes all of the above-mentioned human IGHV genes, wherein the framework regions of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, and hIGHV1-2 genes include gene mutations that result in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid.

[0062] And / or, the human IGHD gene includes some or all of the human IGHD genes selected from the following:

[0063] hIGHD1-1, hIGHD2-2, hIGHD3-3, hIGHD4-4, hIGHD5-5, hIGHD6-6, hIGHD1-7, hIGHD2-8, hIGHD3-9, hIGHD3-10, hIGHD4-11, hIGHD5-12, hIGHD6-13, hIGHD1-14, hIGHD2-15, hIGHD3-16, hIGHD4-17, hIGHD5-18, hIGHD6-19, hIGHD1-20, hIGHD2-21, hIGHD3-22, hIGHD4-23, hIGHD5-24, hIGHD6-25, hIGHD1-26, hIGHD7-27;

[0064] Preferably, the human IGHD gene includes all of the above-mentioned human IGHD genes.

[0065] And / or, the human IGHJ gene is some or all of the human IGHJ genes selected from the following:

[0066] hIGHJ1, hIGHJ2, hIGHJ2P, hIGHJ3, hIGHJ4, hIGHJ5, hIGHJ3P, hIGHJ6;

[0067] Preferably, the human IGHJ gene includes all of the above-mentioned human IGHJ genes.

[0068] And / or, the endogenous IgHG gene of the non-human mammal is any one selected from the following:

[0069] (i) The endogenous complete IgHG2c gene of the non-human mammal, or the endogenous IgHG2c gene segment lacking the CH1 domain; or,

[0070] (ii) The endogenous complete IgHG3, IgHG1, IgHG2b, and IgHG2c genes of non-human mammals, or the endogenous IgHG3, IgHG1, IgHG2b, and IgHG2c gene segments lacking the CH1 domain.

[0071] When the endogenous IgHG gene of the non-human mammal is the endogenous complete IgHG gene of the non-human mammal, after antigen immunization, the resulting product is a humanized whole antibody; when the endogenous IgHG gene of the non-human mammal is the endogenous IgHG gene segment of the non-human mammal lacking the CH1 domain, after antigen immunization, the resulting product is a humanized single-chain antibody.

[0072] In a preferred embodiment of the above specific embodiment, in step (2), the human IGHV gene, human IGHD gene, human IGHJ gene, and the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal are introduced in the following manner:

[0073] Introduce into the mouse obtained in step (1):

[0074] (I) One or several BAC clones containing all of the human IGHV gene, human IGHD gene, and human IGHJ gene; and,

[0075] (II) One or several BAC clones containing the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal.

[0076] More preferably, in step (2), the human IGHV gene, human IGHD gene, human IGHJ gene, and the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal are introduced in the following manner:

[0077] Introduce 2 BAC clones into the mouse obtained in step (1), wherein:

[0078] One BAC clone carries all of the human IGHV gene, human IGHD gene, and human IGHJ gene, and the other BAC clone carries all of the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal; and, there is a 5 kb to 50 kb, preferably 5 kb to 20 kb gene homologous sequence at the head and tail between the two BAC clones, so that they can perform gene splicing through the overlapping gene sequences;

[0079] Preferably, the genes contained in the 2 BAC clones are as shown in Table 13 or Table 15.

[0080] In the non-human mammals prepared according to the above preparation method, the human IGHV gene, human IGHD gene, and human IGHJ gene are operably linked and can undergo VDJ rearrangement, and the human IGHV gene, human IGHD gene, and human IGHJ gene that are operably linked and / or have undergone VDJ rearrangement are operably linked to the endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal;

[0081] And / or, there is a Switch region of endogenous IgHM of human mammals between the human IGHJ gene and the endogenous IgHG gene of the non-human mammal.

[0082] In a third aspect, the present invention provides a method for preparing a humanized full antibody or single-chain antibody or nanobody that specifically binds to an antigen, the method comprising:

[0083] (1) Exposing the genetically modified non-human mammal described in the first aspect above or the genetically modified non-human mammal obtained by the preparation method described in the second aspect above to the antigen;

[0084] (2) Collecting B cells from the non-human mammal obtained in step (1), extracting RNA and reverse transcribing it into cDNA, amplifying the antibody gene fragment using the cDNA as a template and cloning it into a phage display vector;

[0085] (3) Expressing the target antibody by the phage vector obtained in step (2), panning the phage, enriching the phage expressing the target antibody and expressing it, and the obtained target antibody is the humanized full antibody or single-chain antibody; and,

[0086] Optionally, (4) cloning the variable region fragment of the obtained single-chain antibody to obtain a humanized nanobody.

[0087] In a fourth aspect, the present invention provides a method for preparing a humanized single-chain antibody or nanobody that specifically binds to an antigen, the method comprising:

[0088] (1) Exposing the genetically modified non-human mammal described in the first aspect above or the genetically modified non-human mammal obtained by the preparation method described in the second aspect above to the antigen, and then collecting B cells;

[0089] (2) Sequencing the nucleic acids encoding the variable region of the immunoglobulin heavy chain and optionally the variable region of the light chain in the B cells collected in step (1) to obtain the nucleic acid sequences of the variable region of the heavy chain and the variable region of the light chain of the humanized monoclonal antibody or the nucleic acid sequence of the variable region of the heavy chain of the humanized nanobody;

[0090] (3) Express a humanized full antibody or single-chain antibody that specifically binds to the antigen according to the sequence obtained in step (2); and,

[0091] Optionally, (4) Clone the variable region fragment of the obtained single-chain antibody to obtain a humanized nanobody.

[0092] In a fifth aspect, the present invention provides a method for obtaining a biological sample, the method comprising:

[0093] (1) Expose the genetically modified non-human mammal as described in the first aspect above or the genetically modified non-human mammal prepared by the preparation method as described in the second aspect above to an antigen;

[0094] (2) Collect a biological sample from the animal.

[0095] Preferably, the biological sample is spleen tissue, spleen cells or B cells.

[0096] In a sixth aspect, the present invention provides a biological sample obtained by the method as described in the fifth aspect above.

[0097] Advantageous Effects

[0098] The genetically modified non-human mammal prepared according to the preparation method of the present invention has a high immune titer and can efficiently produce humanized single-chain antibodies or nanobodies after antigen immunization, and is an efficient production platform for humanized full antibodies or single-chain antibodies or nanobodies; in addition, the method for preparing the non-human mammal of the present invention has a high efficiency of obtaining positive animals (about 15%), so that humanized mice with different antibody diversities can be easily prepared, and the nanobody sequence diversity can be achieved with multiple strains of mice. BRIEF DESCRIPTION OF THE DRAWINGS

[0099] One or more embodiments are exemplarily illustrated by the pictures in the corresponding drawings, and these exemplary illustrations do not constitute a limitation on the embodiments. The special word "exemplary" here means "serving as an example, embodiment or illustration". Any embodiment illustrated here as "exemplary" does not have to be construed as superior to or better than other embodiments.

[0100] Figure 1 Schematic diagram of the target sites of the sgRNA for deleting the CH1 region of the mouse IgHM gene in Example 1; among them, the five-star symbols respectively represent the positions of the upstream and downstream target sites.

[0101] Figure 2 Agarose gel electrophoresis diagram of the sgRNA transcript for deleting the CH1 region of the mouse IgHM gene in Example 1.

[0102] Figure 3 Agarose gel electrophoresis diagram of PCR products for detecting gene deletion in homozygous mice of the F2 generation and their offspring in Example 1; among them, the numbers 1 to 4 represent the mouse clone numbers for detection, "+" represents the homozygous positive control, "+ / -" represents the heterozygous control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0103] Figure 4 Schematic diagram of the target sites of sgRNA for deleting the Igkc gene of the light chain Igk of the mouse antibody gene in Example 2.

[0104] Figure 5 Agarose gel electrophoresis diagram of the sgRNA transcript for deleting the Igkc gene of the light chain Igk of the mouse antibody gene in Example 2.

[0105] Figure 6 Agarose gel electrophoresis diagram of PCR products for detecting gene deletion in homozygous mice of the F2 generation and their offspring in Example 2; among them, the numbers 1 to 5 represent the mouse clone numbers for detection, "+" represents the homozygous positive control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0106] Figure 7 Schematic diagram of the target sites of sgRNA for deleting the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene in Example 3; among them, the five-star symbols respectively represent the positions of the upstream and downstream target sites.

[0107] Figure 8 Agarose gel electrophoresis diagram of the sgRNA transcript for deleting the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene in Example 3; among them, "5’Guide RNA" represents the GuideRNA at the Iglc2 position, and "3’Guide RNA" represents the GuideRNA at the Iglc1 position.

[0108] Figure 9 Agarose gel electrophoresis diagram of PCR products for detecting gene deletion in homozygous mice of the F2 generation and their offspring in Example 3; among them, the numbers 1 to 6 represent the mouse clone numbers for detection, "+" represents the homozygous positive control, "+ / -" represents the heterozygous control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0109] Figure 10 Schematic diagram of the target sites of sgRNA for deleting the fragment between CH1 and IgHA-CH1 of the heavy chain IgHM of the mouse antibody gene in Example 4; among them, the five-star symbols respectively represent the positions of the upstream and downstream target sites.

