GADD45G as myocardial hypertrophy and heart failure biomarker and application of GADD45G in research and development of therapeutic drugs
By studying the function of Gadd45g, it was found that its expression was upregulated in the myocardial hypertrophy model. Specifically knocking out Gadd45g can alleviate the pathological process of myocardial hypertrophy, solve the treatment problems of myocardial hypertrophy and heart failure, and provide a new treatment strategy targeting Gadd45g.
Patent Information
- Application Number
- CN202510335740.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art is difficult to effectively solve the pathological processes of myocardial hypertrophy and heart failure, and lacks effective treatment methods.
By studying the function of Gadd45g, it was found that its expression was upregulated in the myocardial hypertrophy model, and specific knockdown of Gadd45g can significantly alleviate the pathological progression of myocardial hypertrophy. Examples: Phenylene epinephrine induces cardiomyocyte hypertrophy, knocking down Gadd45g significantly improves the progression of myocardial hypertrophy, while overexpressing Gadd45g aggravates myocardial hypertrophy.
The role of Gadd45g in the process of myocardial hypertrophy is proved, making targeted Gadd45g a new therapeutic strategy for the treatment of myocardial hypertrophy and heart failure.
Smart Images

Figure CN120174082A_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical field of cardiac hypertrophy, and specifically relates to GADD45G as a biomarker for cardiac hypertrophy and heart failure and its application in the research and development of therapeutic drugs. Background Art
[0002] Cardiac hypertrophy is a common pathological step in various cardiovascular diseases such as hypertension, coronary heart disease, and diabetes, and can progress to heart failure, with a lack of effective treatment means clinically. The main characteristics of pathological cardiac hypertrophy are pathological growth of cardiomyocytes, irregular assembly of sarcomeres, enhanced protein synthesis, and reprogramming of embryonic genes, etc. These pathological changes lead to cardiac instability and decompensation. In recent years, studies have found that epigenetic regulation is closely related to cardiovascular diseases, and epigenetic modification enzymes have become important molecular targets for the research and development of a new generation of drugs for treating cardiovascular diseases. Since epigenetic regulation is a dynamic process, the complex spatio-temporal regulation between different sites and different modifications under pathological conditions remains a hot topic and a difficult point in this field. Therefore, in-depth exploration of the mechanism of action of epigenetic regulation in the process of cardiac hypertrophy helps to clarify the molecular mechanism of the pathological occurrence and development of cardiac hypertrophy, reveal new drug targets, and improve the clinical diagnosis and treatment plans for cardiac hypertrophy and heart failure diseases.
[0003] Gadd45 is a family of proteins related to cell growth arrest and DNA damage response, including three gene members: Gadd45a, Gadd45b, and Gadd45g. The proteins of this family act as connectors between repair factors and chromatin in the process of DNA damage repair, thus maintaining the stability of the genome. In terms of molecular function, the Gadd45 family proteins are located in the nucleus and participate in epigenetic regulation by promoting DNA demethylation. Hoffman et al. found that the Gadd45 family proteins can activate the p38 / JNK signaling pathway through MTK1 / MEKK. Mice lacking Gadd45a and Gadd45b are more sensitive to DNA damage stress, but the molecular function of Gadd45g is still unclear. Summary of the Invention
[0004] The inventors of the present application have found through research that Gadd45g can exacerbate the pathological process of myocardial hypertrophy. Transcriptome data shows that Gadd45g is up-regulated in the myocardial hypertrophy model, and specifically knocking out Gadd45g in cardiomyocytes can significantly alleviate the pathological process of myocardial hypertrophy constructed by transverse aortic constriction (TAC). In addition, in the examples, phenylephrine (PE) was used to induce cardiomyocyte hypertrophy, and it was found that knocking down Gadd45g significantly improved the process of PE-induced myocardial hypertrophy. Moreover, overexpression of Gadd45g mediated by adenovirus in primary cardiomyocytes significantly exacerbated PE-induced myocardial hypertrophy, and the degree of hypertrophy induced by overexpressing Gadd45g alone was basically the same as that induced by PE. Additionally, transcriptome sequencing also found that compared with PE treatment, overexpressing Gadd45g can further increase the regulatory level of PE-regulated genes, indicating that Gadd45g can promote hypertrophic reprogramming. The present application clarifies the role of Gadd45g in the process of myocardial hypertrophy, making targeting Gadd45g a new treatment strategy for myocardial hypertrophy and heart failure.
