Method for detecting traditional Chinese medicine decoction pieces containing fresh vein blood of cervidae animals
Through the combined method of DNA extraction and PCR reaction combined with electrophoresis detection, the problem that traditional identification methods are difficult to distinguish deer blood from common animal blood is solved, and the rapid and accurate detection of deer blood Chinese herbal medicines is achieved, ensuring the accuracy of the test results and the protection of consumer rights.
Patent Information
- Application Number
- CN202510391206.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-31
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art has limitations in identifying deer blood and common animal blood due to its similar appearance and physical and chemical properties. It is difficult to quickly and accurately distinguish deer blood fakes.
The deer blood content in Chinese herbal medicines in intravenous blood of deer animals was identified by DNA extraction and PCR reaction combined with electrophoresis detection.
It has achieved rapid and accurate detection of deer blood Chinese herbal medicines, which can distinguish deer blood fake products and protect consumers' legitimate rights and interests.
Smart Images

Figure CN120174103A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of blood product detection, in particular to a method for detecting Chinese medicinal pieces containing venous fresh blood of deer. Background Art
[0002] Deer blood is the blood of red deer or sika deer, which are animals of the Cervidae family. It is a traditional precious Chinese medicinal material with the functions of nourishing blood and essence, promoting blood circulation and removing blood stasis, and reducing swelling. Deer blood has been used as medicine in my country for more than a thousand years. With the increasing demand for health, the value of deer blood in medicine and health care has been paid more and more attention at home and abroad. Deer blood products are constantly enriched in the market, including deer blood wine, deer blood powder, deer blood slices, etc., with huge market value and demand. Driven by economic interests, two types of counterfeit deer blood often appear in the market. One type is counterfeit deer blood made from the blood of other common animals (pigs, cattle, sheep, ducks, etc.), and the other type is adulterated products made by mixing deer blood with the blood of other common animals to pass off as good ones. Therefore, it is necessary to test the Chinese herbal medicine slices developed with fresh venous blood of Cervidae animals as raw materials.
[0003] Due to the high similarity between common animal blood and deer blood in appearance and physical and chemical properties, traditional Chinese medicine identification methods such as trait identification, microscopic identification, and physical and chemical identification have great limitations in the identification of deer blood. Therefore, in order to find a fast and accurate biological method for deer blood; therefore, it does not meet the existing needs, we proposed a method for detecting Chinese medicine pieces containing venous blood of deer animals. Summary of the invention
[0004] The purpose of the present invention is to provide a method for detecting Chinese medicinal preparations containing fresh venous blood of Cervidae animals, so as to solve the problem raised in the above background technology that the existing traditional Chinese medicine identification methods such as property identification, microscopic identification, and physical and chemical identification have great limitations in the identification of deer blood due to the high similarity between common animal blood and deer blood in appearance and physical and chemical properties.
[0005] To achieve the above object, the present invention provides the following technical solution: a method for detecting Chinese medicinal pieces containing venous blood of deer, comprising the following steps:
[0006] S1: DNA extraction pretreatment, taking multiple portions of finely powdered venous blood of deer animals, each weighing 0.02g, as samples for processing, and 0.02g of deer blood crystal as a control medicinal material for simultaneous processing, placing both the sample and the control medicinal material in a 1.5ml centrifuge tube, and extracting genomic DNA using a blood DNA extraction kit based on the genomic DNA extraction method;