[0110] Figure 11Agarose gel electrophoresis diagram of sgRNA transcripts for deleting the fragment between IgH M and IgH A-CH1 of the mouse antibody gene in Example 4; among them, "5’Guide RNA" represents the GuideRNA at the IgM position, and "3’GuideRNA" represents the GuideRNA at the IgH A position.

[0111] Figure 12 Agarose gel electrophoresis diagram of PCR products for detecting gene deletion in F2 generation and its offspring homozygous mice in Example 4; among them, the numbers 1 to 5 represent the detected mouse clone numbers, "+" represents the homozygous positive control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0112] Figure 13 Agarose gel electrophoresis diagram of PCR products for identifying gene deletion of IgM(A), IgK(B), and IgL(C) genes in gene knockout mice in Example 5; among them, the numbers 1 to 9 represent the detected mouse clone numbers, "+" represents the homozygous positive control, "+ / -" represents the heterozygous control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0113] Figure 14 Agarose gel electrophoresis diagram of PCR products for identifying gene deletion of IgA(A), IgK(B), and IgL(C) genes in gene knockout mice in Example 6; among them, the numbers 1 to 3 represent the detected mouse clone numbers, "+" represents the homozygous positive control, "-" represents the wild mouse control, and "H2O" represents the water control.

[0114] Figure 15 Schematic diagram of the structure of each gene segment introduced by the mini-1G protocol in Example 7.

[0115] Figure 16 A-B: Agarose gel electrophoresis diagram of PCR products for identifying the genotype of F1 generation IgM-KL-mini-1G heterozygous mice in Example 7; among them, Figure A is the gel electrophoresis diagram for identifying gene introduction. Lanes H1-H16 respectively represent the PCR products amplified by primers H1-H16, and the primer binding sites are all located on the two BACs of the mini-1G protocol. Figure B is the gel electrophoresis diagram for identifying gene deletion. Lanes M, K, and L are respectively the PCR products for identifying gene deletion of IgM, IgK, and IgL genes in gene knockout mice.

[0116] Figure 17 Schematic diagram of the structure of each gene segment introduced by the mini-4G protocol in Example 8.

[0117] Figure 18Agarose gel electrophoresis pattern of the PCR products for genotyping mini-4G mice in Example 8; among them, H1-H17 respectively represent the PCR products amplified by H1-H17 primers, and the primer binding sites are all located on two BACs of the mini-4G protocol.

[0118] Figure 19 A-C are the graphs showing the titer detection results of three IgM homozygous mice immunized with OVA antigen in Example 9.

[0119] Figure 20 Western blot experimental results of the sera of IgM gene knockout mice immunized with OVA antigen in Example 9 under reducing conditions; among them, lane 1 represents the serum sample of C57BL / 6 wild-type mice after immunization, lane 2 represents the serum sample of IgM CH1 ko heterozygous mice after immunization, lane 3 represents the serum sample of IgM CH1 ko homozygous mice after immunization, and the bands above each lane represent the IgM heavy chain.

[0120] Figure 21 RT-PCR detection results of splenocytes of IgM gene knockout mice immunized with OVA antigen in Example 9; among them, Figure A is the colony PCR result of the picked clones, and Figure B is the partial sequencing result of the picked clones.

[0121] Figure 22 Graphs showing the titer detection results of IgA homozygous mice immunized with OVA (A) and CRP (B) antigens respectively in Example 10.

[0122] Figure 23 Western blot experimental results of the sera of IgA homozygous mice immunized with CRP antigen in Example 10 under reducing conditions; among them, lane 1 and lane 2 are the serum samples of C57BL / 6 mice after immunization, and lane 3 is the serum sample of IgA homozygous mice after immunization.

[0123] Figure 24 RT-PCR detection results of splenocytes of IgA homozygous mice immunized with CRP antigen in Example 10; among them, Figure A is the colony PCR result of the picked clones, and Figure B is the partial sequencing result of the picked clones.

[0124] Figure 25 Graphs showing the titer detection results of IgM-KL (A) and IgA-KL (B) homozygous mice immunized with OVA antigen in Example 11.

[0125] Figure 26Panels A, B, and C are the Coomassie blue staining results of sera from four types of mice immunized with OVA antigen in Example 11, namely IgM, IgM-KL, IgA, and IgA-KL mice (Panel A), the immunoblotting results of Kappa chains in the sera (Panel B), and the immunoblotting results of Lamda chains in the sera (Panel C).

[0126] Figure 27 This is the immunoblotting experimental result of the sera of IgM-KL-mini-1G mice immunized with OVA protein in Example 12. Among them, lanes 1-3 are the serum samples of IgM-KL-mini-1G mice, and lanes 4-6 are the serum samples of C57BL / 6 mice.

[0127] Figure 28 This is the agarose gel electrophoresis diagram of colony PCR for cloning the genomic RT-PCR products of IgM-KL-mini-1G hybrid mice prepared in Example 7 into -Blunt Zero Cloning vector.

[0128] Figure 29 This is the agarose gel electrophoresis diagram of colony PCR for cloning the genomic RT-PCR products of mini-4G mice prepared in Example 8 into Blunt Zero Cloning vector. Detailed implementation manners

[0129] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. Apparently, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0130] In addition, to better illustrate the present invention, numerous specific details are given in the following detailed implementation manners. Those skilled in the art should understand that the present invention can be implemented without some specific details. In some embodiments, details of raw materials, components, methods, means, etc. well-known to those skilled in the art are not described in detail to highlight the gist of the present invention.

[0131] Unless otherwise clearly stated, throughout the specification and claims, the term "comprise" or its variations such as "comprises" or "including" etc. will be understood to include the stated elements or components, without excluding other elements or other components.

[0132] In addition, in the following examples, the mice used were C57BL / 6 mice purchased from Vital River Laboratories. The starting mice were 4 to 6 weeks old and weighed approximately 18 g to 22 g.

[0133] Example 1. Design of sgRNAs for deleting the CH1 region of the mouse IgHM gene (also referred to as the "IgM gene" hereinafter), preparation and identification of gene knockout mice (hereinafter abbreviated as "IgM mice" or "IgM homozygous mice")

[0134] To delete the CH1 region of the mouse IgHM gene, one target site was selected upstream and one downstream on the first exon of the mouse IgHM gene, and one sgRNA was designed for each target site. The schematic diagram of the sgRNA target sites is shown in Figure 1 , where the five-star symbols in the figure represent the positions of the upstream and downstream target sites respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 1.

[0135] 1 Construction of IgM mice:

[0136] 1.1 The specific steps include: sgRNA primer design, in vitro transcription of sgRNA, mouse embryo injection, and identification of positive mice.

[0137] 1.2 Experimental reagents:

[0138] MEGAshortscript TM Kit

[0139] MEGAclear TM Kit

[0140] Purification for Large Scale Transcription Reactions

[0141] 1.3 sgRNA primer design

[0142] Table 1

[0143]

[0144] 1.4 Preparation of sgRNA transcription template

[0145] 1.4.1 The Taq-mix PCR system is shown in Table 2, and 20 μL × 2 tubes are amplified for each sample.

[0146] Table 2

[0147] <![CDATA[ddH2O]]> 8 μL Forward primer 0.5 μL Reverse primer 0.5 μL Template (~10 ng / μL) 1 μL Taq mix 10 μL Total Volume 20 μL

[0148] 1.4.2 The Touchdown program is shown in Table 3.

[0149] Table 3

[0150]

[0151] The PCR products were recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0152] 1.5 In Vitro Transcription

[0153] 1.5.1 The transcription system is shown in Table 4.

[0154] Table 4

[0155]

[0156]

[0157] The above transcription system was placed in an incubator at 37 °C for 18 h and recovered using the MEGAclear TM Kit Purification for Large Scale Transcription Reactions kit.

[0158] 1.5.2 Agarose gel electrophoresis of the sgRNA transcription products is as Figure 2 shown.

[0159] 1.6 Implant the cells containing the above sgRNA and Cas9 protein into the host animal:

[0160] Induce ovulation in mice, perform in vitro fertilization and culture the fertilized eggs, then mix the sgRNA and Cas9 protein and electrotransfer the mouse fertilized eggs or inject Cas9 protein (or Cas9 mRNA, commercially available) together with the sgRNA into the mouse fertilized eggs by microinjection.

[0161] The above fertilized egg cells were implanted into the body of surrogate mother mice to produce F0 generation chimeric mice. By extracting genomic DNA from the mouse tails, PCR amplification and analyzing the PCR amplification products, the individuals with knockout in the F0 generation mice were detected.

[0162] In the above PCR amplification, the PCR primers mIghM-teko-1F and mIghM-teko-1R were designed at both ends of the deletion sequence, and their sequences are shown in Table 5.

[0163] Table 5

[0164]

[0165] The analysis of the PCR amplification products includes agarose gel electrophoresis analysis and sequencing analysis to confirm whether the target sequence has been deleted.

