Human epididymal protein 4 tumor marker and application thereof

Through human epididymis 4 (HE4) tumor markers and their applications, the problem of low specificity and sensitivity of existing ovarian cancer markers is solved, and more efficient diagnosis and treatment of ovarian cancer is achieved.

CN120174095APending Publication Date: 2025-06-20THE THIRD AFFILIATED HOSPITAL OF GUIZHOU MEDICAL UNIV +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510383371.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-28
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

The specificity and sensitivity of existing tumor markers CA125 and CA199 of ovarian cancer are low, making it difficult to meet the clinical needs for early diagnosis and differentiation.

Method used

Provided is a human epididymis 4 (HE4) tumor marker and its applications, including inhibitor siRNA of HE4 and specific detection primer pairs for the preparation of ovarian cancer diagnostic kits.

Benefits of technology

It improves the efficiency and sensitivity of ovarian cancer diagnosis, improves the early diagnosis level, and can be widely used in the auxiliary diagnosis and treatment of ovarian cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174095A_ABST
    Figure CN120174095A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicine and tumor diagnosis, and particularly discloses a human epididymal protein 4 tumor marker and application thereof. The high expression of the human epididymal protein 4 tumor marker gene is closely related to the prognosis of an ovarian cancer patient, and the human epididymal protein 4 can be used as an ovarian cancer tumor marker and has important significance on the diagnosis, treatment and prognosis evaluation of ovarian cancer; the invention provides a detection primer pair of a human epididymal protein 4 tumor marker and application of the detection primer pair as an ovarian cancer diagnosis kit, ovarian cancer diagnosis can be more accurate and rapid, the early diagnosis level of ovarian cancer is improved, and the invention further provides a human epididymal protein 4 tumor marker expression inhibitor siRNA which can be used for detecting the human epididymal protein 4 tumor marker. When being used for inhibiting the expression of the human epididymal protein 4 tumor marker, the human epididymal protein 4 tumor marker has a good interference effect and has clinical application potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the fields of biological medicine technology and tumor diagnosis technology. More specifically, it relates to a human epididymal protein 4 tumor marker and its application. Background Art

[0002] Ovarian malignant tumor, also known as ovarian cancer, is one of the common tumors of female reproductive organs. Its incidence rate ranks third only after cervical cancer and uterine body cancer, posing a serious threat to women's lives. The cause of ovarian cancer is still unclear, and its occurrence may be related to age, fertility, blood type, mental factors, environment, etc. Currently, there are mainly two methods for detecting ovarian cancer clinically: one is transvaginal ultrasound examination (TUV). Although it is very commonly used, this method has low sensitivity in detecting the benign and malignant nature of masses; the other is to detect blood tumor markers.

[0003] Currently, the main tumor markers for ovarian cancer are CA125, CA199, and HE4, and these tumor markers will show obvious increases in ovarian cancer. However, for some ovarian cancers, the specificity and sensitivity of CA125 and CA199 are often very low and cannot meet the clinical needs. Human epididymal protein 4 (HE4) is a more effective indicator for differentiating benign and malignant ovarian tumors, and its sensitivity in the diagnosis of early ovarian cancer is significantly higher than that of CA125. Detecting HE4 in the body is of great significance for the differentiation, early diagnosis, treatment, prognosis, and monitoring of recurrence of ovarian cancer. Therefore, this application provides a human epididymal protein 4 tumor marker and its application, which can effectively improve the diagnostic efficiency and sensitivity of ovarian cancer and improve the early diagnosis level of ovarian cancer. Summary of the Invention

[0004] In order to solve the problem of low specificity and sensitivity of traditional ovarian cancer tumor markers, this application provides a human epididymal protein 4 tumor marker and its application.

[0005] In a first aspect, this application provides a human epididymal protein 4 tumor marker, and the tumor marker includes human epididymal protein 4.

[0006] Preferably, the inhibitor of the human epididymal protein 4 tumor marker is siRNA that inhibits the expression of human epididymal protein 4, and the inhibitor is used in the preparation of drugs for treating ovarian cancer.

[0007] Preferably, the siRNA that inhibits the expression of human epididymal protein 4 includes a sense strand and an antisense strand, and the nucleotide sequences are respectively: Sense strand: AGTCCCGAAAAAGGGGAGGGCdTdT (SEQ ID NO.5); Antisense strand: GCCCTCCCCCTTTTTCGGGACTdTdT (SEQ ID NO.6).