[0005] Therefore, the embodiments of the present application disclose at least the following technical solutions:
[0006] In the first aspect, the embodiments disclose the application of Gadd45g in peripheral blood and / or myocardial tissue as a biomarker, which is for A1) or A2): A1) preparing a product for predicting myocardial hypertrophy; A2) preparing a product for treating myocardial hypertrophy; the application is for non-diagnostic or therapeutic use of diseases.
[0007] In the second aspect, the embodiments disclose the application of substances that reduce the activity and / or expression level of Gadd45g in peripheral blood and / or myocardial tissue, which is for B1) or B2): B1) preparing a product for predicting myocardial hypertrophy; B2) preparing a product for treating myocardial hypertrophy; the application is for non-diagnostic or therapeutic use of diseases.
[0008] In the third aspect, the embodiments disclose the application of substances targeting Gadd45g as a drug target in preparing a product, and the function of the product is C1) or C2): C1) predicting myocardial hypertrophy; C2) preventing and / or treating myocardial hypertrophy; the application is for non-diagnostic or therapeutic use of diseases.
[0009] In some embodiments of the third aspect, the detection object of Gadd45g is an in vitro peripheral blood and / or myocardial tissue sample.
[0010] In the fourth aspect, the embodiments disclose the application of mice with increased activity and / or expression level of Gadd45g in peripheral blood and / or myocardial tissue in preparing and / or screening drugs; the function of the drugs is D1) or D2): D1) predicting myocardial hypertrophy; D2) preventing and / or treating myocardial hypertrophy; the application is for non-diagnostic or therapeutic use of diseases.
[0011] In some embodiments of the fourth aspect, the drug is selected from one or more of nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, polypeptides, proteins, gene editing vectors, lentiviruses, adenoviruses or adeno-associated viruses.
[0012] In a fifth aspect, embodiments disclose an inhibitor, which is a substance that downregulates the expression of the Gadd45g gene, silences or knocks out the Gadd45g gene, and / or a substance that promotes the content and / or activity of the Gadd45g protein.
[0013] In some embodiments of the fifth aspect, the inhibitor is interfering RNA. The sense strand of the interfering RNA is as shown in SEQ ID NO.3, and the antisense strand of the interfering RNA is as shown in SEQ ID NO.4.
[0014] In a sixth aspect, embodiments disclose a kit, including substances for detecting the activity and / or expression level of Gadd45g; the detection objects of the kit are peripheral blood and / or myocardial tissue; the use of the kit is to predict myocardial hypertrophy or prevent and / or treat myocardial hypertrophy.
[0015] In some embodiments of the sixth aspect, the kit consists of substances for detecting the activity and / or expression level of Gadd45g.
[0016] In some embodiments of the sixth aspect, the kit is an RT-PCR kit, and the kit includes a primer pair as shown in SEQ ID NO.5 and SEQ ID NO.6. Description of the Drawings
[0017] Figure 1 Related results of the upregulation of Gadd45g expression in model cells or mice with myocardial hypertrophy provided in the examples. (a) Combined analysis of RNA-seq of PE-induced cardiomyocyte hypertrophy and the dataset after mouse aortic stenosis surgery; (b) Co-regulated genes in mouse aortic stenosis surgery and PE-induced myocardial hypertrophy, and the expression of Gadd45g was significantly upregulated during the process of myocardial hypertrophy. (c) Detection of hypertrophy indexes of PE-induced NRVMs; (d) Detection of the expression of Gadd45g in the hypertrophy model of PE-induced NRVMs; (e) Detection of hypertrophy indexes in the mouse myocardial hypertrophy model constructed by TAC; (f) Detection of the expression of Gadd45g in the in vivo hypertrophy model induced by TAC; *P<0.05, **P<0.01, ***P<0.001 vs. Control or TAC.
[0018] Figure 2 For Gadd45g provided in the examples fl / fl mice and Gadd45g fl / fl; Detection results of various indicators of Cre mice. (a) Detection results of relative expression levels of Gadd45g mRNA. (b) Heart sizes of two types of mice after Sham and TAC surgeries. (c) Representative HE staining of left ventricular cross-sections of two types of mice after Sham and TAC surgeries. (d) Heart weight / body weight ratios of two types of mice after Sham and TAC surgeries. (e) Liver weight / body weight ratios of two types of mice after Sham and TAC surgeries. (f) Heart weight / tibia length ratios of two types of mice after Sham and TAC surgeries. (g) Liver weight / tibia length ratios of two types of mice after Sham and TAC surgeries. (h) WGA staining images of heart tissues and statistical analysis of cardiomyocyte size and dimensions of two types of mice after Sham and TAC surgeries, scale bar: 20 μm. (i) Results of relative expression levels of mRNA of hypertrophy markers Nppa and Nppb in two types of mice after Sham and TAC surgeries. In the figure, *P < 0.05, **P < 0.01, ***P < 0.001 vs Gadd45g fl / fl ; #P < 0.05, P < 0.001 vs Sham. "Sham" represents the control, sham operation group, that is, the whole procedure is the same as TAC except for aortic ligation.