[0166] Based on the sequencing results analysis and confirmation of the PCR products, the length of the deleted sequence is 323 bp. Therefore, for the PCR products amplified with the above primers, both the deleted gene and the wild-type gene can be detected according to the fragment size. Among them, for the wild-type gene and the gene with the target sequence deleted, the sizes of the target bands amplified with primers mIghM-teko-1F and mIghM-teko-1R are 907 bp and 584 bp respectively (results not shown).

[0167] Select F0 generation chimeric mice with correct gene knockout for subsequent breeding and identification.

[0168] 1.7 Breeding heterozygous and homozygous gene knockout mice:

[0169] Mate the F0 generation mice with the target gene knockout with wild-type mice to obtain F1 generation mice. By extracting the mouse tail genome and performing PCR detection, select the gene knockout positive F1 generation heterozygous mice that can be stably inherited; then cross the F1 generation heterozygous mice with each other to obtain the gene knockout positive F2 generation homozygous mice, that is, IgM homozygous mice. Genotype identification is performed on the obtained F2 generation and its offspring homozygous mice, and the method is the same as that in the above step (1.6). At the same time, use the homozygous positive mice and heterozygous mice identified by sequencing as the homozygous positive control (lane marked with "+") and heterozygous control (lane marked with "+ / -") respectively. In addition, a wild-type mouse control (lane marked with "-") and a negative control without DNA template (also called "water control") are set. The results are as Figure 3 shown.

[0170] Figure 3 shown. It is shown that through the above procedures, IgM homozygous mice are indeed obtained.

[0171] Example 2: Design of sgRNA for deleting the Igkc gene (hereinafter also referred to as "IgK gene") of the light chain Igk of the mouse antibody gene, preparation and identification of gene knockout mice (hereinafter simply referred to as "IgK mice" or "IgK homozygous mice")

[0172] In order to knockout the Igkc gene of mouse Igk, 1 target site was selected on the exon of the mouse Igkc gene, and 1 sgRNA was designed for this target site. The schematic diagram of the target site of sgRNA is shown in Figure 4 , and the sequence of the designed 1 sgRNA and its target sequence are shown in Table 3.

[0173] 2 Construction of IgK mice:

[0174] 2.1 The specific steps include: sgRNA primer design, in vitro transcription of sgRNA, mouse embryo injection, and positive mouse identification.

[0175] 2.2 Experimental reagents:

[0176] MEGAshortscript TM Kit

[0177] MEGAclear TM Kit

[0178] Purification for Large Scale Transcription Reactions

[0179] 2.3 sgRNA primer design

[0180] Table 6

[0181]

[0182] 2.4 Preparation of sgRNA transcription template

[0183] 2.4.1 The Taq-mix PCR system is shown in Table 2 above. Each sample is amplified in 2 tubes of 20 μL.

[0184] 2.4.2 The Touchdown program is shown in Table 3 above.

[0185] The PCR products are recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0186] 2.5 In vitro transcription

[0187] 2.5.1 The transcription system is shown in Table 4 above.

[0188] The above transcription system is incubated in a 37 °C constant temperature incubator for 18 h, and recovered using the MEGAclear TM Kit Purification for Large Scale Transcription Reactions kit

[0189] 2.5.2 The agarose gel electrophoresis of the IgK-sgRNA transcription product is as Figure 5 shown. Figure 5 It shows that after the above transcription procedure, a single transcription product, namely IgK-sgRNA, is obtained and can be used for the subsequent introduction procedure.

[0190] 2.6 Introducing the said sgRNA and Cas9 protein into the fertilized eggs of host animals:

[0191] Superovulate mice, perform in vitro fertilization and culture the fertilized eggs, then mix sgRNA and Cas9 protein, electrotransfer the mouse fertilized eggs, or inject Cas9 protein (or Cas9 mRNA, commercially available) together with sgRNA into the mouse fertilized eggs by microinjection.

[0192] Implant the above fertilized egg cells into the body of surrogate mother mice to produce F0 generation chimeric mice. Detect the individuals with knockout in the F0 generation mice by extracting mouse tail genomic DNA, PCR amplification, and analyzing the PCR amplification products.

[0193] In the above PCR amplification, the PCR primers KC-nF and KC-nR are designed on both sides of the deletion sequence, and their sequences are shown in Table 7.

[0194] Table 7

[0195]

[0196] The analysis of the PCR amplification products includes agarose gel electrophoresis analysis and sequencing analysis to confirm whether the target sequence has been deleted. According to the sequencing results of the PCR products, it is confirmed that the length of the deleted sequence is 76bp. Therefore, for the PCR products amplified by the above primers, both the deleted gene and the wild-type gene can be detected according to the size of the fragment. Among them, for the wild-type gene and the gene with the target sequence deleted, the sizes of the target bands amplified by the primers KC-nF and KC-nR are 299bp and 223bp respectively (results not shown).

[0197] Select the F0 generation chimeric mice with correct gene knockout for subsequent breeding and identification.

[0198] 2.7 Breed heterozygous and homozygous gene knockout mice:

[0199] Mate the F0 generation mice with knocked-out target genes with wild-type mice to obtain F1 generation mice. Select the positive F1 generation heterozygous mice with stable inheritance of gene knockout by extracting mouse tail genome and PCR detection. Then, mate the F1 generation heterozygous mice with each other to obtain the positive F2 generation homozygous mice with gene knockout, that is, the homozygous mice with Igkc knockout. Genotype identification is performed on the obtained F2 generation and its offspring homozygous mice, and the method is the same as that in the above step (2.6), and the results are as Figure 6 shown.

[0200] Figure 6 It shows that through the above procedures, IgK homozygous mice are indeed obtained.

[0201] Example 3: Design of sgRNA for Deleting the Fragment between IgLc2 and IgLc1 of the Light Chain Igλ of the Mouse Antibody Gene, Preparation and Identification of Gene Knockout Mice (hereinafter Referred to as "IgL Mice" or "IgL Homozygous Mice")

[0202] To delete the fragment between IgLc2 and IgLc1 of the light chain Igλ of the mouse antibody gene, 1 target site was selected upstream of the exon of the mouse Iglc2 gene, and 1 target site was selected downstream of the exon of the mouse Iglc1 gene. 1 sgRNA was designed for each target site. The schematic diagram of the sgRNA target sites is shown in Figure 7 , where the five-star symbols in the figure respectively represent the positions of the upstream and downstream target sites. The sequences of the 2 designed sgRNAs and their target sequences are shown in Table 8.

[0203] Construction of IgL Mice:

[0204] 3.1 The specific steps include: sgRNA primer design, in vitro transcription of sgRNA, mouse embryo injection, and identification of positive mice.

[0205] 3.2 Experimental reagents:

[0206] MEGAshortscript TM Kit

[0207] MEGAclear TM Kit

[0208] Purification for Large Scale Transcription Reactions

[0209] 3.3 sgRNA primer design

[0210] Table 8

[0211]

[0212] 3.4 Preparation of sgRNA transcription template

[0213] 3.4.1 The Taq-mix PCR system is shown in Table 2 above, and 20 μL × 2 tubes are amplified for each sample.

[0214] 3.4.2 The Touchdown program is shown in Table 3 above.

[0215] The PCR products were recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0216] 3.5 In vitro transcription

[0217] 3.5.1 The transcription system is shown in Table 4 above.

[0218] Incubate the above transcription system in an incubator at 37 °C for 18 h, and recover it using the MEGAclear TM Kit Purification for Large Scale Transcription Reactions kit.

[0219] 3.5.2 Agarose gel electrophoresis of the sgRNA transcription product is as Figure 8 shown. Figure 8 As shown, after the above transcription procedure, single transcription products were obtained respectively, which were two sgRNAs designed based on the upstream and downstream target sites as described above, and could be used for subsequent introduction procedures.

[0220] 3.6 Introduce the above sgRNA and Cas9 protein into fertilized eggs of host animals:

[0221] Induce ovulation in mice, perform in vitro fertilization and culture fertilized eggs, then mix the sgRNA and Cas9 protein and electrotransfer the fertilized eggs of mice, or inject Cas9 protein (or Cas9 mRNA, commercially available) together with the sgRNA into the fertilized eggs of mice by microinjection.

[0222] Implant the above fertilized egg cells into the body of a surrogate mother mouse to produce F0 generation chimeric mice. Detect the individuals with knockout in the F0 generation mice by extracting genomic DNA from mouse tails, PCR amplification and analyzing the PCR amplification products.

[0223] In the above PCR amplification, the PCR primers LC2-nF1 and IgL-R2 are designed on both sides of the deletion sequence, and their sequences are shown in Table 9.

[0224] Table 9

[0225]

[0226] The analysis of the PCR amplification products includes agarose gel electrophoresis analysis and sequencing analysis to confirm whether the target sequence has been deleted. According to the analysis of the PCR product sequencing results, the length of the deleted sequence is about 137 kb, so the size of the PCR product of the gene knockout mouse amplified with the above primers is 1170 bp. The PCR primer LC1-nF2l is designed at a position close to the 3' end on the deleted sequence, and the primers LC1-nF2l and IgL-R2 are used to detect the target fragment without gene deletion, and the size of its PCR product is 1424 bp. According to the size of the PCR product fragment, it can also be confirmed whether it is a wild-type gene or a gene with the target sequence deleted.