[0007] S2: Template DNA extraction. Add 200 μl of buffer GS into two 1.5-ml centrifuge tubes and shake to dissolve. Add 20 μl of proteinase K with a concentration of 20 mg / ml and pipette to mix evenly. Add 200 μl of buffer GB, invert to mix evenly, and place in a water bath at 56 °C for 10 min. Add 200 μl of absolute ethanol, pipette to mix evenly, and add to the DNA purification column while maintaining a centrifugal state. Discard the filtrate, add 500 μl of wash buffer GD while maintaining a centrifugal state, discard the filtrate, add 600 μl of wash buffer PW while maintaining a centrifugal state, discard the filtrate, add 600 μl of wash buffer PW while maintaining a centrifugal state, discard the filtrate, and then maintain a centrifugal state. Take out the adsorption column, replace the centrifuge tube, add 200 μl of elution buffer TB, and let stand at room temperature for 2 min. Then centrifuge at 8000 r / min for 2 min. After the treatment, add genomic DNA of non-deer animals with different volume fractions to multiple samples and store at -20 °C for standby;
[0008] S3: PCR reaction treatment. Take the sample eluate after the above treatment as the test sample solution, the eluate of the control medicinal material as the template DNA solution of the control medicinal material, and take sterile ultrapure water as the blank control. Perform the test sample solution, the template DNA solution of the control medicinal material, and the blank control in 200-μl centrifuge tubes. The total reaction volume is 10 μl. The reaction system includes 2×Taq Master Mix with a premixed Taq enzyme and a volume of 5 μl, in which the concentration of the identification primer is 2 μmol / L. Both the test sample solution and the template DNA solution of the control medicinal material are 1 μl, and the blank control is 2 μl. Then place the centrifuge tube in the PCR instrument, set the PCR reaction parameters of the PCR instrument, and obtain the sample PCR reaction solution, the control medicinal material PCR reaction solution, and the sterile ultrapure water PCR reaction solution. Clone the bacterial liquid and determine the accurate sequence of the cytb gene of each PCR reaction solution;
[0009] S4: Electrophoresis detection. According to the agarose gel electrophoresis method, keep the concentration of the agarose gel at 1.5%. Add the nucleic acid stain GelRed to the agarose gel. The loading amounts of the sample PCR reaction solution, the control medicinal material PCR reaction solution, and the sterile ultrapure water PCR reaction solution are all 5 μl;
[0010] S5: Gel image inspection. After electrophoresis, take the gel slice and inspect it on the gel imager. There should be a single DNA band at the corresponding position of 350 - 400 bp in the gel electrophoresis patterns of the sample and the control medicinal material, and there should be no amplified band for the specific primers of other animals. The sterile ultrapure water shows no band as the blank control.
[0011] Preferably, the genomic DNA extraction method in S1 is the column affinity method and the chromatography method.
[0012] Preferably, the centrifugation state in S2 is 8000 r / min and is maintained for 30 s.
[0013] Preferably, the PCR reaction parameters of the PCR instrument in S3 are as follows: pre-denaturation at 94 °C for 5 min, denaturation at 94 °C for 45 s, annealing at 56 °C for 45 s, extension at 72 °C for 45 s, with 35 cycles of reaction, and final extension at 72 °C for 10 min.
[0014] Preferably, the identification primers in S3 are respectively for deer: 5'CAGCCTTCCTATTGACCCTTAAT3' and 5'CGGCTGTAAAGTTACTTTCGTTG3'; for reindeer: 5'AATTTCTAAAAACCTTCAAGAA3' and 5'CAAGTACTTGCTTATAAGCAT3'; for pig: 5'GCACACCTATAACGGTAGCTCAT3' and 5'TCCTAGCTATCGTGTGTCAGGAT3'; for cattle: 5'GGcCCTCTTACTAATTCTAGCT3' and 5CCGATGGTGATATATGGGTGTT3'; for horse: 5'CAAGCTCAACGACACATCTATC3' and 5CCCTGAAGGTTAAGGTTTGTG3'; for donkey: 5CAAGCTCAACGTCACACATATC3' and 5CCTGTGTTGGGTTAACAATAGTC3'; for sheep: 5GGCGCCATGCTACTAATTCTTGTT3' and 5'GAGGAAGGGTACAAGTACTAAGAT3'; for rabbit: 5'CGGCGTAAAGCGTGATTAGAATAA3' and 5GCTATCGTGAGTTCGAAGAGTAT3'; for chicken: 5'CCATCTTAGCCTCAACGATTAA3' and 5'GGCTATTGAGCTCACTGTTGTT3'; for duck: 5GCGCTATCCTATATCTCAGGGATTA3' and 5'TGATTGTCATCGGGTTTGGATCGT3'.
[0015] Preferably, the parameters of the traditional Chinese medicine pieces prepared from the venous fresh blood of cervids are as follows: moisture content ≤ 9.0%, residue on ignition ≤ 6.0%, total aerobic bacteria count ≤ 105 cfu / g, total mold and yeast count ≤ 103 cfu / g, bile salt-tolerant Gram-negative bacteria < 10+ cfu / g, and the measured value of the traditional Chinese medicine pieces prepared from the venous fresh blood of cervids by the cold extraction method according to the determination method of water-soluble extractives ≥ 90.0%.
[0016] Preferably, the detection limit for adding genomic DNA of non-cervid animals to deer blood is 3%, and the detection limit for adding genomic DNA of wapiti blood is 6%.
[0017] Preferably, the exact sequence fragment sizes of the cytb gene in S3 are as follows: 472 bp for sika deer, 472 bp for wapiti, 463 bp for pig, 473 bp for cattle, 473 bp for sheep, and 473 bp for duck.