[0008] In a second aspect, the present application provides an application of a human epididymis protein 4 tumor marker, and the human epididymis protein 4 tumor marker is applied to the preparation of an ovarian cancer diagnostic kit.

[0009] Preferably, the ovarian cancer diagnostic kit is a fluorescence quantitative PCR kit for ovarian cancer diagnosis.

[0010] Preferably, the fluorescence quantitative PCR kit for ovarian cancer diagnosis comprises the following components: a specific detection primer pair for the human epididymis protein 4 tumor marker, and a specific detection primer pair for an internal reference gene.

[0011] Preferably, the components of the fluorescence quantitative PCR kit for ovarian cancer diagnosis further comprise Premix Ex Taq.

[0012] Preferably, the specific detection primer pair for the human epididymis protein 4 tumor marker comprises a forward primer F and a reverse primer R, and the nucleotide sequences are respectively: Forward primer HE4-F: AAACTTTCTCTCCTCACTGCTC (SEQ ID NO.1); Reverse primer HE4-R: GAAGGTGTCCTGTGTCACTG (SEQ ID NO.2).

[0013] Preferably, the specific detection primer pair for the internal reference gene comprises a forward primer F and a reverse primer R, and the nucleotide sequences are respectively: Forward primer GAPDH-F: CCCACTTTACCCCTCCAATG (SEQ ID NO.3); Reverse primer GAPDH-R: CTTTTCCAATTTCCCGTCGATATC (SEQ ID NO.4).

[0014] Preferably, the detection method of the ovarian cancer diagnostic kit comprises the following steps: S1. Prepare a fluorescence quantitative PCR reaction system: Experimental group: Mix Premix Ex Taq, forward primer HE4-F, reverse primer HE4-R, sample cDNA and dH2O evenly; Internal reference group: Mix Premix Ex Taq, forward primer GAPDH-F, reverse primer GAPDH-R, sample cDNA and dH2O evenly; S2. Amplify the sample: Set the amplification program for the fluorescence PCR reaction system in a fluorescence quantitative PCR instrument for amplification; S3. Result analysis: According to the real-time fluorescence PCR amplification results, the relative quantity of gene expression is calculated by the 2-ΔΔCt method for data analysis. -ΔΔCt

[0015] Preferably, in the step S1, the method for preparing the sample cDNA is as follows: extracting the sample RNA with an RNA extraction kit, and reverse transcribing the sample RNA into the sample cDNA with a reverse transcription kit.

[0016] Preferably, in the step S1, for the experimental group: mixing 10 μL of Premix Ex Taq, 1 μL of 15 μmol / L forward primer HE4-F, 1 μL of 15 μmol / L reverse primer HE4-R, 2 μL of the sample cDNA, and 5 μL of dH2O evenly; for the internal reference group: mixing 10 μL of Premix Ex Taq, 1 μL of 15 μmol / L forward primer GAPDH-F, 1 μL of 15 μmol / L reverse primer GAPDH-R, 2 μL of the sample cDNA, and 5 μL of dH2O evenly.

[0017] Preferably, in the step S2, the amplification program is pre-denaturation at 95 °C for 15 s, denaturation at 95 °C for 5 s, annealing / extension at 60 °C for 35 s, for a total of 40 cycles.

[0018] In summary, the present application has the following beneficial effects: 1. The present application provides a pair of detection primers for ovarian cancer tumor markers, which has the nucleotide sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2. It can be applied to a fluorescence quantitative PCR kit for ovarian cancer diagnosis, with simple operation, can achieve rapid detection of ovarian cancer tumor markers, can improve the sensitivity and accuracy of ovarian cancer tumor marker detection, improve the early diagnosis level of ovarian cancer, and can be widely applied to the auxiliary diagnosis and treatment of ovarian cancer.

[0019] 2. The present application provides an inhibitor of ovarian cancer tumor markers, which has the nucleotide sequences shown in SEQ ID NO: 5 and SEQ ID NO: 6. It can be applied to the preparation of drugs for the treatment of ovarian cancer, can inhibit the expression of ovarian cancer tumor markers, and thus promote the growth of normal ovarian cells, and can be widely applied to the auxiliary diagnosis and treatment of ovarian cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Shows the differential expression of the HE4 gene (WFDC2) in ovarian cancer tissues and normal control tissues in Example 1.

[0021] Figure 2 Shows the analysis of the correlation between the HE4 gene (WFDC2) and the prognosis of OV patients in Example 1.​

[0022] Figure 3 For the differential expression of HE4 gene (WFDC2) in blood samples of healthy controls and OV patients in Example 3.