[0227] Select F0 chimeric mice with correct gene knockout for subsequent breeding and identification.

[0228] 3.7 Breed heterozygous and homozygous gene knockout mice:

[0229] Mate F0 mice with knocked-out target genes with wild-type mice to obtain F1 mice. By extracting mouse tail genomic DNA and performing PCR detection, select positive F1 heterozygous mice with stable inheritance of gene knockout. Then, cross F1 heterozygous mice with each other to obtain positive F2 homozygous mice with gene knockout, that is, homozygous mice with Igkc knockout. Genotype identification of the obtained F2 and their offspring homozygous mice is performed using the same method as in step (3.6) above, and the results are as Figure 9 shown.

[0230] Figure 9 It shows that through the above procedures, IgL homozygous mice were indeed obtained.

[0231] Example 4. Design of sgRNAs for deleting the fragment between IgHM and IgHA-CH1 of the heavy chain of the mouse antibody gene (hereinafter also referred to as "IgA gene"), preparation and identification of gene knockout mice (hereinafter abbreviated as "IgA mice" or "IgA homozygous mice")

[0232] To delete the fragment between IgHM and IgHA-CH1 of the heavy chain of the mouse antibody gene, one target site was selected upstream of the exon of the mouse IgHM gene, and one target site was selected downstream of exon 1 of the mouse IgHA gene. One sgRNA was designed for each target site. The schematic diagram of the sgRNA target sites is shown in Figure 10 , where the five-star symbols in the figure indicate the positions of the upstream and downstream target sites respectively. The sequences of the two designed sgRNAs and their target sequences are shown in Table 10.

[0233] 4 Construction of IgA mice:

[0234] 4.1 The specific steps include: sgRNA primer design, in vitro transcription of sgRNA, mouse embryo injection, and identification of positive mice.

[0235] 4.2 Experimental reagents:

[0236] 4.2.1 MEGAshortscript TM Kit

[0237] 4.2.2 MEGAclear TM Kit

[0238] Purification for Large Scale Transcription Reactions

[0239] 4.3 sgRNA Primer Design

[0240] Table 10

[0241]

[0242] 4.4 Preparation of sgRNA Transcription Template

[0243] 4.4.1 For the Taq-mix PCR system, see Table 2 above. Amplify 20 μL × 2 tubes for each sample.

[0244] 4.4.2 For the Touchdown program, see Table 3 above.

[0245] The PCR products are recovered using a recovery kit and used for the next experiment, in vitro transcription.

[0246] 4.5 In Vitro Transcription

[0247] 4.5.1 For the transcription system, see Table 4 above.

[0248] Incubate the above transcription system in a 37°C constant temperature incubator for 18 h, and recover it using the MEGAclear TM Kit Purification for Large Scale Transcription Reactions kit.

[0249] 4.5.2 Agarose gel electrophoresis of the IgA-sgRNA transcription products is as Figure 11 shown. Figure 11 As shown, after the above transcription procedure, single transcription products were obtained respectively, which are the 2 sgRNAs designed based on the upstream and downstream targets as described above, and can be used for the subsequent introduction procedure.

[0250] 4.6 Introduction of the sgRNA and Cas9 Protein into Fertilized Eggs of Host Animals:

[0251] Superovulate mice, perform in vitro fertilization and culture the fertilized eggs, then mix the sgRNA and Cas9 protein and electrotransfer the mouse fertilized eggs, or inject the Cas9 protein (or Cas9 mRNA, commercially available) together with the sgRNA into the mouse fertilized eggs by microinjection.

[0252] Implant the above fertilized egg cells into the body of surrogate mother mice to produce F0 generation chimeric mice. Detect the individuals with knockout in the F0 generation mice by extracting genomic DNA from mouse tails, PCR amplification, and gel electrophoresis and sequencing analysis of the PCR amplification products.

[0253] In the above PCR amplification, the PCR primers IgA-KO-1F and IgA-KO / WT-1R were designed on both sides of the deletion sequence, and their sequences are shown in Table 11.

[0254] Table 11

[0255]

[0256] The PCR amplification products were respectively analyzed by agarose gel electrophoresis and sequencing analysis to confirm whether the target sequence was deleted.

[0257] Based on the analysis and confirmation of the PCR product sequencing results, the length of the deleted sequence was approximately 163 kb. The size of the PCR product amplified from the gene knockout mouse using the above primers was 1170 bp. The PCR primer IgA-KO / WT-1R was designed at a position near the 3'-end of the deletion sequence. The primers IgA-WT-1F and IgA-KO / WT-1R were used to detect the target fragment without gene deletion, and the size of their PCR product was 724 bp. According to the size of the PCR product fragment, it was also possible to confirm whether it was a wild-type gene or a gene with the target sequence deleted.

[0258] Select F0 generation chimeric mice with correct gene knockout for subsequent breeding and identification.

[0259] 4.7 Breeding heterozygous and homozygous gene knockout mice:

[0260] Mate the F0 generation mice with the target gene knockout with wild-type mice to obtain F1 generation mice. By extracting the mouse tail genome and performing PCR detection, select the gene knockout positive F1 generation heterozygous mice that can be stably inherited. Then, cross the F1 generation heterozygous mice with each other to obtain the gene knockout positive F2 generation homozygous mice, that is, the homozygous type mice with IgA knockout. Genotype identification was performed on the obtained F2 generation and its offspring homozygous mice, and the method was the same as that in the above step (4.6). At the same time, the homozygous positive mice identified by sequencing were used as homozygous positive controls (i.e., the lanes marked as "+"), in addition, a wild-type mouse control (i.e., the lane marked as "-") and a negative control without DNA template (also called "water control") were set up, and the results are as Figure 12 shown.

[0261] Figure 12 It shows that through the above procedure, IgA homozygous mice were indeed obtained.

[0262] Example 5 Preparation and Identification of IgM, IgK, and IgL Triple Gene Knockout Mice (Abbreviated as "IgM-KL Mice" in this article)

[0263] The IgM homozygous mice prepared in Example 1 were mated with the IgK homozygous mice prepared in Example 2 to obtain IgM-IgK heterozygous mice; synchronously, the IgM homozygous mice prepared in Example 1 were mated with the IgL homozygous mice prepared in Example 3 to obtain IgM-IgL heterozygous mice; then, the obtained IgM-IgK heterozygous mice were mated with the IgM-IgL heterozygous mice to obtain IgM(+ / +)IgK(+ / -)IgL(+ / -) mice; finally, the IgM(+ / +)IgK(+ / -)IgL(+ / -) mice were self-crossed to obtain IgM(+ / +)IgK(+ / +)IgL(+ / +) mice, which were named IgM-KL mice.

[0264] The mouse tail genomic DNA was extracted, PCR amplification was carried out, and the amplification products were analyzed by gel electrophoresis to determine the target strain mice. The primers for identifying the deletion of IgM, IgK, and IgL genes are as described in Examples 1, 2, and 3 respectively. At the same time, the homozygous positive mice and heterozygous mice with the corresponding knocked-out genes identified by sequencing were used as the homozygous positive control (the lane marked with "+") and the heterozygous control (the lane marked with "+ / -") respectively. In addition, a wild-type mouse control (the lane marked with "-") and a negative control without DNA template (also called "water control") were set. The genotype identification results are as Figure 13 shown in A, 13B, and 13C.

[0265] Figure 13 As shown in A, 13B, and 13C, through the above procedures, IgM, IgK, and IgL triple gene knockout mice were indeed obtained.

[0266] Preparation and identification of IgA, IgK, and IgL triple gene knockout mice (abbreviated as "IgA-KL mice" in this article) in Example 6

[0267] The IgM-KL homozygous mice prepared in Example 5 were mated with the IgA homozygous mice prepared in Example 4 to obtain IgA-KL heterozygous mice; then, the obtained IgA-KL heterozygous mice were self-crossed to obtain IgA(+ / +)IgK(+ / +)IgL(+ / +) mice, which were named IgA-KL mice.

[0268] By extracting mouse tail genomic DNA, performing PCR amplification and analyzing the amplification products by gel electrophoresis to determine the target strain of mice. The primers for identifying the deletion of IgA and IgK are as described in Example 4 and Example 2 respectively, and the primers for identifying the deletion of IgL are shown in Table 12 below. At the same time, the homozygous positive mice with the corresponding knockout genes identified by sequencing are used as homozygous positive controls (lanes marked with "+"), in addition, wild-type mouse controls (lanes marked with "-") and negative controls without DNA templates (also called "water controls") are also set up. The genotype identification results are as Figure 14 shown in A, 14B, and 14C.

[0269] Table 12

[0270]

[0271] Figure 14 As shown in A-C, through the above procedures, IgA, IgK, and IgL triple knockout mice were indeed obtained.