[0019] Figure 3 For the Gadd45g provided in the example fl / fl mice and Gadd45g fl / fl : Detection results of various indicators of cardiac function of Cre mice. (a) Echocardiograms of two types of mice. (b) Ejection fraction (EF) of two types of mice. (c) Fractional shortening (FS) of two types of mice. (d) Left ventricular end-diastolic diameter (LVIDd) of two types of mice. (e) Left ventricular posterior wall thickness in diastole (LVPWd) of two types of mice. (f) Left ventricular end-systolic diameter (LVIDs) of two types of mice. (g) Histological analysis of Masson staining of heart tissues of two types of mice after Sham and TAC surgeries, scale bar: 50 μm. *P < 0.05, **P < 0.01, ***P < 0.001 vs Gadd45g fl / fl ; #P < 0.05, P < 0.001 vs Sham. "Sham" represents the control, sham operation group, that is, the whole procedure is the same as TAC except for aortic ligation.
[0020] Figure 4Detection results of siRNA knockdown of PE-induced cardiomyocyte hypertrophy cells provided in the examples. (a) Relative expression levels of Gadd45g mRNA in knockdown cells (siGadd45g) and non-knockdown cells (siNeg). (b) Relative expression levels of mRNA of hypertrophy indicators Nppa and Nppb in knockdown cells and non-knockdown cells with or without PE induction. (c) WGA staining images of knockdown cells and non-knockdown cells with or without PE induction. (d) Statistical results of cell size and cardiomyocyte area in Figure c. *P<0.05, **P<0.01, ***P<0.001 vs siNeg; #P<0.05, P<0.001 vs Control. In the figure, siNeg is the control of siGadd45g, and Control is the control of PE.
[0021] Figure 5 Detection results of overexpressing cells provided in the examples. (a) Relative expression levels of Gadd45g mRNA in overexpressing cells (Ad-Gadd45g) and non-overexpressing cells (Ad-Vector). (b) Relative expression levels of mRNA of hypertrophy indicators Nppa and Nppb in overexpressing cells and non-overexpressing cells with or without PE induction. (c) WGA staining images of overexpressing cells and non-overexpressing cells with or without PE induction. (d) Statistical results of cell size and cardiomyocyte area in Figure c. *P<0.05, **P<0.01, ***P<0.001 versus Ad-Vector; #P<0.05, P<0.001 vs Control. In the figure, Ad-Vector is the control of Ad-Gadd45g, and Control is the control of PE.
[0022] Figure 6 Transcriptomic analysis results of cardiomyocytes overexpressing Gadd45g provided in the examples. (a) PCA plot of the overall gene distribution profile of different treatments. (b) Venn diagram of up- and down-regulated differential genes between different groups. (c) Heat map and Go analysis show that overexpression of Gadd45G mainly affects the expression of genes related to heart development, structure and contraction function, etc. (d) GSEA analysis shows that overexpression of Gadd45g mainly down-regulates the expression of genes related to dilated cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy and myocardial contraction, etc. Detailed implementation manners
[0023] To make the objectives, technical solutions, and advantages of this application more clear and understandable, the following further details this application in combination with embodiments. It should be understood that the specific embodiments described herein are merely used to explain this application and are not used to limit this application. Reagents not specifically described in detail in this application are all conventional reagents and can be obtained from commercial sources; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.
[0024] Materials and Methods
[0025] 1. Animal Rearing
[0026] All experimental procedures in this project were reviewed and approved by the Animal Care and Use Committee of Shenzhen Hospital, Fuwai Hospital, Chinese Academy of Medical Sciences, and were carried out in accordance with the Guide for the Care and Use of Laboratory Animals (8th Edition) published by the National Institutes of Health, USA. All mice were reared in a specific relatively clean environment (room temperature, 24 ± 3°C; room humidity 55 ± 5%), with a 12-hour light / 12-hour dark cycle, and fed a normal diet. This study used 8-week-old male mice with a C57BL / 6 background; the number of mice studied in each experiment is stated.