[0018] Compared with the prior art, the beneficial effects of the present invention are as follows:
[0019] The present invention uses traditional Chinese medicine decoction pieces of deer blood as samples and deer blood crystals as controls, and successively performs template DNA extraction, PCR reaction treatment, and electrophoresis detection, which can accurately and quickly detect traditional Chinese medicine decoction pieces. By adding genomic DNA of non - deer animal blood with different volume fractions to the samples, multiple control references can be achieved, and then the deer blood content in traditional Chinese medicine decoction pieces can be identified, facilitating the distinction of deer blood counterfeits and safeguarding the legitimate rights and interests of consumers. Description of the Drawings
[0020] Figure 1 is a schematic structural diagram of the whole of the present invention;
[0021] Figure 2 is a detection flow chart of the traditional Chinese medicine decoction pieces of the present invention. Detailed Embodiments
[0022] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments.
[0023] Please refer to Figures 1 to 2 , an embodiment provided by the present invention: A method for detecting traditional Chinese medicine decoction pieces containing fresh venous blood of Cervidae animals, comprising the following steps:
[0024] S1: DNA extraction pretreatment. Take multiple fine - powdered traditional Chinese medicine decoction pieces of fresh venous blood of Cervidae animals, each weighing 0.02 g, as samples for treatment, and 0.02 g of deer blood crystals as control medicinal materials for synchronous treatment. Place the samples and control medicinal materials in 1.5 - ml centrifuge tubes, and extract genomic DNA through a blood DNA extraction kit based on the genomic DNA extraction method.
[0025] S2: Template DNA extraction. Add 200 μl of buffer GS into two 1.5-ml centrifuge tubes and dissolve it by shaking. Add 20 μl of proteinase K with a concentration of 20 mg / ml and mix well by pipetting. Add 200 μl of buffer GB, invert to mix well, and place in a water bath at 56 °C for 10 min. Add 200 μl of absolute ethanol, mix well by pipetting, and add it to the DNA purification column while maintaining a centrifugation state. Discard the filtrate, add 500 μl of wash buffer GD while maintaining a centrifugation state, discard the filtrate, add 600 μl of wash buffer PW while maintaining a centrifugation state, discard the filtrate, add 600 μl of wash buffer PW while maintaining a centrifugation state, discard the filtrate, and then maintain a centrifugation state. Take out the adsorption column, replace the centrifuge tube, add 200 μl of elution buffer TB, and let it stand at room temperature for 2 min. Then centrifuge at 8000 r / min for 2 min. After the treatment, add genomic DNA of non-deer animals with different volume fractions to multiple samples and store them at -20 °C for standby;
[0026] S3: PCR reaction treatment. Take the sample eluate after the above treatment as the test sample solution, the eluate of the control medicinal material as the template DNA solution of the control medicinal material, and take sterile ultrapure water as the blank control. Perform the test sample solution, the template DNA solution of the control medicinal material, and the blank control in 200-μl centrifuge tubes. The total reaction volume is 10 μl. The reaction system includes 2×Taq Master Mix with a pre-mixed Taq enzyme and a volume of 5 μl, in which the concentration of the identification primer is 2 μmol / L. The test sample solution and the template DNA solution of the control medicinal material are both 1 μl, and the blank control is 2 μl. Then place the centrifuge tube in a PCR instrument, set the PCR reaction parameters of the PCR instrument, and obtain the sample PCR reaction solution, the control medicinal material PCR reaction solution, and the sterile ultrapure water PCR reaction solution. Determine the accurate sequence of the cytb gene of each PCR reaction solution by cloning the bacterial liquid and sequencing;
[0027] S4: Electrophoresis detection. According to the agarose gel electrophoresis method, maintain the concentration of the agarose gel at 1.5%. Add the nucleic acid stain GelRed to the agarose gel. The loading amounts of the sample PCR reaction solution, the control medicinal material PCR reaction solution, and the sterile ultrapure water PCR reaction solution are all 5 μl;
[0028] S5: Gel image inspection. After electrophoresis, take the gel slice and inspect it on a gel imager. There should be a single DNA band at the corresponding position of 350 - 400 bp in the gel electrophoresis patterns of the sample and the control medicinal material, and there should be no amplified band for the specific primers of other animals. The sterile ultrapure water shows no band as the blank control.
