Detection primer for atherosclerosis-related SNP site rs759080989 and application of detection primer
By designing detection primers for ARMS-PCR, the problem of inconvenience and efficiency of atherosclerotic imaging screening in the prior art was solved, and efficient detection of relevant SNP sites was achieved, which is of clinical significance and market value.
Patent Information
- Application Number
- CN202510416703.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-03
- Publication Date
- 2025-06-20
AI Technical Summary
The existing atherosclerotic imaging screening is not convenient and efficient enough, especially for high-risk groups, and there is a lack of an efficient, convenient, sensitive and specific detection method.
A detection primer using ARMS-PCR method was designed to specifically match the SNP site rs759080989 related to atherosclerosis, improve the reaction system and reaction conditions, and enable it to successfully complete the amplification and detection of the target gene.
The efficient detection of atherosclerosis-related SNP sites rs759080989 has potential clinical significance and can provide huge market value.
Smart Images

Figure HDA0005344140600000011 
Figure HDA0005344140600000012
Abstract
Description
Technical Field
[0001] This application relates to the field of gene detection. More specifically, it relates to primers for detecting the SNP locus rs759080989 related to atherosclerosis and their applications. Background Art
[0002] Atherosclerosis is a chronic progressive disease, mainly manifested by the deposition of lipids, cholesterol and other substances in the arterial wall, forming plaques, resulting in arterial stenosis and sclerosis. It is the main pathological basis of cardiovascular diseases (such as coronary heart disease, stroke and peripheral arterial diseases), with high morbidity and mortality rates globally. According to the statistics of the World Health Organization (WHO), cardiovascular diseases are the leading cause of death worldwide, and atherosclerosis is its core pathological mechanism. Early detection and intervention are crucial for preventing serious cardiovascular events.
[0003] Single nucleotide polymorphisms (SNPs) refer to variations of single nucleotides in the genome, including transitions, transversions, deletions and insertions, forming genetic markers. SNPs have the characteristics of being known, heritable and detectable, and can be used for the mapping, cloning and identification of disease genes, and for finding mutation sites related to diseases. The rs759080989 locus is located at chr17:50185514 (GRCh38.p14) of humans. Previous studies have shown that mutations at this locus are somewhat related to the occurrence of atherosclerosis.
[0004] The Chinese name of ARMS is amplification refractory mutation system (ARMS). ARMS-PCR combines ARMS technology and gene PCR technology. Its basic principle is that when the base at the 3′ end of the primer is completely complementary to the template, the primer can be normally extended. If the base at the 3′ end of the primer is not complementary to the template base, that is, there is a mismatch, primer extension is inhibited or even completely terminated. This method is often used to detect the variability of SNP loci.
[0005] The occurrence and development process of atherosclerosis is very long. Early lesions can start in childhood and develop into diseases in middle and old age, or some people may develop the disease in young adulthood. Currently, the most commonly used imaging methods for atherosclerosis are B-ultrasound, CT and magnetic resonance. However, these imaging screenings for atherosclerosis are not convenient and efficient enough. For high-risk populations, it is very necessary to develop a highly efficient, convenient, sensitive and specific detection method. Therefore, designing primers for detecting the SNP locus rs759080989 related to atherosclerosis using the ARMS-PCR method and their applications have potential clinical significance and can provide great market value. Summary of the Invention
[0006] The object of the invention of the present application is to provide a detection primer for the SNP locus rs759080989 related to atherosclerosis and its application. The design and verification of the detection primer and its application are based on the ARMS-PCR method to specifically match the primer for the rs759080989 locus, and the reaction system and reaction conditions are improved to successfully complete the amplification and detection of the target gene, which has positive significance for clinical practice.
[0007] To achieve the above object of the invention, the present application adopts the following technical solutions:
[0008] In the first aspect, the present application provides a detection primer for the SNP locus rs759080989 related to atherosclerosis. The primer includes 2 non-specific outer primers and 2 inner primers for specifically detecting the SNP mutation site. The 2 outer primers have the sequences shown in SEQ ID NO:1 (forward primer) and SEQ ID NO:2 (reverse primer) or their complementary sequences, and the 2 inner primers have the sequences shown in SEQ ID NO:3 (forward primer) and SEQ ID NO:4 (reverse primer) or their complementary sequences.