[0027] 2. Transverse Aortic Constriction Surgery (TAC)
[0028] When the heart is under long-term pressure load, it is most likely to induce the formation of ventricular hypertrophy and present compensatory myocardial hypertrophy. Mice with cardiac-specific knockout of Gadd45g (Gadd45g fl / fl :Cre) and their control mice Gadd45g fl / fl (8 weeks old, body weight 24 - 26 g) were randomly divided into a sham operation group (Sham) and a TAC group, and the grouping information was double-blind between the researchers performing the surgery and the data analysts. The mice were anesthetized by intraperitoneal injection of 50 mg / kg sodium pentobarbital, and then fixed on the operating table, supported by a mouse micro ventilator (ALcott Biotechnology, Shanghai, China). The respiratory rate was set at 110 breaths / minute, the tidal volume was 2 mL / minute, and the inhalation / exhalation ratio was 1:2. An adjustable heating pad was used in the experimental procedure to maintain the body temperature at 37°C. After depilation with depilatory cream and routine disinfection, the chest was incised horizontally along the 2nd - 3rd intercostal space, the thoracic aorta was dissected free, and a 27-gauge needle was ligated together with the aorta using 7-0 surgical suture. Then the needle was withdrawn to create approximately 70% aortic stenosis; then the chest was sutured closed layer by layer. In the sham operation group (Sham), the entire procedure was the same except for aortic ligation. The successful constriction of the aorta was confirmed by echocardiography with Doppler.
[0029] 3. Echocardiography
[0030] Eight weeks after TAC surgery, cardiac function was evaluated by echocardiography. First, rats were anesthetized by inhalation maintenance with 1.5 - 2% isoflurane and placed in the supine position. The left anterior chest area of the mice was shaved, coated with coupling agent, and ultrasonic detection was performed using a high - frequency Doppler ultrasound instrument (Vevo2100, FujiFiLm, VisuaLSonics). The standard short - axis section of the left ventricular papillary muscle was selected to measure the left ventricular end - diastolic diameter (LVIDD), left ventricular end - systolic diameter (LVISD), left ventricular posterior wall thickness (LVPWD), interventricular septum thickness in diastole (IVSD), ejection fraction (EF), and fractional shortening (FS) of the mice.
[0031] 4. Histopathological analysis
[0032] After echocardiography, the hearts and lungs of each group of mice were removed, blotted dry with filter paper, weighed separately, and the ratios of heart weight to body weight (HW / BW), lung weight to body weight (LW / BW), and heart weight to tibia length (HW / TL) were calculated, and the gross appearance of the heart was observed macroscopically. Five hearts from each group were fixed with 10 - fold volume of 4% paraformaldehyde. After 24 h, the mouse hearts were placed on a photographing board and photographed with a camera (Nikon D700). Then the hearts were dehydrated, paraffin - embedded, and sectioned (section thickness 5 μm, 18 sections were cut from each heart). Some of the tissue sections were reserved for myocardial collagen staining; the other part of the tissue sections were subjected to routine HE staining and FITC - labeled wheat germ agglutinin (WGA; n = 6 / group) staining. Using an image acquisition digital analysis system (Image Pro PLus 6.0), more than 200 intact cross - sectional myocardial cells were counted in each experimental group, and the cross - sectional area of myocardial cells was calculated.
[0033] 5. Isolation and culture of primary cardiomyocytes (NRVMs)
[0034] First, neonatal rats within 3 days after birth were taken, and the chest skin was disinfected with 75% ethanol. Then, the chest skin was cut open with sterilized surgical scissors and disinfected again. Next, the heart was taken out with a curved forceps and placed in a large dish containing sterile PBS. The large blood vessels and atria attached to the heart surface were carefully cut off, and then the ventricular tissue was thoroughly minced. Digestion was carried out using a digestive solution composed of 0.08% type II collagenase (Sigma) and 0.125% trypsin (Sigma) at 37°C for 20 min each time. The supernatant obtained from the first digestion was discarded, and the supernatant was collected starting from the second time. This step was continued until the heart tissue was completely digested. Fibroblasts and cardiomyocytes were separated by percoll (GE) density gradient centrifugation, and cardiomyocytes were retained. The cardiomyocytes were cultured in high-glucose DMEM (Hyclone) medium containing 10% fetal bovine serum (Gbico) and 1% penicillin / streptomycin. After culturing for 24 h, the medium was changed to high-glucose DMEM containing 1% ITS and 1% penicillin / streptomycin.