[0023] Figure 4 For the differential expression of HE4 gene (WFDC2) in human normal ovarian epithelial cells and human ovarian cancer cell lines in Example 4. (Human normal ovarian epithelial cells: HOSEpiC; Human ovarian cancer cell lines: CaOV3, SKOV3, and OVCAR-3).

[0024] Figure 5 Schematic diagram of the expression of HE4 gene (WFDC2) in normal HOSEpiC cells with inhibited WFDC2 gene expression in Example 5.

[0025] Figure 6 Schematic diagram of the change in cell proliferation ability of normal HOSEpiC cells with inhibited HE4 gene (WFDC2) expression in Example 5. Detailed implementation manners

[0026] The following further elaborates on the present application in conjunction with examples.

[0027] Example 1 Analysis of differential expression and prognostic correlation of HE4 gene (WFDC2) in ovarian cancer tissues and normal control tissues.

[0028] Using the GEPIA tool (http: / / gepia.cancer-pku.cn / ) to analyze the expression levels of the WFDC2 gene in ovarian cancer tissues and normal control tissues in the high-throughput sequencing results of 426 OV patient samples and 88 normal control samples in the TCGA database. The results are as Figure 1 shown. Data analysis shows that the expression of WFDC2 is significantly upregulated in ovarian cancer tissues.

[0029] Further using the GEPIA tool to analyze the correlation between high expression of the WFDC2 gene and patient prognosis in the TCGA database samples. The results are as Figure 2 shown. It is found that the overall survival of OV patients in the low-expression WFDC2 group is significantly longer than that in the high-expression WFDC2 group, and WFDC2 is significantly negatively correlated with the prognosis of OV patients. Therefore, HE4 can be used as an ovarian cancer tumor marker and is of great significance for the identification, early diagnosis, treatment, prognosis, etc. of ovarian cancer.

[0030] Example 2 Usage method of the fluorescence quantitative PCR kit for ovarian cancer diagnosis.

[0031] 1. RNA extraction Quickly grind the frozen tumor tissue into fine powder in liquid nitrogen, and extract the sample RNA according to the operation steps in the instruction manual of the RNA extraction kit (product number: F05984, purchased from Hubei Apt Biotechnology Co., Ltd.).

[0032] 2. Obtaining cDNA According to the instruction manual of the reverse transcription kit (product number: JKR23014, purchased from Wuhan Kingcare Bioengineering Co., Ltd.), prepare the reverse transcription system on ice: 4 μL of RT OneStep Mix, 1 μL of dsDNase, 10 μL of sample RNA, and make up to 20 μL with Nuclease-free H2O. The reverse transcription program is: 5 min at 37 °C, 15 min at 55 °C, 5 min at 85 °C.

[0033] 3. PCR reaction The RT-PCR primers are shown in Table 1: Table 1

[0034] Prepare the fluorescence quantitative PCR reaction system: Experimental group: Mix 10 μL of Premix Ex Taq, 1 μL of 15 μmol / L forward primer HE4-F, 1 μL of 15 μmol / L reverse primer HE4-R, 2 μL of sample cDNA, and 5 μL of dH2O evenly; Internal reference group: Mix 10 μL of Premix Ex Taq, 1 μL of 15 μmol / L forward primer GAPDH-F, 1 μL of 15 μmol / L reverse primer GAPDH-R, 2 μL of sample cDNA, and 5 μL of dH2O evenly.

[0035] Reaction program: Pre-denaturation at 95 °C for 15 s, denaturation at 95 °C for 5 s, annealing / extension at 60 °C for 35 s, for a total of 40 cycles.

[0036] Using GAPDH as the internal control, calculate the expression level of the target gene HE4 gene (WFDC2) between groups by the 2 -△△CT method; Calculate the relative expression of the sample according to the following formula: where △△ Ct = △ Ct treatment group - △ Ct control group, △ Ct = CtHE4 - CtGAPDH.

[0037] Example 3 RT-PCR was used to detect the differential expression of HE4 gene (WFDC2) in blood samples of healthy controls and OV patients.