[0272] Example 7. Preparation and Identification of Genetically Modified Mouse IgM-KL-mini-1G Mice of the Present Invention

[0273] In this example, two modified BACs carrying all the human or murine antibody gene sequences to be introduced were introduced into C57BL / 6J mice to prepare mini-1G mice. The two modified BACs are called CH17-185P21-23V-1G and RP23-351J19-1G respectively. Among them, the CH17-185P21-23V-1G BAC carries a total of 23 V genes, the complete human D region gene and J region gene. RP23-351J19–1G contains murine IgHG2c (when producing traditional antibodies, it is the complete IgHG2c segment; when producing nanobodies, it is the IgHG2c segment lacking CH1; in this example, the IgHG2c segment lacking CH1 is introduced), IgHE, IgHA, and LCR region (35 kb) (the detailed information of the genes carried by the two BACs is shown in Table 13). The two parts are connected by the Switch region of murine IgHM, and the schematic diagram is as Figure 15 shown.

[0274] The above two BAC clones, CH17-185P21-23V-1G and RP23-351J19-1G, are strains obtained by modifying their respective original BAC clone strains (i.e., CH17-185P21 and RP23-351J19, purchased from Invitrogen (Shanghai) Trading Co., Ltd.). The specific modification methods are as follows.

[0275] First, prepare electrocompetent cells from blank BAC strains and electrotransfer the pKD46-Tet plasmid (Wuhan Miaoling Biotechnology Co., Ltd., P7957) into the electrocompetent cells.

[0276] Next, for the BAC clone CH17-185P21-23V-1G, construct the 5'-end and 3'-end fragments to be recombined (shown as SEQ ID NO:82 and SEQ ID NO:83 respectively) by OverLap-PCR or restriction enzyme ligation. Prepare electrocompetent cells from the BAC bacteria carrying the pKD46-Tet plasmid, then electrotransfer the above 5'-end fragment to be recombined into the electrocompetent cells, screen through the corresponding antibiotics, and verify positive clones by colony PCR. Then, prepare electrocompetent cells from the bacterial solution of the BAC positive clone (i.e., the clone recombined with the 5'-end fragment to be recombined), then electrotransfer the above 3'-end fragment to be recombined into the electrocompetent cells, screen through the corresponding antibiotics, and verify positive clones by colony PCR. Finally, extract the positive BAC from the bacteria and perform Fast-NGS sequencing for confirmation.

[0277] For the BAC clone RP23-351J19-1G, construct the fragment to be recombined (shown as SEQ ID NO:84) by OverLap-PCR or restriction enzyme ligation. Prepare electrocompetent cells from the BAC bacteria carrying the pKD46-Tet plasmid, then electrotransfer the above fragment to be recombined into the electrocompetent cells, screen through the corresponding antibiotics, and verify positive clones by colony PCR. Finally, extract the positive BAC from the bacteria and perform Fast-NGS sequencing for confirmation.

[0278] SEQ ID NO:82

[0279]

[0280] SEQ ID NO:83

[0281]

[0282] SEQ ID NO:84

[0283]

[0284] Table 13. Detailed information on genes carried by each BAC

[0285]

[0286]

[0287] In Table 13, "mIgHG2c-CH1" represents the mIgHG2c gene sequence with the CH1 segment removed; and, "*" indicates that the specified gene sequence has undergone a gene mutation that results in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid.

[0288] The specific procedure is as follows:

[0289] (1) Introduce 2 BACs carrying all the human antibody gene sequences to be introduced into C57BL / 6J mice; specifically, first extract the BAC plasmid, then cut off and purify the BAC backbone with the corresponding restriction endonuclease, mix the purified BAC genes in equimolar amounts to prepare an injection solution, then inject the injection solution into the male pronucleus of the fertilized egg through pronuclear injection, and finally transplant it into the surrogate mouse to obtain F0 generation mice transfected with the human antibody gene; then, perform PCR identification on the introduced antibody gene sequence, and the primers used are shown in Table 14.

[0290] Table 14

[0291]

[0292]

[0293] (2) Mate the F0 generation mice transfected with the human antibody gene sequence obtained in step (1) with the IgM-KL homozygous mice prepared in Example 5 to obtain F1 generation heterozygous mice. By extracting the mouse tail genome and performing PCR detection, select the F1 generation heterozygous mice with positive gene recombination that can be stably inherited. At the same time, perform PCR detection on the IgM-KL background mice. The primers for identifying the deletion of IgM and IgK are as described in Example 1 and Example 2 respectively, and the primers for identifying the deletion of IgL are shown in Table 12.

[0294] The results are as Figure 16 shown in A and B. Among them, Figure 16 A is the gel electrophoresis diagram for identifying the gene introduction situation, Figure 16 B is the gel electrophoresis diagram for identifying the gene deletion situation.

[0295] The above results showed that all of the above genes were successfully introduced, that is, in this example, IgM-KL-mini-1G hybrid mice were successfully obtained.

[0296] Example 8. Preparation and Identification of Genetically Modified Mouse IgM-KL-mini-4G of the Present Invention

[0297] In this example, two modified BACs carrying all the human or murine antibody gene sequences to be introduced were introduced into C57BL / 6J mice to prepare mini-4G mice. The two modified BACs are respectively called CH17-185P21-23V-4G and RP23-351J19-4G; among them, CH17-185P21-23V-4G BAC carries a total of 23 V genes, the complete human D region gene and J region gene, and RP23-351J19-4G contains murine IgHG3, IgHG1, IgHG2b and IgHG2c (when producing conventional antibodies, they are complete IgHG3, IgHG1, IgHG2b and IgHG2c segments; when producing nanobodies, they are IgHG3, IgHG1, IgHG2b and IgHG2c segments lacking CH1; in this example, the introduced segments are IgHG3, IgHG1, IgHG2b and IgHG2c segments lacking CH1), IgHE, IgHA and LCR region (35 kb) (the detailed information of the genes carried by each BAC is shown in Table 15); between the above two parts (that is, between the human J region and the murine IgHG2c gene) is connected by the Switch region of murine IgHM. The schematic diagram is as Figure 17 shown.

[0298] The above two BAC clones CH17-185P21-23V-4G and RP23-351J19-4G used were strains obtained by modifying their respective original BAC clone strains (that is, CH17-185P21 and RP23-351J19, purchased from Invitrogen (Shanghai) Trading Co., Ltd.), and the specific modification method is:

[0299] The method for obtaining the BAC clone CH17-185P21-23V-4G is almost the same as the method for obtaining CH17-185P21-23V-1G in Example 7, except that the 3'-end recombinant fragment used is different. The 3'-end recombinant fragment used in CH17-185P21-23V-4G is shown in SEQ ID NO: 85; the method for obtaining the BAC clone RP23-351J19-4G is almost the same as the method for obtaining RP23-351J19-1G in Example 7, except that the recombinant fragment used is different. The recombinant fragment used in RP23-351J19-4G is shown in SEQ ID NO: 86.

[0300] SEQ ID NO:85

[0301]

[0302] SEQ ID NO:86

[0303]

[0304] Table 15. Detailed information on genes carried by each BAC

[0305]

[0306] In Table 15, "mIgHG3-CH1", "mIgHG1-CH1", "mIgHG2b-CH1", and "mIgHG2c-CH1" respectively represent the sequences of the corresponding genes after removing the CH1 segment; moreover, "*" indicates that the specified gene sequence has undergone a gene mutation that results in the following amino acid mutations: the 4th amino acid in the FR2 region is mutated to phenylalanine, the 11th amino acid is mutated to glutamic acid, the 12th amino acid is mutated to arginine, and the 14th amino acid is mutated to glutamic acid.

[0307] The specific procedure is as follows:

[0308] (1) Introduce 2 BACs carrying all the human antibody gene sequences to be introduced into C57BL / 6J mice; specifically, first extract the BAC plasmid, then cut off and purify the BAC backbone with the corresponding restriction endonuclease, mix the purified BAC genes in equimolar amounts to prepare an injection solution, and then inject the injection solution into the male pronucleus of the fertilized egg through pronuclear injection, and finally transplant it into the surrogate mouse to obtain F0 generation mice transfected with the human antibody gene; then, perform PCR identification on the introduced antibody gene sequence, and the primers used are shown in Table 16. The results are as Figure 18 shown.

[0309] Table 16

[0310]

[0311]

[0312] Figure 18 The results show that all the above genes were successfully introduced, that is, mini-4G mice were successfully obtained in this example.

[0313] Example 9. Phenotype detection of IgM gene-edited mice

[0314] (I) Antigen immune response and titer detection of IgM homozygous mice

[0315] Use OVA (chicken ovalbumin, purchased from Beijing Borsi Technology Co., Ltd.) as an antigen to immunize 3 IgM homozygous mice (prepared in Example 1) respectively, and the specific procedure is as follows:

[0316] Select mice aged 6 - 8 weeks. Mix the antigen with an equal volume of Freund's complete adjuvant and emulsify it until it doesn't disperse when dropping water. Then, it can be used for multiple subcutaneous injections in mice. The initial immunization injection dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0317] Two weeks after the initial immunization, for the second subcutaneous immunization, after emulsifying the antigen with an equal volume of Freund's incomplete adjuvant, perform multiple subcutaneous injections on the mice. The injection dose is reduced to 25 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0318] Collect blood on days 0, 17, and 24 respectively. Coat the plate with goat anti - mouse IgM polyclonal antibody, label the antigen with biotin, and use HRP - Streptavidin to detect the IgM antibody titer in the serum. The experimental results of the antigen immunization titer of three IgM homozygous mice are shown in Figure 19 A, 19B, 19C.