[0035] 6. Construction of cardiomyocyte hypertrophy model cells
[0036] Phenylephrine (PE) is an α-receptor agonist that can enhance myocardial contractility and is a commonly used inducer for constructing a cardiomyocyte hypertrophy model. After NRVMs were plated and cultured for 24 h, the medium was replaced with high-glucose DMEM medium containing 1% ITS and 1% penicillin / streptomycin for starvation treatment for 12 h for normalization, and then other knockdown or overexpression treatments were carried out. 36 h before harvesting the cells, phenylephrine was added to the medium at a final concentration of 50 μM and treated for 36 h to obtain cardiomyocyte hypertrophy model cells.
[0037] 7. Preparation of knockdown cells (siGadd45g)
[0038] In some embodiments, cardiomyocytes with reduced Gadd45g expression levels were prepared.
[0039] For example, it was achieved by transfecting cardiomyocyte hypertrophy model cells with siRNA. The Gadd45g-specific siRNA oligonucleotides were purchased from GenePharma. The sequences of the siRNA used were as follows: Gadd45g sense strand: ACGCUAUCGUGGAAGCUUUGAAU TT , shown as SEQ ID NO.1 (which is a DNA / RNA chimera that can increase the stability of its complex with the antisense strand); antisense strand: AAAUUCAAAGCUUCCACGAUAGCGUCC, shown as SEQ ID NO.2. According to the manufacturer's instructions, Lipofectamine iMAX (Invitrogen) was used for siRNA transfection.
[0040] Before transfection, change the culture medium to 1% ITS + high-glucose DMEM medium. Then, prepare the siRNA solution and the transfection reagent RNAiMAX solution respectively. Each well contains 4 μL of siRNA + 100 μL of Opti-MEM medium for the siRNA solution, and 6 μL of RNAiMAX + 100 μL of Opti-MEM medium for the transfection reagent solution. After preparation, let it stand at room temperature for 5 minutes, then mix the two and invert it up and down to mix evenly. After standing at room temperature for 15 minutes, add it to the cell culture medium. 12 hours after siRNA transfection, change the culture medium to 1% ITS + 1% penicillin-streptomycin solution + high-glucose DMEM medium. Continue the culture. After 36 h, harvest the knockdown cells (siGadd45g) for WGA staining or extract RNA to detect the expression of hypertrophy-related genes.
[0041] 8. Preparation of overexpressing cells (Ad-Gadd45g)
[0042] Use primers Gadd45g-CZF (5'ATAGGGAGACCCAAGCTGGCTAGCgccaccatgactctggaagaagtcc-3', SEQ ID NO.3) and Gadd45g-CZR (5'-ATCTGGTACGTCGTATGGGTATCTAGActcgggaagggtgatgctggg-3', SEQ ID NO.4) to amplify the cDNA fragment of the mature peptide of Gadd45g (NCBI, NM_001077640.2), and insert it into the NheI and XbaI sites of the pcDNA3.1-HA plasmid by cloning to construct the pcDNA3.1-Gadd45g-HA recombinant plasmid.
[0043] Transfer pcDNA3.1-Gadd45g-HA into Escherichia coli DH-5α for large-scale replication of the plasmid to obtain a sufficient amount of plasmid. In addition, in order to overexpress Gadd45g in primary cardiomyocytes, the pcDNA3.1-Gadd45g-HA plasmid was sent to Shanghai Hanheng Biotechnology Co., Ltd. for virus packaging (refer to Huo Yuyan, Construction and identification of overexpression adenovirus vector of Om i / HtrA2 gene, Science and Technology Vision, No. 16, 2020, 2095-2457). Add the virus to the culture medium of NRVMs at a ratio of multiplicity of infection (MOI) = 10. 12 hours after the virus infects the model cells, change the culture medium to high-glucose DMEM medium containing 1% ITS and 1% penicillin / streptomycin to remove the virus. After continuing the culture for 36 h, harvest the overexpressing cells (Ad-Gadd45g). Use the adenovirus vector encoding the green fluorescent protein gene as a control.
[0044] 8, Wheat germ agglutinin (WGA) staining
[0045] Wash the knockdown cells and overexpressing cells prepared in the above steps once with PBS, and fix them with 4% paraformaldehyde at room temperature for 10 min. Aspirate the fixative, gently rinse three times with PBS for 5 min each time. Permeabilize with 0.2% Triton X-100 at room temperature for 5 min, stain with fluorescein isothiocyanate (FITC)-labeled wheat germ agglutinin (WGA) at 37 °C for 15 min, and stain the nuclei with DAPI for 10 min. Then take pictures after rinsing, and use the Image J digital analysis system to calculate the cross-sectional area of cardiomyocytes.