[0038] Sample collection and processing: 50 blood samples were collected from OV patients and 50 healthy controls. The blood samples to be tested were centrifuged at room temperature to obtain plasma. Sample RNA extraction and reverse transcription: The obtained plasma from OV patients and healthy controls was operated according to the instruction steps of the RNA extraction kit described in Example 2 to extract plasma sample RNA, and then the plasma sample RNA was reverse transcribed into cDNA according to the instruction steps of the reverse transcription kit. Fluorescent quantitative PCR amplification test: Prepare the fluorescent quantitative PCR reaction system: Experimental group: Mix 10 μL of Premix Ex Taq, 1 μL of 15 μmol / L forward primer HE4-F, 1 μL of 15 μmol / L reverse primer HE4-R, 2 μL of plasma sample cDNA and 5 μL of dH2O evenly; Internal reference group: Mix 10 μL of Premix Ex Taq, 1 μL of 15 μmol / L forward primer GAPDH-F, 1 μL of 15 μmol / L reverse primer GAPDH-R, 2 μL of plasma sample cDNA and 5 μL of dH2O evenly. Reaction procedure: Pre-denaturation at 95°C for 15 s, denaturation at 95°C for 5 s, annealing / extension at 60°C for 35 s, a total of 40 cycles.

[0039] Using GAPDH as the internal control, the expression levels of the target gene HE4 gene (WFDC2) between groups were calculated by the -△△CT method. The results are as Figure 3 shown. The expression of HE4 gene (WFDC2) in the blood samples of OV patients was significantly higher than that in the healthy control group. After t-test, the p-value was less than 0.05, which was statistically significant.

[0040] Example 4 RT-PCR was used to detect the transcriptional levels of HE4 gene (WFDC2) in clinical ovarian cancer cell lines and normal ovarian epithelial cells.

[0041] Detect the expression of HE4 gene (WFDC2) in human ovarian cancer cell lines CaOV3, SKOV3 and OVCAR-3 and human normal ovarian epithelial cell HOSEpiC.

[0042] Sample collection and processing: Human normal ovarian epithelial cell HOSEpiC, human ovarian cancer cell lines CaOV3, SKOV3 and OVCAR-3 were cultured in a culture box at 37°C, 5% CO2 and relative humidity of 90% using DMEM medium containing 10% fetal bovine serum and 1% double antibiotics, and the medium was changed every 3 days.

[0043] Sample RNA extraction and reverse transcription: Human normal ovarian epithelial cells HOSEpiC, human ovarian cancer cell lines CaOV3, SKOV3, and OVCAR-3 were obtained and the RNA of cell samples was extracted according to the operating steps in the instruction manual of the RNA extraction kit described in Example 2, and then the RNA of cell samples was reverse transcribed into cDNA according to the operating steps in the instruction manual of the reverse transcription kit; Fluorescent quantitative PCR amplification test: The same as in Example 3.

[0044] The results are as Figure 4 shown. Compared with human normal ovarian epithelial cells HOSEpiC, the expression of HE4 gene (WFDC2) was up-regulated in human ovarian cancer cell lines CaOV3, SKOV3, and OVCAR-3. After t-test, the p value was less than 0.05, indicating statistical significance.

[0045] Example 5 Inhibit the expression of HE4 gene (WFDC2) in normal ovarian HOSEpiC cell line, and detect the changes in the expression of HE4 gene (WFDC2) and the proliferation ability of cells.

[0046] Design and synthesize HE4 siRNA sequences targeting HE4 gene (WFDC2) mRNA, and set the irrelevant sequence NC siRNA as a negative control. The sequences are shown in Table 2.

[0047] Table 2

[0048] Use liposome (Lipofectamine 2000) transfection reagent to transfect HE4 siRNA and NC siRNA into HOSEpiC cells at a final concentration of 50 nmol / L respectively. Culture the cells with DMEM medium containing 10% fetal bovine serum, and then extract the RNA of different cell lines according to the method described in Example 2 and reverse transcribe it into cDNA. Using GAPDH as an internal control and the cDNA of different cell lines as templates, perform fluorescent quantitative PCR experiments according to the method described in Example 2 to detect the expression of HE4 gene (WFDC2) in normal ovarian HOSEpiC cell line. The results are as Figure 5 shown. Compared with the control group (NC siRNA), HE4 siRNA can effectively inhibit the expression level of HE4 gene (WFDC2) in HOSEpiC cells.

[0049] Seed normal ovarian HOSEpiC cells in 96-well plates, with 5×10 3, When the cell density reached 50%, HE4 siRNA and NC siRNA were transfected into HOSEpiC cells at a final concentration of 50 nmol / L using liposome transfection reagent. After 4 h, the medium was replaced with DMEM medium containing 10% fetal bovine serum. The cells were cultured for 5 d with 24 h as one detection unit, and the cell density was detected once a day. When detecting, 10 μL of CCK-8 was added to the cell lysate in each well to be measured, and it was incubated at 37 °C for 1 h. The absorbance at a wavelength of 450 nm was detected using an enzyme-linked immunosorbent assay (ELISA) reader to represent the cell viability, and a growth curve was plotted. The results are as Figure 6 shown. The survival rate of normal ovarian HOSEpiC cells in the HE4 siRNA group was significantly higher than that of the control group (NC siRNA), indicating that inhibiting the expression of the HE4 gene (WFDC2) in normal ovarian HOSEpiC cell lines can promote the growth of normal ovarian cells to a certain extent.