[0009] SEQ ID NO:1 is as follows: CGAGAGCATGACCGATGGAT;
[0010] SEQ ID NO:2 is as follows: AGGGGGTTCAGTTTGGGTTG;
[0011] SEQ ID NO:3 is as follows: GCTTCGACGTTGGCCCTGTA;
[0012] SEQ ID NO:4 is as follows: AGGGAGTTTACAGGAAGCAG.
[0013] Among them, the 2 inner primers for specifically detecting the SNP mutation site respectively correspond to the polymorphism of the SNP locus rs759080989 (T / G).
[0014] When detecting a homozygous wild-type or mutant sample, a non-specific DNA product will be generated and a specific DNA primer with different lengths will be generated respectively. When detecting a heterozygous mutant sample, a non-specific DNA product and two specific DNA primers with different lengths will be generated.
[0015] In the second aspect, the present application provides the application of the detection primer in the first aspect in the preparation of a kit for detecting atherosclerosis or mutations in the SNP locus rs759080989 related to atherosclerosis.
[0016] In the third aspect, the present application provides a detection kit, and the kit includes:
[0017] RNase-free water and buffer;
[0018] 2×SYBR Green Master Mix;
[0019] The four primers described in claim 1.
[0020] Positive control, including two positive plasmids pUC57 with 539 copies of wild-type and mutant SNP site rs759080989 respectively;
[0021] Negative control, nucleic acid-free water.
[0022] Fourthly, the present application provides a method for using the kit described in the third aspect, including the following steps:
[0023] Step 1: Extraction of sample DNA;
[0024] Step 2: ARMS-PCR;
[0025] Step 3: Analysis of test results and their validity.
[0026] Further, in the step 2, the reaction conditions of ARMS-PCR are: maintaining at 50 °C for 2 min, 95 °C for 2 min; 40 cycles of 95 °C for 15 s, 56 °C for 15 s, 72 °C for 60 s.
[0027] Further, in the step 3, if each of the two positive controls generates a non-specific band and a specific band and the negative control does not generate a band, it indicates that the experimental results are valid.
[0028] In summary, the present application has the following beneficial effects:
[0029] The present invention provides primers for detecting SNP site rs759080989 related to atherosclerosis and their applications. The design and verification of the detection primers and their applications are based on primers specifically matching the rs759080989 site by ARMS-PCR method, and the reaction system and reaction conditions are improved to successfully complete the amplification and detection of the target gene, which has positive significance for clinical practice. Description of the Drawings
[0030] Figure 1 It is the schematic diagram of primer construction of the present invention.
[0031] Figure 2 It is the schematic diagram of the constructed sample in Example 1 of the present invention. Detailed Embodiments
[0032] The technical solutions and effects of the present application will be further described in detail below in conjunction with embodiments and the accompanying drawings. It can be understood that the specific embodiments described herein are only used to explain the invention, rather than limiting the invention.
[0033] Example 1
[0034] This example provides primers for detecting the SNP locus rs759080989 related to atherosclerosis.
[0035] The primers include 2 non-specific outer primers and 2 inner primers for specifically detecting the SNP mutation site. The 2 outer primers have the sequences shown in SEQ ID NO:1 (forward primer) and SEQ ID NO:2 (reverse primer) or their complementary sequences, and the 2 inner primers have the sequences shown in SEQ ID NO:3 (forward primer) and SEQ ID NO:4 (reverse primer) or their complementary sequences.
[0036] SEQ ID NO:1 is as follows: CGAGAGCATGACCGATGGAT;
[0037] SEQ ID NO:2 is as follows: AGGGGGTTCAGTTTGGGTTG;
[0038] SEQ ID NO:3 is as follows: GCTTCGACGTTGGCCCTGTA;
[0039] SEQ ID NO:4 is as follows: AGGGAGTTTACAGGAAGCAG.