[0046] 9, Real-time quantitative PCR
[0047] Use the GenELute Mammalian Total RNA Miniprep Kit (Sigma-Aldrich) to extract total RNA from cells and heart tissues according to the manufacturer's instructions. Quantify the RNA by NanoDrop (Thermo Fisher Scientific). Reverse transcribe 0.5 μg of RNA into cDNA using the First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, U.S.A.). Perform real-time fluorescence quantitative PCR on the CFX96M Touch Real-time PCR Detection System (Roche, Basel, Switzerland) using specific primers and Ultra SYBR Mixture (Mona, Suzhou, China). The reaction system for qRT-PCR is shown in Table 1, the reaction program is shown in Table 2, and the primers are shown in Table 3.
[0048] Table 1
[0049] 2×SYBR Green Master MIX 5 μL Water 3 μL Forward Primer 0.5 μL Reserve Primer 0.5 μL cDNA 1 μL
[0050] Table 2
[0051]
[0052] In a 96-well plate, first add the reaction system except cDNA, then add cDNA, seal it with a transparent film, centrifuge at 4500 rpm for 2 min at room temperature, and detect it using a real-time quantitative PCR instrument. After the reaction, use GAPDH as the endogenous control, and use 2 -ΔΔCtThe relative expression levels of each gene were determined by the method. Statistical analysis was performed using GraphPad Prism 8 software. All experimental data were expressed as the mean ± SEM of at least three independent experiments. One-way ANOVA or two-way ANOVA was used for the statistical significance of multiple comparisons, and then Tukey's test was used. Bonferroni adjustment was used for post hoc analysis. The t-test was used for comparison between two groups. P < 0.05 was considered statistically significant. In Table 1, the primers named "r" were used for the detection of samples from C57BL / 6 mice, and the primers named "m" were used for the detection of samples from neonatal rat cardiomyocytes.
[0053] Table 3 Primer sequences
[0054] Name Sequence(5'-3') rGadd45g-qF aagtcctgaatgtggaccctg, as shown in SEQ ID NO.5 rGadd45g-qR gggttcgaaatgaggatgcaa, as shown in SEQ ID NO.6 rNppa-qF atacagtgcggtgtccaaca, as shown in SEQ ID NO.7 rNppa-qR agccctcagtttgcttttca, as shown in SEQ ID NO.8 rNppb-qF cagctctcaaaggaccaagg, as shown in SEQ ID NO.9 rNppb-qR gcagcttgaactatgtgcca, as shown in SEQ ID NO.10 mGadd45g-qF tgattcaggcgttctgctgt, as shown in SEQ ID NO.11 mGadd45g-qR agggtccttccatgtgtcct, as shown in SEQ ID NO.12 rGAPDH-qF acagcaacagggtggtggac, as shown in SEQ ID NO.13 rGAPDH-qR tttgagggtgcagcgaactt, as shown in SEQ ID NO.14 mNppa-qF tttcaagaacctgctagaccacc, as shown in SEQ ID NO.15 mNppa-qR gatctatcggaggggtccca, as shown in SEQ ID NO.16 mNppb-qF cgctgggaggtcactcctat, as shown in SEQ ID NO.17 mNppb-qR cttcagtgcgttacagcccaa, as shown in SEQ ID NO.18 mGAPDH-qF tcctgcaccaccaactgcttag, as shown in SEQ ID NO.19 mGAPDH-qR gatgaccttgcccacagccttg, as shown in SEQ ID NO.20
[0055] Results
[0056] 1. Gadd45g is upregulated during the process of cardiac hypertrophy
[0057] As Figure 1 shown in Figure 1 a and Figure 1 b, Gadd45g was upregulated both in cells of the cardiac hypertrophy model induced by PE and in cardiac hypertrophy of mice constructed by TAC. As Figure 1 shown in Figure 1 c, Nppa, Nppb, and Myh7 were upregulated and Myh6 was downregulated in cells of the cardiac hypertrophy model induced by PE, indicating that the cardiac hypertrophy model cells were successfully constructed. As Figure 1 shown in Figure 1 d, the expression of Gadd45g mRNA was upregulated in cells of the cardiac hypertrophy model. As
[0058] shown in
[0059] e and fl / fl f, the mRNA level of Gadd45g increased in the heart tissues of mice with cardiac hypertrophy induced by TAC. fl / fl This indicates that Gadd45g is upregulated during the pathological process of cardiac hypertrophy, suggesting that Gadd45g is closely related to the disease process of cardiac hypertrophy. Figure 2 a).