[0029] Among them, the parameters of the traditional Chinese medicine decoction pieces of the venous fresh blood of cervidae animals are as follows: moisture content ≤ 9.0%, ignited residue ≤ 6.0%, total aerobic bacteria ≤ 105 cfu / g, total mold and yeast ≤ 103 cfu / g, bile salt-tolerant Gram-negative bacteria < 10+ cfu / g. The measured value of the traditional Chinese medicine decoction pieces of the venous fresh blood of cervidae animals by the cold extraction method according to the determination method of water-soluble extractives ≥ 90.0%. By setting the parameters of the traditional Chinese medicine decoction pieces of the venous fresh blood of cervidae animals, it is possible to make a reference comparison after detecting the traditional Chinese medicine decoction pieces of the venous fresh blood of cervidae animals.
[0030] The genomic DNA extraction method in S1 is the column affinity method and the chromatography method. The centrifugation state in S2 is 8000 r / min and maintained for 30 s. The PCR reaction parameters of the PCR instrument in S3 are as follows: pre-denaturation at 94 °C for 5 min, 94 °C for 45 s, 56 °C for 45 s, 72 °C for 45 s, cyclic reaction for 35 times, and extension at 72 °C for 10 min. By determining the parameters of the traditional Chinese medicine decoction pieces during the detection process, it is convenient to maintain the accuracy of the detection results.
[0031] The identification primers in S3 are respectively for deer: 5'CAGCCTTCCTATTGACCCTTAAT3' and 5'CGGCTGTAAAGTTACTTTCGTTG3'; for reindeer: 5'AATTTCTAAAAACCTTCAAGAA3' and 5'CAAGTACTTGCTTATAAGCAT3'; for pig: 5'GCACACCTATAACGGTAGCTCAT3' and 5'TCCTAGCTATCGTGTGTCAGGAT3'; for cattle: 5'GGcCCTCTTACTAATTCTAGCT3' and 5CCGATGGTGATATATGGGTGTT3'; for horse: 5'CAAGCTCAACGACACATCTATC3' and 5CCCTGAAGGTTAAGGTTTGTG3'; for donkey: 5CAAGCTCAACGTCACACATATC3' and 5CCTGTGTTGGGTTAACAATAGTC3'; for sheep: 5GGCGCCATGCTACTAATTCTTGTT3' and 5'GAGGAAGGGTACAAGTACTAAGAT3'; for rabbit: 5'CGGCGTAAAGCGTGATTAGAATAA3' and 5GCTATCGTGAGTTCGAAGAGTAT3'; for chicken: 5'CCATCTTAGCCTCAACGATTAA3' and 5'GGCTATTGAGCTCACTGTTGTT3'; for duck: 5GCGCTATCCTATATCTCAGGGATTA3' and 5'TGATTGTCATCGGGTTTGGATCGT3'. The detection limits for detecting genomic DNA of non-deer animals added to deer blood are 3%, and for detecting genomic DNA of wapiti blood added are 6%. The accurate sequence fragment sizes of the cytb gene are respectively: sika deer 472bp, wapiti 472bp, pig 463bp, cattle 473bp, sheep 473bp, duck 473bp. The DNA sequences of other identification primers and the cytb gene sequence facilitate the identification of samples.
[0032] For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and without departing from the spirit or basic characteristics of the present invention, the present invention can be implemented in other specific forms. Therefore, from any point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is defined by the appended claims rather than the above description. Therefore, all changes falling within the meaning and scope of the equivalent elements of the claims are intended to be embraced within the present invention. Any reference signs in the claims should not be regarded as limiting the claimed rights.