[0319] From Figure 19 A - C, it can be seen that after three immunizations with OVA, the IgM antibody titer in the serum of the three IgM homozygous mice increased, but the overall titer was very low.

[0320] (2) Western blot experiment of serum of IgM - knockout mice immunized with CRP

[0321] According to the product instruction of CNBr - activated SepharoseTM 4B (purchased from GE Healthcare, catalog number 17043001), prepare the antigen affinity column material of CRP (i.e., human C - reactive protein, purchased from Baiqiao Ruijing). The volume of CRP - Sepharose packing material prepared with 1.5 mg CRP antigen is set to 1.5 mL.

[0322] Immunize one C57BL / 6 wild - type mouse (purchased from Vital River), one IgM heterozygous mouse (the F1 - generation heterozygous mouse prepared in Example 1), and one IgM homozygous mouse (the F2 - generation homozygous mouse prepared in Example 1) aged 6 - 8 weeks with CRP (the immunization process is the same as that of OVA immunization). On the 7th day after the third immunization, collect 20 - 50 μL of mouse blood, let it clot at room temperature for about 30 min, and collect the serum after centrifugation. Take 1 μL from each sample, add 100 μL of PBS, add 10 μL of CRP - Sepharose packing material, react at room temperature for 60 min, then centrifuge at 6000 rpm for 30 seconds, and discard the supernatant. Wash the packing material with PBS three times, resuspend it with 10 μL of PBS and boil it, perform 12% SDS - PAGE electrophoresis, transfer the membrane, block it with PVDF, react with goat anti - mouse IgM antibody (Sigma, ISO2 - 1KT), and further develop the color. The results are shown in Figure 20 .

[0323] From Figure 20It can be seen that after immunization with CRP antigen, IgM antibodies specifically reactive with the antigen CRP were detected in the sera of C57BL / 6 wild-type mice (lane 1), IgM CH1 ko heterozygous mice (lane 2), and IgM CH1 ko homozygous mice (lane 3). Under reducing conditions, the size of the IgM heavy chain in homozygous mice was 60 KD, significantly smaller than the 78 KD IgM heavy chain in wild-type mice, demonstrating successful knockout of the CH1 domain in the IgM mouse strain.

[0324] (III) RT-PCR Detection of IgM Gene Knockout Mice Immunized with CRP

[0325] Spleen cells were taken from the IgM homozygous mice triple-immunized with CRP antigen in (II) above, and total RNA was extracted using Trizol and reverse-transcribed to obtain cDNA. The variable region and a part of the connected CH2 gene were amplified using IgM subtype antibody-specific primers. The upstream primer was the MHV1-12 mixed primer, and the downstream primer was IgHM-CH2-R4. The primers used and their sequences are shown in Table 17, where the variable bases S, Y, R, W, M, and K are defined as in the art. Specifically, S is G or C, Y is C or T, R is A or G, W is A or T, M is A or C, and K is G or T.

[0326] Table 17

[0327] Primer Sequence (5’>3’) MHV1 ATGAAATGCAGCTGGGGCATSTTCTTC (SEQ ID NO:64) MHV2 ATGGGATGGAGCTRTATCATSYTCTT (SEQ ID NO:65) MHV3 ATGAAGWTGTGGTTAAACTGGGTTTTT (SEQ ID NO:66) MHV4 ATGRACTTTGGGYTCAGCTTGRTTT (SEQ ID NO:67) MHV5 ATGGGACTCCAGGCTTCAATTTAGTTTTCCTT (SEQ ID NO:68) MHV6 ATGGCTTGTCYTTRGSGCTRCTCTTCTGC (SEQ ID NO:69) MHV7 ATGGRATGGAGCKGGRGTCTTTMTCTT (SEQ ID NO:70) MHV8 ATGAGAGTGCTGATTCTTTTGTG (SEQ ID NO:71) MHV9 ATGGMTTGGGTGTGGAMCTTGCTTATTCCTG (SEQ ID NO:72) MHV10 ATGGGCAGACTTACCATTCTCATTCCTG (SEQ ID NO:73) MHV11 ATGGATTTTGGGCTGATTTTTTTTATTG (SEQ ID NO:74) MHV12 ATGATGGTGTTAAGTCCTTCTGTACC (SEQ ID NO:75) IgHM-CH2-R4 GTTCATCTCTGCGACAGC (SEQ ID NO:76)

[0328] The PCR reaction system is shown in Table 18.

[0329] Table 18

[0330]

[0331]

[0332] The PCR reaction program is shown in Table 19.

[0333] Table 19

[0334]

[0335] The PCR amplification product was ligated to -Blunt Zero Cloning vector, transformed into TOP10 strain and plated (ampicillin resistance), and a clone was picked for colony PCR. The results are as Figure 21 shown in A. This positive clone was sequenced, and from the sequencing results, it can be seen that the FR4 of the IgM heavy chain variable region expressed in IgM homozygous mice is directly connected to CH2 (starting amino acid sequence AVAEMN). The results are as Figure 21 shown in B, indicating that: successful knockout of the genomic IgM CH1 exon.

[0336] Example 10, Phenotype Detection of IgA Gene-Edited Mice

[0337] (I) Antigen Immune Response and Titer Detection of IgA Homozygous Mice

[0338] CRP (human C-reactive protein) and OVA (chicken ovalbumin) were used as antigens to immunize IgA homozygous mice (prepared in Example 4). The immunization method was as follows:

[0339] Mice at 6-8 weeks of age were selected. The antigen protein was mixed with an equal volume of Freund's complete adjuvant and emulsified until it did not drip, and then it could be used for multiple subcutaneous injections in mice. The initial immunization injection dose was 50 μg / mouse, and the injection volume was 0.2 mL / mouse; after the initial immunization, subsequent subcutaneous immunizations were performed every 2 weeks. After the antigen protein was emulsified with an equal volume of Freund's incomplete adjuvant, multiple subcutaneous injections were given to the mice, and the injection dose was reduced to 25 μg / mouse, and the injection volume was 0.2 mL / mouse.

[0340] The serum titer detection method was as follows: The antigen protein was diluted to 2 μg / mL, 100 μL was taken and added to the polystyrene enzyme-linked detection plate for coating, and Biotin-goat anti-mouse IgA (Abcam, ab97231) was used to detect the specific IgA antibody bound to the antigen protein in the serum.

[0341] The results were as Figure 22 A Figure 22 shown in B, which showed that: Blood was collected on the 8th day after the third immunization with the antigen protein, and ELISA was used to detect the serum titer, indicating that basically no specific IgA antibody bound to the antigen protein appeared in the IgA-CH1-KO homozygous mice, and the serum titers did not exceed 1:400.

[0342] (II) Western Blot Experiment of Serum from IgA Homozygous Mice Immunized with CRP

[0343] According to the product instruction of CNBr-activated SepharoseTM 4B (purchased from GE Healthcare, catalog number 17043001), the CRP antigen affinity column material was prepared. The volume of the CRP-Sepharose packing prepared with 1.5 mg of CRP antigen was set at 1.5 mL.

[0344] Immunize 2 C57BL / 6 wild-type mice at 6 - 8 weeks old and 1 IgA homozygous mouse (prepared in Example 4) with CRP (human C-reactive protein). The immunization process is the same as that in the above part (I); 20 - 50 μL of mouse blood is taken 7 days after the third immunization, left to clot at room temperature for about 30 min, and the serum is collected after centrifugation. Take 2 μL of serum from each sample, add 100 μL of PBS, add 10 μL of CRP-Sepharose packing material, react at room temperature for 60 min, centrifuge at 6000 rpm for 30 seconds, and discard the supernatant. Wash the packing material 3 times with PBS, resuspend and boil with 10 μL of PBS, perform 12% SDS-PAGE electrophoresis, transfer the membrane to PVDF for blocking, react with goat anti mouse IgG Fc HRP (JACKSON, 115 - 035 - 071) and further develop the color.

[0345] According to the design of this application, since the genes of mouse IgM, IgD, IgG, and IgE are knocked out, and the CH1 gene of the IgA heavy chain is knocked out, immunizing IgA mice with antigen protein will only produce IgA heavy chain antibodies (without the CH1 domain), and the molecular weight of a single IgA heavy chain is about 40 KD. After the antibodies produced by C57BL / 6 wild-type mice and IgA homozygous mice after antigen protein immunization are separated, electrophoresed, developed, etc., the results are as Figure 23 shown. Figure 23 It is a Western blot of mouse serum under reducing conditions. Among them, lanes 1 and 2 are serum samples of C57BL / 6 mice after immunization, and lane 3 is the serum sample of IgA homozygous mice after immunization; this result shows that the antibodies produced by IgA homozygous mice are consistent with the expectation, proving that the gene sequence knockout between CH1 of IgHM and CH1 of IgHA in the mouse genome is successful.