[0060] Subsequently, a myocardial hypertrophy model was constructed by TAC. At 8 weeks after the operation, the degree of TAC-induced myocardial hypertrophy was determined by ultrasound, and samples were taken for the detection of hypertrophy phenotypes. It can be seen from the gross heart view and cross-sectional view that the pressure overload induced by TAC did increase the heart size of Gadd45g fl / fl mice, while knockout of Gadd45g inhibited TAC-induced cardiac enlargement ( Figure 2 b, c); compared with Gadd45g fl / fl mice, the heart weight / body weight ratio and heart weight / tibia length ratio of Gadd45g fl / fl :Cre mice were smaller under pressure overload ( Figure 2 d, f), while the liver weight / body weight ratio and liver weight / tibia length ratio were larger ( Figure 2 e, g). Moreover, by counting the cardiomyocyte area through WGA staining of myocardial tissue, it was found that, compared with Gadd45g fl / fl mice, the cardiomyocyte area of Gadd45g fl / fl :Cre mice was smaller ( Figure 2 h). The examples also detected the myocardial hypertrophy markers (Nppa, Nppb), and the results showed that the hypertrophy state of Gadd45g fl / fl ;Cre mice was less severe, indicating that knockout of Gadd45g could inhibit myocardial hypertrophy.
[0061] 3. Knockout of Gadd45g can significantly improve the impaired cardiac function of mice
[0062] Figure 3 a shows representative echocardiograms of the effects on left ventricular cardiac function of Gadd45g fl / fl mice and Gadd45g fl / fl :Cre mice in the sham operation group (Sham) and after TAC. Figure 3 b-f show the ejection fraction (EF), fractional shortening (FS), left ventricular posterior wall thickness in diastole (LVPWd), left ventricular end-diastolic diameter (LVIDd), and left ventricular end-systolic diameter (LVIDs) of Gadd45g fl / fl mice and Gadd45g fl / fl :Cre mice under basal conditions and after TAC. Figure 3 g shows the Masson staining images of the heart tissues of Gadd45g fl / fl mice and Gadd45g fl / fl :Cre mice in the Sham group and after TAC.
[0063] The results showed that knockout of Gadd45g significantly improved the impaired ejection fraction and fractional shortening after TAC surgery and prevented left ventricular dilation. This indicates that knockout of Gadd45g can significantly improve impaired cardiac function in mice.
[0064] 4. Interference with Gadd45g can improve the hypertrophy process of cardiomyocytes induced by PE
[0065] To further explore the role of Gadd45g in myocardial hypertrophy, we treated NRVMs with PE to establish a cardiomyocyte hypertrophy model.
[0066] In some embodiments, siRNA was used to interfere with and knockdown PE-induced hypertrophic cardiomyocytes (as in step 8 above)( Figure 4 a), and the results were as Figure 4 shown in b-d. In the PE-induced cardiomyocyte hypertrophy model, knockdown of Gadd45g inhibited the upregulation of PE-induced hypertrophy markers (Nppa and Nppb)( Figure 4 b), and also inhibited the increase in cardiomyocyte surface area( Figure 4 c, d).
[0067] In some embodiments, Gadd45g was overexpressed in NRVMs by adenovirus( Figure 5 a), and the results showed that in the PE-induced cardiomyocyte hypertrophy model, overexpression of Gadd45g significantly aggravated the upregulation of PE-induced hypertrophy markers (Nppa and Nppb)( Figure 5 b) and the increase in cardiomyocyte surface area( Figure 5 c, d); these results further indicate that Gadd45g promotes the process of myocardial hypertrophy, suggesting that Gadd45g is a promoter of myocardial hypertrophy.
[0068] 5. Gadd45g promotes transcriptional reprogramming of hypertrophy-related genes
[0069] To explore the mechanism by which Gadd45g inhibits myocardial hypertrophy, the embodiments performed transcriptome sequencing analysis on NRVMs with or without PE treatment and with or without overexpression of Gadd45g.
[0070] As Figure 6 shown by the principal component analysis (PCA) in a, overexpression of Gadd45g formed a gene expression pattern different from that of PE-induced myocardial hypertrophy transcriptome reprogramming.