[0040] Among them, the 2 inner primers for specifically detecting the SNP mutation site respectively correspond to the polymorphism of the SNP locus rs759080989 (T / G).
[0041] When detecting a homozygous wild-type or mutant sample, a non-specific DNA product will be generated and a specific DNA primer with different lengths will be generated respectively. When detecting a heterozygous mutant sample, a non-specific DNA product and two specific DNA primers with different lengths will be generated. As Figure 1 shown.
[0042] The primers for detecting the SNP locus rs759080989 related to atherosclerosis provided in this example are used to prepare a kit, and the kit includes:
[0043] RNAse-free water and buffer.
[0044] 2×SYBR Green Master Mix.
[0045] The four primers described above.
[0046] Among them, two positive plasmids pUC57 with 539 copies of the wild-type and mutant SNP locus rs759080989 were used as positive controls, and nuclease-free water was used as a negative control.
[0047] The implementation of the present invention will be described in detail through experiments below.
[0048] 1. Extraction of sample DNA.
[0049] In this example, a commercial kit from QIAGEN was used to extract sample DNA. The specific extraction steps are as follows:
[0050] Take 1.6 mL of saliva sample in a 2 mL centrifuge tube, incubate in a water bath at 50 °C for 15 min, centrifuge at 12000 g for 5 min, discard the supernatant, add 180 μL of PBS to wash the precipitate, then add 20 μL of proteinase K and 200 μL of buffer AL, vortex and mix well, incubate at 56 °C for 60 min, then add 200 μL of absolute ethanol, vortex and mix well and centrifuge, transfer to a QIAamp Mini spin column, centrifuge at 6000 g for 1 min, replace with a new collection tube; add 500 μL of buffer AW1, centrifuge at 6000 g for 1 min, replace with a new collection tube; add 500 μL of buffer AW2, centrifuge at 20000 g for 3 min, replace with a new collection tube, centrifuge at full speed, and finally add 60 μL of buffer AE to elute the sample.
[0051] 2. PCR amplification.
[0052] The primers for the PCR reaction are as follows:
[0053] SEQ ID NO:1 is as follows: CGAGAGCATGACCGATGGAT;
[0054] SEQ ID NO:2 is as follows: AGGGGGTTCAGTTTGGGTTG;
[0055] SEQ ID NO:3 is as follows: GCTTCGACGTTGGCCCTGTA;
[0056] SEQ ID NO:4 is as follows: AGGGAGTTTACAGGAAGCAG.
[0057] Prepare 8 PCR tubes and place the reaction system liquid: 3.6 μM RNase-free water, 5 μM 2×SYBR Green Master Mix, 0.4 μM Primer Mix. And add 1 μM of sample DNA, wild-type positive plasmid, mutant positive plasmid, and nuclease-free water to the 8 tubes respectively. Each reaction is placed in duplicate in a double-tube setup.
[0058] The reaction conditions of the ARMS-PCR are as follows: maintain at 50°C for 2 min, 95°C for 2 min; 40 cycles of 95°C for 15 s, 56°C for 15 s, and 72°C for 60 s.
[0059] 3. Detection results and their validity analysis.
[0060] 1. According to the ratio of 1.5% agarose solution, weigh an appropriate amount of agarose powder and place it in a conical flask. Add an appropriate amount of 0.5×TBE electrophoresis buffer. Then heat it in a microwave oven until it is completely melted and the solution is transparent. Shake it slightly to obtain a gel solution. Cool it to about 60°C, and add an appropriate amount of ethidium bromide to the gel solution until the concentration is 0.5 μg / ml.
[0061] 2. Take an organic glass gel plate tank, seal it tightly around the gel tank with transparent tape, and drip a small amount of gel solution to seal the gap between the tape and the gel tank.
[0062] 3. Place the gel tank horizontally, insert a comb at one end, and slowly pour the gel solution that has cooled to about 60°C into the tank to form a uniform horizontal gel surface.
[0063] 4. After the gel has solidified, carefully pull out the comb, tear off the transparent tape, and place the end with the sample loading wells at the cathode section into the electrophoresis tank.