[0346] (III) RT-PCR detection of splenocytes of IgA homozygous mice immunized with CRP

[0347] Take splenocytes from the IgA homozygous mice immunized with CRP antigen three times in the above part (II), extract total RNA with Trizol and reverse transcribe to obtain cDNA, and use IgA subtype antibody-specific primers to amplify the variable region and the connected part of the CH2 gene. The upstream primer is the MHV1 - 12 mixed primer (the sequences of each primer are shown in Table 16 above), and the downstream primer is IgHA-CH2-R3 (its sequence is: CTGCATCCTTCCCAGTGGAG, i.e., SEQ ID NO:77).

[0348] The PCR reaction system is as shown in Table 18 above (except for the different downstream primers).

[0349] The PCR reaction program is the same as that in Table 19 above.

[0350] Ligate the PCR amplification product to -Blunt Zero Cloning vector, transform TOP10 strain and plate (ampicillin resistance), pick 4 clones for colony PCR, and the results are as Figure 24 shown in A. Send these 4 positive clones for sequencing, and part of the sequencing results are as Figure 24 shown in B. From this part of the sequencing results, it can be seen that the FR4 of the IgA heavy chain variable region expressed in IgA homozygous mice is directly connected to CH2, indicating that the gene sequence knockout between CH1 of mouse genome IgHM and IgHA-CH1 is successful.

[0351] Example 11. Phenotype detection of IgM-KL&IgA-KL homozygous mice

[0352] (1) Antigen immune response and titer detection of IgM-KL&IgA-KL homozygous mice

[0353] Immunize wild-type C57BL / 6, IgM-KL homozygous mice (prepared in Example 5), IgA homozygous mice (prepared in Example 4, as a control), and IgA-KL (prepared in Example 6) homozygous gene knockout mice with OVA (chicken ovalbumin) respectively. The specific procedures are as follows:

[0354] Select mice at 6 - 8 weeks old. Mix the antigen with an equal volume of Freund's complete adjuvant and emulsify until it doesn't drip, then perform multiple subcutaneous injections on mice. The primary immunization injection dose is 50 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0355] Two weeks after the primary immunization, perform the second subcutaneous immunization. After emulsifying the antigen with an equal volume of Freund's incomplete adjuvant, perform multiple subcutaneous injections on mice. The injection dose is reduced to 25 μg / mouse, and the injection volume is 0.2 mL / mouse.

[0356] The method for detecting serum titer is as follows: Dilute the antigen protein to 2 μg / mL, take 100 μL and add it to the polystyrene enzyme-linked detection plate for coating. Use goat anti-mouse IgM antibody (Sigma, ISO2-1KT) for IgM-KL mice and Biotin-goat anti-mouse IgA (Abcam, ab97231) for IgA-KL mice to detect specific IgA antibodies binding to the antigen protein in the serum.

[0357] The results are as Figure 25 A and Figure 25 B shown, which shows that: Blood is collected on the 8th day after the third immunization with the antigen protein, and ELISA detection of serum titer shows that there are basically no specific antibodies binding to the antigen protein in IgM-KL and IgA-KL homozygous mice, and the serum titers do not exceed 1:400.

[0358] (2) Serum Western blot assay of IgM-KL&IgA-KL homozygous mice immunized with OVA

[0359] The sera of four types of mice, namely IgM, IgM-KL, IgA, and IgA-KL, after the third immunization with OVA were subjected to Coomassie Brilliant Blue staining to examine their protein abundances. The results are shown in Figure 26 A.

[0360] In each group of experiments, the loading volume of the serum sample was 0.5 μL. After boiling for denaturation, the sample was loaded onto a 12% SDS-PAGE gel for electrophoresis. After transferring the membrane and blocking with PVDF, the expression of light chain proteins in the sera of the above mice was detected using the goat anti-mouse Kappa polyclonal antibody (HRP*Polyclonal Goat Anti-Mouse Kappa, C030214) and the goat anti-mouse Lamda polyclonal antibody (HRP*Polyclonal Goat Anti-Mouse Lamda, C030213) from Reabo (Shanghai) Biochemical Technology Co., Ltd. The results are shown in Figure 26 B and 26C.

[0361] As can be seen from Figure 26 B and 26C, after antigen immunization, Kappa and Lamda antibodies that specifically reacted with the antigen OVA were detected in both IgM (lane 1) and IgA mice (lane 3), while no Kappa and Lamda antibodies that specifically reacted with the antigen OVA were detected in IgM-KL (lane 2) and IgA-KL mice (lane 4), demonstrating complete knockout of light chain proteins in IgM-KL and IgA-KL mice.

[0362] Example 12. Phenotype detection of IgM-KL-mini-1G heterozygous mice

[0363] (1) Serum Western blot assay of IgM-KL-mini-1G heterozygous mice

[0364] Three IgM-KL-mini-1G heterozygous mice prepared in Example 7 were immunized with OVA protein. Mice at 6 - 8 weeks of age were selected. The OVA antigen was formulated into a solution with a concentration of 500 ng / μL using sodium chloride injection solution, and the mice were injected intraperitoneally at a dose of 200 μL / mouse.

[0365] The sera of three IgM-KL-mini-1G mice after 72 hours of OVA immunization and three non-immunized C57BL / 6 mice were subjected to Western blot assay to verify whether there was expression of human-mouse chimeric single-chain antibody in IgM-KL-mini-1G heterozygous mice.

[0366] In each group of experiments, the loading volume of the serum sample was 1 μL. After boiling for denaturation, the sample was loaded onto a 12% SDS-PAGE gel for electrophoresis. After transfer to a PVDF membrane and blocking, goat anti-mouse IgG Fc HRP (JACKSON, 115-035-071) was used to detect the expression of human-mouse chimeric nanobody protein in the above-mentioned mouse serum. The results are shown in Figure 27 , where lanes 1-3 were serum samples from IgM-KL-mini-1G mice, and lanes 4-6 were serum samples from C57BL / 6 mice.

[0367] As Figure 27 can be seen, human-mouse chimeric nanobody and mouse intact antibody proteins were detected in the IgM-KL-mini-1G hybrid mice immunized with OVA antigen, while only mouse intact antibody protein was detected in the non-immunized C57BL / 6 mice, proving the expression of human-mouse chimeric single-chain antibody in IgM-KL-mini-1G mice.

[0368] (2) RT-PCR detection of IgM-KL-mini-1G hybrid mice immunized with OVA

[0369] Peripheral blood was collected from 3 IgM-KL-mini-1G hybrid mice immunized with OVA antigen in (1) above. Total RNA was extracted using Trizol and reverse-transcribed to obtain cDNA. Three degenerate primers for the human V gene and one primer for the murine IgHG were combined, and PCR amplification was performed using the cDNA of the sample as a template. The primers used and their sequences are shown in Table 20; in Table 20, the degenerate bases S, Y, R, W, M, K are defined as in the art. Specifically, S is G or C, Y is C or T, R is A or G, W is A or T, M is A or C, and K is G or T.

[0370] Table 20

[0371]

[0372] The PCR reaction system is shown in Table 21.

[0373] Table 21

[0374]

[0375] The PCR reaction program is shown in Table 22.

[0376] Table 22

[0377]

[0378] The PCR amplification product was ligated to -Blunt Zero Cloning vector was transformed into TOP10 strain and spread on LB plates (kanamycin resistant). Single colonies were picked for colony PCR, and the results are as Figure 28 shown. The positive clones were sequenced, and the sequencing results were analyzed with human immunoglobulin sequences by bioinformatics techniques to identify the expression of human VH genes after V(D)J recombination. Among the 60 valid sequencing results of the IgM-KL-mini-1G immunized mouse samples, 11 VH gene expressions were detected (Table 23). Among these gene segments, some VH genes are near the constant region, while others are far from the constant region. The data results in Table 23 indicate that the human VH genes on the human-mouse chimeric nanobody genes transferred by the mini-1G protocol can be rearranged and expressed in IgM-KL heterozygous background mice.

[0379] Table 23

[0380] IgHV Gene Count V1-2 19 V4-59 8 V6-1 6 V3-23 5 V3-15 4 V4-61 4 V5-51 4 V3-30 3 V3-7 3 V1-69 2 V3-35 2

[0381] Example 13. Phenotype Detection of F0 Mice of mini-4G

[0382] Peripheral blood was collected from 5 F0 mice of mini-4G (prepared as in Example 8). Total RNA was extracted with Trizol and reverse transcribed into cDNA. Three degenerate primers of human V genes and one primer of murine IgHG gene were combined, and PCR amplification was performed using the cDNA of the samples as templates. The primer sequences used are shown in Table 20.