[0071] As Figure 6 shown in b, under basal conditions, overexpression of Gadd45g significantly changed the transcriptome pattern of cardiomyocytes, with 942 genes upregulated and 1273 genes downregulated.
[0072] As Figure 6 The differential gene set enrichment analysis results of c showed that the cardiovascular development-related systems were prominent in the down-regulated gene groups. By comparing the differential genes between PE treatment and overexpression of Gadd45g, it was found that the number of differentially expressed genes with the same direction of change between the two was more than that with the opposite direction. Moreover, among the differentially expressed genes significantly changed after PE treatment, a large number of genes showed further enhanced differences after overexpression of Gadd45g.
[0073] As Figure 6 The GSEA analysis of d showed that genes related to dilated cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, and myocardial contraction were down-regulated after overexpression of Gadd45g. The overall analysis results indicated that Gadd45g could lead to pro-hypertrophic transcriptome reprogramming.
[0074] In summary, this application first demonstrated the role of Gadd45g in the pathological occurrence and development of myocardial hypertrophy. The transcriptome data of myocardial hypertrophy samples were analyzed in the examples, and the results showed that the expression level of Gadd45g was significantly up-regulated in the process of myocardial hypertrophy. In the examples, an in vivo hypertrophy model was constructed by TAC using mice with inducible specific knockout of Gadd45g in cardiomyocytes, and it was clarified that knocking out Gadd45g could inhibit the pathological occurrence process of myocardial hypertrophy induced by TAC. In the examples, a myocardial cell hypertrophy model was induced by PE on NRVMs, and Gadd45g was knocked down and overexpressed by siRNA and adenovirus, further demonstrating the promoting effect of Gadd45g in the process of myocardial hypertrophy. Through in vivo and in vitro methods and combined with transcriptome sequencing, the examples proved that Gadd45g acts as a pro-hypertrophic factor in the pathological development process of myocardial hypertrophy.
[0075] The above are only the preferred specific embodiments of this application, but the protection scope of this application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in this application should be covered by the protection scope of this application.
Claims
1. Application of Gadd45g in peripheral blood and / or myocardial tissue as a biomarker (A1) or A2): A1) preparing a product for predicting cardiac hypertrophy; A2) preparing products for treating myocardial hypertrophy; The use comprises the product preparation steps of A1) and / or A2).
2. Use of a substance that reduces the activity and / or expression of Gadd45g in peripheral blood and / or myocardial tissue, B1) or B2): B1) preparing a product for predicting myocardial hypertrophy; B2) preparing products for treating myocardial hypertrophy; The use comprises the product preparation steps of B1) and / or B2).
3. Use of Gadd45g as a drug target substance in the preparation of a product, wherein the function of the product is C1) or C2): C1) Prediction of myocardial hypertrophy; C2) prevention and / or treatment of myocardial hypertrophy; The use comprises the product preparation steps of C1) and / or C2).
4. The use according to claim 3, wherein the detection object of Gadd45g is in vitro peripheral blood and / or myocardial tissue samples.
5. Use of mice with reduced Gadd45g activity and / or expression in peripheral blood and / or myocardial tissue in the preparation and / or screening of drugs; the function of the drug is D1) or D2): D1) Prediction of myocardial hypertrophy; D2) prevention and / or treatment of myocardial hypertrophy; The application comprises the drug screening steps of A1) and / or A2).
6. The use according to claim 5, wherein the drug is selected from one or more of nucleic acid molecules, carbohydrates, lipids, small molecule compounds, antibodies, peptides, proteins, gene editing vectors, lentiviruses, adenoviruses or adeno-associated viruses.
7. An inhibitor, which is a substance that downregulates Gadd45g gene expression, silences or knocks out the Gadd45g gene, and / or a substance that promotes the content and / or activity of Gadd45g protein.
8. The inhibitor according to claim 7, which is an interfering RNA that downregulates the expression of the Gadd45g gene, wherein the sense strand of the interfering RNA is as described in SEQ ID NO.3, and the antisense strand of the interfering RNA is as described in SEQ ID NO.
4.
9. A kit comprising a substance for detecting the activity and / or expression of Gadd45g; The test object of the kit is peripheral blood and / or myocardial tissue; The kit is used for predicting myocardial hypertrophy or preventing and / or treating myocardial hypertrophy.
10. The kit according to claim 6, which is composed of substances for detecting the activity and / or expression level of Gadd45g.