Claims
1. A method for detecting Chinese medicinal pieces containing venous blood of Cervidae animals, characterized in that: The steps include: S1: DNA extraction pretreatment, taking multiple portions of finely powdered venous blood of deer animals, each weighing 0.02g, as samples for processing, and 0.02g of deer blood crystal as a control medicinal material for simultaneous processing, placing both the sample and the control medicinal material in a 1.5ml centrifuge tube, and extracting genomic DNA using a blood DNA extraction kit based on the genomic DNA extraction method; S2: Template DNA extraction, add 200ul buffer GS to two 1.5ml centrifuge tubes and shake to dissolve, add 20ul proteinase K with a concentration of 20mg / ml and mix by blowing, add 200ul buffer GB and mix by inversion and place in a 56℃ water bath for 10min, add 200ul anhydrous ethanol and mix by blowing and add to the DNA purification column and keep it in a centrifugal state, discard the filtrate and add 500ul rinse solution GD and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and add 600ul rinse solution PW and keep it in a centrifugal state, discard the filtrate and then keep it in a centrifugal state again, take out the adsorption column and replace the centrifuge tube, add 200ul elution buffer TB and let it stand at room temperature for 2min, and then centrifuge it for 2min at a speed of 8000r / min. After the processing is completed, different volume fractions of non-deer animal blood genomic DNA are added to multiple samples and stored at minus 20℃ for use; S3: PCR reaction treatment, taking the sample eluate after the above treatment as the test solution, the control medicinal material eluate as the control medicinal material template DNA solution, and taking sterile ultrapure water as the blank control, the test solution, the control medicinal material template DNA solution and the blank control are all carried out in a 200ul centrifuge tube, the total reaction volume is 10ul, the reaction system includes a 2×Taq Master Mix premixed with Taq enzyme and a capacity of 5ul, wherein the identification primer concentration is 2umol / L, the test solution and the control medicinal material template DNA solution are both 1ul, and the blank control is 2ul, and then the centrifuge tube is placed in a PCR instrument, the PCR reaction parameters of the PCR instrument are set, and the sample PCR reaction solution, the control medicinal material PCR reaction solution and the sterile ultrapure water PCR reaction solution are obtained, and the cloning bacterial solution sequence is determined to determine the accurate sequence of the cytb gene of each PCR reaction solution; S4: Electrophoresis detection, according to the agarose gel electrophoresis method, the concentration of agarose gel is maintained at 1.5%, and nucleic acid dye GelRed is added to the agarose gel, wherein the loading amount of the sample PCR reaction solution, the control medicinal material PCR reaction solution and the sterile ultrapure water PCR reaction solution is 5ul; S5: Image inspection. After the electrophoresis, take the gel slice and inspect it on a gel imager. There should be a single DNA band at the corresponding position of 350-400bp in the gel electrophoresis map of the sample and the control medicinal material, and there should be no amplified bands using the specific primers of other animals. Sterile ultrapure water as a blank control will show no bands.
2. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 1, characterized in that: The genomic DNA extraction method in S1 is column affinity method and chromatography method.
3. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 2, characterized in that: The centrifugal state in S2 is 8000 r / min and maintained for 30 seconds.
4. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 3, characterized in that: The PCR reaction parameters of the PCR instrument in S3 are: pre-denaturation at 94°C for 5 min, 35 cycles of 94°C for 45 s, 56°C for 45 s, and 72°C for 45 s, and extension at 72°C for 10 min.
5. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 4, characterized in that: The identification primers in S3 are deer 5'CAGCCTTCCTATTGACCCTTAAT3' and 5'CGGCTGTAAAGTTACTTTCGTTG3', reindeer 5'AATTTCTAAAAACCTTCAAGAA3' and 5'CAAGTACTTGCTTATAAGCAT3', pig 5'GCACACCTATAACGGTAGCTCAT3' and 5'TCCTAGCTATCGTGTGTCAGGAT3', cattle 5'GGcCCTCTTACTAATTCTAGCT3' and 5'CCGATGGTGATATATGGGTGTT3', horse 5'CAAGCTCAACGACACATCTATC3' and 5'CCCTGAAGGTTAAGGTTTGT3'. 3', donkey 5CAAGCTCAACGTCACACATATC3' and 5CCTGTGTTGGGTTAACAATAGTC3', sheep 5GGCGCCATGCTACTAATTCTTGTT3' and 5'GAGGAAGGGTACAAGTACTAAGAT3', rabbit 5'CGGCGTAAAGCGTGATTAGAATAA3' and 5GCTATCGTGAGTTCGAAGAGTAT3', chicken 5'CCATCTTAGCCTCAACGATTAA3' and 5'GGCTATTGAGCTCACTGTTGTT3', duck 5GCGCTATCCTATATCTCAGGGATTA3' and 5'TGATTGTCATCGGGTTTGGATCGT3'.
6. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 5, characterized in that: The parameters of the Chinese medicinal slices of fresh venous blood of Cervidae are as follows: moisture content ≤9.0%, residue on ignition ≤6.0%, total aerobic bacteria ≤105 cfulg, total mold and yeast count ≤103 cfulg, bile-resistant Gram-negative bacteria <10+ cfu / g, and the measured value of the Chinese medicinal slices of fresh venous blood of Cervidae by cold immersion method according to the water-soluble extract determination method is ≥90.0%.
7. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 6, characterized in that: The detection limit of adding genomic DNA from non-deer blood to the deer blood is 3%, and the detection limit of adding genomic DNA from red deer blood is 6%.
8. The method for detecting Chinese medicinal pieces containing venous blood of Cervidae according to claim 7, characterized in that: The exact sequence fragment sizes of the cytb gene in S3 are: 472 bp for sika deer, 472 bp for red deer, 463 bp for pig, 473 bp for cattle, 473 bp for sheep, and 473 bp for duck.