[0383] The PCR amplification products were ligated to -Blunt Zero Cloning vector, transformed into TOP10 strain and spread on LB plates (kanamycin resistant). Single colonies were picked for colony PCR, and the results are as Figure 29 shown. The positive clones were sequenced, and the sequencing results were analyzed with human immunoglobulin sequences by bioinformatics techniques to identify the expression of human VH genes after V(D)J recombination. Among the 66 valid sequencing results of mini-4G mice, 11 VH gene expressions were detected (Table 24). Among these gene segments, some VH genes are near the constant region, while others are far from the constant region. The data results in Table 24 indicate that the human VH genes on the human-mouse chimeric nanobody genes transferred by the mini-4G protocol can be rearranged and expressed in C57BL / 6 background mice.

[0384] Table 24

[0385] IgHV Gene Count V1-2 40 V4-59 6 V3-30 4 V3-23 3 V5-51 3 V6-1 3 V1-69 2 V1-8 2 V3-15 1 V3-7 1 V4-61 1

[0386] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A method for preparing a genetically modified non-human mammal, characterized in that: The preparation method comprises the following steps: (1) disrupting an endogenous heavy chain immunoglobulin locus in a non-human mammal; and, (2) introducing the human IGHV gene, human IGHD gene, human IGHJ gene, and endogenous IgHG gene, IgHE gene, IgHA gene, and LCR region of the non-human mammal into the genetically modified non-human mammal obtained in step (1); in: The human IGHV gene includes part or all of the human IGHV genes selected from the following: hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2, hIGHV3-74, hIGHV3-72, hIGHV3 -66, hIGHV3-64, hIGHV3-35, hIGHV3-30, hIGHV3-20, hIGHV3-16, hIGHV3-15, hIGHV3-13, hIGHV3-33, hIGHV3-23, hIGHV3-7, h IGHV1-2, hIGHV6-1; optionally, the framework region of the above human IGHV gene comprises a mutation; further optionally, the framework region of hIGHV1-69, hIGHV4-61, hIGHV4-59, hIGHV5-51, hIGHV1-18, hIGHV1-8, hIGHV4-4, hIGHV1-2 genes comprises a gene mutation resulting in the following amino acid mutations: the 4th amino acid in the FR2 region mutates to phenylalanine, the 11th amino acid mutates to glutamic acid, the 12th amino acid mutates to arginine and the 14th amino acid mutates to glutamic acid; And / or, the human IGHD gene includes part or all of the human IGHD genes selected from the following: hIGHD1-1, hIGHD2-2, hIGHD3-3, hIGHD4-4, hIGHD5-5, hIGHD6-6, hIGHD1-7, hIGHD2-8, hIGHD3-9, hIGHD3-10, hIGHD4-11, hIGHD5-12, hIGHD6-13, hIGHD1-14 , hIGHD2-15, hIGHD3-16, hIGHD4-17, hIGHD5-18, hIGHD6-19, hIGHD1-20, hIGHD2-21, hIGHD3-22, hIGHD4-23, hIGHD5-24, hIGHD6-25, hIGHD1-26, hIGHD7-27; And / or, the human IGHJ gene is part or all of the human IGHJ genes selected from the following: hIGHJ1, hIGHJ2, hIGHJ2P, hIGHJ3, hIGHJ4, hIGHJ5, hIGHJ3P, hIGHJ6; And / or, the endogenous IgHG gene of the non-human mammal is any one selected from the following: (i) an endogenous complete IgHG2c gene of a non-human mammal, or an endogenous IgHG2c gene segment lacking the CH1 domain; or, (ii) endogenous complete IgHG3, IgHG1, IgHG2b and IgHG2c genes of a non-human mammal, or endogenous IgHG3, IgHG1, IgHG2b and IgHG2c gene segments lacking the CH1 domain.

2. The preparation method according to claim 1, characterized in that: The non-human mammal is a mouse, and in step (1), the disruption of the endogenous heavy chain immunoglobulin locus comprises the deletion of the following gene fragments: The CH1 fragment of the mouse antibody gene heavy chain IgHM, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ.

3. The preparation method according to claim 2, characterized in that: The gene fragment is deleted by CRISPR-Cas9 gene editing technology; Among them, the sgRNA for deleting the CH1 fragment of the mouse antibody gene heavy chain IgHM includes the sgRNA shown in SEQ ID NO: 1 and SEQ ID NO: 2; and / or, the sgRNA for deleting the Igkc fragment of the mouse antibody gene light chain Igk includes the sgRNA shown in SEQ ID NO: 3; and / or, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNA shown in SEQ ID NO: 4 and SEQ ID NO:

5.

4. The preparation method according to claim 1, characterized in that: The non-human mammal is a mouse, and in step (1), the disruption of the endogenous heavy chain immunoglobulin locus comprises the deletion of the following gene fragments: The fragments of the mouse antibody gene heavy chain from IgHM to IgHA-CH1, the Igkc fragment of the mouse antibody gene light chain Igk, and the fragments of the mouse antibody gene light chain Igλ from IgLc2 to IgLc1.

5. The preparation method according to claim 4, characterized in that: The gene fragment is deleted by CRISPR-Cas9 gene editing technology; Among them, the sgRNA for deleting the fragment from IgHM to IgHA-CH1 of the mouse antibody gene heavy chain includes the sgRNA shown in SEQ ID NO: 1 and SEQ ID NO: 6; and / or, the sgRNA for deleting the Igkc fragment of the mouse antibody gene light chain Igk includes the sgRNA shown in SEQ ID NO: 3; and / or, the sgRNA for deleting the fragment between IgLc2 and IgLc1 of the mouse antibody gene light chain Igλ includes the sgRNA shown in SEQ ID NO: 4 and SEQ ID NO:

5.

6. The preparation method according to claim 1, characterized in that: In step (2), the human IGHV gene, human IGHD gene, human IGHJ gene and endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of a non-human mammal are introduced by the following method: Introduce into the mice obtained in step (1): (I) one or more BAC clones containing all of the human IGHV genes, human IGHD genes, and human IGHJ genes; and, (II) one or more BAC clones comprising the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal.

7. The preparation method according to claim 6, characterized in that: In step (2), the human IGHV gene, human IGHD gene, human IGHJ gene and endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of a non-human mammal are introduced by the following method: Two BAC clones were introduced into the mice obtained in step (1), wherein: One BAC clone carries all of the human IGHV gene, human IGHD gene and human IGHJ gene, and the other BAC clone carries all of the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of the non-human mammal; and there are 5kb to 50kb, preferably 5kb to 20kb of gene homologous sequences at the beginning and end of the two BAC clones, so that they can be gene spliced ​​through overlapping gene sequences; Preferably, the genes contained in the two BAC clones are as shown in Table 13 or Table 15.

8. The preparation method according to claim 7, characterized in that: The human IGHV gene, human IGHD gene and human IGHJ gene are operably linked and can undergo VDJ rearrangement, and the human IGHV gene, human IGHD gene and human IGHJ gene that are operably linked and / or have undergone VDJ rearrangement are operably linked to the endogenous IgHG gene, IgHE gene, IgHA gene and LCR region of a non-human mammal; And / or, there is a Switch region of endogenous IgHM of human mammals between the human IGHJ gene and the endogenous IgHG gene of the non-human mammal.

9. A method for preparing a humanized whole antibody or single heavy chain antibody or nanobody that specifically binds to an antigen, the method comprising: (1) exposing a genetically modified non-human mammal obtained by the preparation method according to any one of claims 1 to 8 to an antigen; (2) collecting B cells from the non-human mammal obtained in step (1), extracting RNA and reverse transcribing it into cDNA, amplifying antibody gene fragments using the cDNA as a template and cloning them into a phage display vector; (3) allowing the phage vector obtained in step (2) to express the target antibody, panning the phage, enriching the phage expressing the target antibody and expressing it, and obtaining the target antibody, which is a humanized whole antibody or single heavy chain antibody; and Optionally, (4) cloning the variable region fragment of the obtained single heavy chain antibody to obtain a humanized nanobody.

10. A method for preparing a humanized whole antibody or single heavy chain antibody or nanobody that specifically binds to an antigen, the method comprising: (1) exposing the genetically modified non-human mammal obtained by the preparation method according to any one of claims 1 to 8 to an antigen, and then collecting B cells; (2) sequencing the nucleic acid encoding the immunoglobulin heavy chain variable region and optionally the light chain variable region in the B cells collected in step (1) to obtain the nucleic acid sequence of the heavy chain variable region and the light chain variable region of the humanized monoclonal antibody or the nucleic acid sequence of the heavy chain variable region of the humanized Nanobody; (3) expressing a humanized whole antibody or single heavy chain antibody that specifically binds to the antigen based on the sequence obtained in step (2); and, Optionally, (4) cloning the variable region fragment of the obtained single heavy chain antibody to obtain a humanized nanobody.

11. A method for obtaining a biological sample, the method comprising: (1) exposing a genetically modified non-human mammal obtained by the preparation method according to any one of claims 1 to 8 to an antigen; (2) Collecting biological samples from the animals.

12. The method according to claim 11, characterized in that The biological sample is spleen tissue, spleen cells or B cells.

13. A biological sample obtained by the method of claim 11 or 12.

Images