[0050] This specific embodiment is only an explanation of the present application and does not limit the present application. After reading this specification, those skilled in the art can make modifications to this embodiment without creative contributions as needed, but as long as they are within the scope of the claims of the present application, they are protected by the patent law.

Claims

1. A human epididymis protein 4 tumor marker, characterized in that: The tumor markers include human epididymis protein 4.

2. An inhibitor of human epididymis protein 4 tumor marker according to claim 1, characterized in that: The inhibitor is siRNA that inhibits the expression of human epididymis protein 4, and the inhibitor is used for preparing drugs for treating ovarian cancer.

3. The inhibitor of human epididymis protein 4 tumor marker according to claim 2, characterized in that: The siRNA for inhibiting the expression of human epididymis protein 4 includes a sense strand and an antisense strand, and the nucleotide sequences are: Sense strand: AGTCCCGAAAAAGGGGAGGGCdTdT (SEQ ID NO. 5); Antisense strand: GCCCTCCCCCTTTTTCGGGACTdTdT (SEQ ID NO. 6).

4. A use of the human epididymis protein 4 tumor marker according to claim 1, characterized in that: The human epididymis protein 4 tumor marker is used for preparing an ovarian cancer diagnosis kit.

5. The use of human epididymis protein 4 tumor marker according to claim 4, characterized in that: The ovarian cancer diagnosis kit is an ovarian cancer diagnosis fluorescent quantitative PCR kit.

6. The use of human epididymis protein 4 tumor marker according to claim 5, characterized in that: The ovarian cancer diagnosis fluorescence quantitative PCR kit comprises the following components: a specific detection primer pair of human epididymis protein 4 tumor marker and a specific detection primer pair of internal reference gene.

7. The use of human epididymis protein 4 tumor marker according to claim 6, characterized in that: The specific detection primer pair of human epididymis protein 4 tumor marker includes a forward primer F and a reverse primer R, and the nucleotide sequences are: Forward primer HE4-F: AAACTTTCTCTCCTCACTGCTC (SEQ ID NO. 1); Reverse primer HE4-R: GAAGGTGTCCTGTGTCACTG (SEQ ID NO. 2).

8. The use of human epididymis protein 4 tumor marker according to claim 6, characterized in that: The internal reference gene specific detection primer pair includes a forward primer F and a reverse primer R, and the nucleotide sequences are: Forward primer GAPDH-F: CCCACTTTACCCCTCCAATG (SEQ ID NO. 3); Reverse primer GAPDH-R: CTTTTCCAATTTCCCGTCGATATC (SEQ ID NO. 4).

9. The use of human epididymis protein 4 tumor marker according to claim 5, characterized in that: The detection method of the ovarian cancer fluorescent quantitative PCR diagnostic kit comprises the following steps: S1. Prepare the fluorescence quantitative PCR reaction system: Experimental group: mix Premix Ex Taq, forward primer HE4-F, reverse primer HE4-R, sample cDNA and dH2O evenly; Internal reference group: mix Premix Ex Taq, forward primer GAPDH-F, reverse primer GAPDH-R, sample cDNA and dH2O evenly; S2, sample amplification: the fluorescence PCR reaction system is set up in the fluorescence quantitative PCR instrument for amplification; S3. Result analysis: According to the real-time fluorescence PCR amplification results, 2 -ΔΔCt The relative amount of gene expression was calculated and data analysis was performed.

10. The use of human epididymis protein 4 tumor marker according to claim 9, characterized in that: The amplification program in step S2 is pre-denaturation at 95°C for 15s, denaturation at 95°C for 5s, annealing / extension at 60°C for 35s, for a total of 40 cycles.

Citation Information

Patent Citations

  • Method for detecting ovarian tumor marker human epididymis (HE4) protein

    CN102103144A

  • Application of human epididymis protein 4 serving as diagnosis marker of rheumatoid arthritis

    CN109239349A

  • Application of biomarker in preparation of ovarian cancer diagnosis and / or prognosis product

    CN116219017A