[0064] 5. Add 0.5×TBE electrophoresis buffer to the tank until the liquid level covers the gel surface.
[0065] 6. Carefully mix the samples to be detected in the following amounts on a clean glass slide, and use a pipette to add them to the sample loading wells of the gel.
[0066] 1 μl of loading buffer (6×) + 5 μl of DNA sample to be detected.
[0067] 7. Connect the electrophoresis instrument and the electrophoresis tank, turn on the power supply, adjust the regulated voltage output, with the maximum voltage not exceeding 5 V / cm, and start electrophoresis. Place the sample loading end at the cathode end. Adjust the voltage according to experience to make the bands clear.
[0068] 8. Observe the movement of the bromophenol blue band (blue). When it moves to about 1 cm from the front edge of the gel plate, electrophoresis can be stopped.
[0069] 9. Staining: Take out the gel tank, carefully slide out the gel block, place it horizontally on a piece of plastic wrap or other support, and put it into the EB solution for staining, completely soak it for about 30 min.
[0070] 10. Lay a new piece of plastic wrap on the sample stage of the ultraviolet transilluminator, drive out the air bubbles and lay it flat, and then place the stained gel on it. Close the outer door of the sample chamber, turn on the ultraviolet lamp (360 nm or 254 nm), and observe through the observation hole.
[0071] If two positive controls each produce one non-specific band and one specific band and the negative control produces no band, it indicates that the experimental results are valid.
[0072] By comparing the specific bands of the sample DNA with those of the two positive controls, the genotype and homozygosity of the SNP locus rs759080989 of the sample DNA can be analyzed. As Figure 2 shown in the figure, in the figure, samples 1 and 3 are atherosclerotic samples and mutant positive plasmid samples respectively, and samples 2 and 4 are normal arterial endothelial samples and wild-type mutant plasmid samples respectively
[0073] In summary, the present invention provides a detection primer for the SNP locus rs759080989 related to atherosclerosis and its application. DNA is extracted using a QIAGEN kit, specific primers are designed, and the reaction system and reaction conditions are improved to successfully complete the amplification and detection of the target gene, which has potential clinical significance and can provide great market value.
[0074] This specific embodiment is only an interpretation of the present application and is not a limitation thereof. Those skilled in the art can make modifications to this embodiment without creative contributions according to needs after reading this specification, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.
Claims
1. A detection primer for the atherosclerosis-related SNP site rs759080989, characterized in that: The primers include 2 non-specific outer primers and 2 inner primers for specifically detecting SNP mutation sites, the 2 outer primers have the sequences shown in SEQ ID NO: 1 (forward primer) and SEQ ID NO: 2 (reverse primer) or their complementary sequences, and the 2 inner primers have the sequences shown in SEQ ID NO: 3 (forward primer) and SEQ ID NO: 4 (reverse primer) or their complementary sequences.
2. Use of the detection primer according to claim 1 in preparing a kit for detecting atherosclerosis or atherosclerosis-related SNP site rs759080989 mutation.
3. A detection kit, characterized in that: The kit comprises: RNase-free water and buffer; 2×SYBR Green Master Mix; The four primers according to claim 1. Positive quality control, including two positive plasmids pUC57 with 539 copies of wild-type and mutant SNP site rs759080989; Negative quality control, nucleic acid-free water.
4. The method for using the kit according to claim 3, characterized in that: The steps include: Step 1: Extraction of sample DNA; Step 2: ARMS-PCR; Step 3: Analysis of test results and their effectiveness.
5. The method for using the kit according to claim 4, characterized in that: In step 2, the reaction conditions of ARMS-PCR are: maintaining 50° C. for 2 min, 95° C. for 2 min; 40 cycles of 95° C. for 15 s, 56° C. for 15 s, and 72° C. for 60 s.
6. The method for using the kit according to claim 4, characterized in that: In step 3, if the two positive quality controls produce a nonspecific band and a specific band respectively and the negative quality control produces no band, it means that the experimental results are valid.