Molecular marker related to content of 2-acetyl-3-methylpyrazine in pig muscle and application of molecular marker

Abstract

The invention relates to a molecular marker related to the content of 2-acetyl-3-methylpyrazine in pig muscle and application of the molecular marker, belonging to the technical field of determination or inspection methods of enzymes, nucleic acids or microorganisms. The technical problem to be solved by the invention is to provide a molecular marker related to the content of 2-acetyl-3-methylpyrazine in pig muscle. In order to solve the technical problem, the molecular marker provided by the invention is obtained through genome-wide association (GWAS) analysis, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO: 1, and the molecular marker has an Agt at the 6328556 position of a chromosome 9 of a pig genome; a nucleotide single base of G is mutated, and the mutation obviously affects the content of 2-acetyl-3-methylpyrazine in pig muscles. By detecting the genotype of a to-be-detected pig at the SNP site, early selection of the content of 2-acetyl-3-methylpyrazine in pig muscles can be realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of methods for the determination or inspection of enzymes, nucleic acids or microorganisms, and particularly relates to a molecular marker related to the content of 2-acetyl-3-methylpyrazine in porcine muscle and its application Background Art

[0002] Meat is a food with high edible value. With the improvement of living standards, people's demand for meat products is not only limited to quantity, but also quality and flavor have become important factors affecting consumer demand. Some volatile compounds contained in meat products are highly correlated with meat quality and flavor, which are the basis for forming the original flavor of meat and can endow it with unique aromas

[0003] 2-Acetyl-3-methylpyrazine belongs to the pyrazine class of volatile compounds and has the aroma of nuts and toasted bread. It is often used as a flavor additive in the food industry, especially in products with coffee, chocolate, and nut flavors. Due to its unique aroma characteristics, it is also widely used in the synthesis of perfumes and fragrances. Pyrazine compounds have antioxidant properties and can scavenge free radicals, thus having a protective effect on cells. In addition, some studies have shown that aroma compounds have an impact on the nervous system and may affect mood and behavior through the olfactory pathway. As an important organic compound, 2-acetyl-3-methylpyrazine has broad application prospects in the food and fragrance industries, and its biological functions and mechanisms also have important research value

[0004] It is difficult to increase the content of 2-acetyl-3-methylpyrazine in pork by using traditional breeding methods, so there is still a large room for improvement in the content of 2-acetyl-3-methylpyrazine in pork. At present, molecular marker-assisted breeding technology has been widely applied to the cultivation of new varieties in the livestock and poultry fields, and through genome-wide association analysis, molecular markers closely related to target traits can be obtained. Using molecular markers for early selection of target traits can greatly save breeding costs and accelerate genetic progress. However, there are currently no molecular markers related to the content of 2-acetyl-3-methylpyrazine in pork Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a molecular marker related to the content of 2-acetyl-3-methylpyrazine in porcine muscle. The technical problems to be solved are not limited to the described technical topics, and those skilled in the art can clearly understand other technical topics not mentioned herein through the following description

[0006] To solve the above technical problems, the present invention provides the following technical solutions The present invention provides the application of a substance for detecting the polymorphism or genotype of SNP sites in the pig genome, wherein the SNP site is the 134th nucleotide of SEQ ID NO:1, and the nucleotide type is A or G, and the application is any one of the following: A1) The application of the substance in detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; A2) The application of the substance in detecting or assisting in detecting the polymorphism or genotype of SNP; A3) The application of the substance in pig breeding; A4) The application of the substance in preparing a product for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; A5) The application of the substance in preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNP; A6) The application of the substance in preparing a product for pig breeding.

[0007] The SNP is also located at the 6328556th nucleotide on chromosome 9 of the pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to the 134th nucleotide of nucleotide sequence SEQ ID NO:1).

[0008] Those skilled in the art know that SEQ ID NO:1 is composed of the SNP site (the 134th nucleotide of SEQ ID NO:1) and the nucleotide sequences nearby. The number of nucleotide sequences near the SNP site should not be used as a limiting factor for the protection scope of the present invention. It can be 25 bp, 50 bp, 70 bp, 100 bp, 150 bp, 200 bp, 300 bp, 400 bp, 500 bp, 600 bp, 700 bp, 800 bp, 900 bp, 1000 bp before and after the SNP site, or any other value. Its function is to assist in locating the position of the SNP on chromosome 6 of the pig genome.

[0009] The "before and after" described herein should be defined as before or after in the direction recognized by those skilled in the art, such as the 5'-3' direction.

[0010] The present invention also provides a method for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine, including the following steps: detecting the genotype of the aforementioned SNP site in the pig to be tested, and detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine according to the genotype.

[0011] In the above method for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine, the relative content of 2-acetyl-3-methylpyrazine in the pigs to be tested with the SNP genotype of AA is significantly higher than that in the pigs to be tested with the genotypes of AG and GG, and the relative content of 2-acetyl-3-methylpyrazine in the pigs to be tested with the genotype of AG is significantly higher than that in the pigs to be tested with the genotype of GG. AA is the homozygous type with the SNP locus being A, GA is the heterozygous type with the SNP locus being G and A, and GG is the homozygous type with the SNP locus being G.

[0012] In the above application or method, the detection or assistance in detecting the content of 2-acetyl-3-methylpyrazine may specifically be the detection of the content of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle of pigs.

[0013] In the above method, a partial region containing the aforementioned SNP in the pig genome can be amplified by PCR. For example, sequencing the PCR product containing SEQ ID NO:1 to detect the type of the 134th deoxyribonucleotide of SEQ ID NO:1, so as to detect the genotype of the SNP locus in the genome of the pigs to be tested.

[0014] The present invention also provides a method for pig breeding, which includes detecting the genotype of the aforementioned SNP locus in the genome of the pigs to be tested, and selecting the pigs to be tested with the genotype of AA at the SNP locus as parents for breeding, where AA is the homozygous type with the SNP locus being A.

[0015] The present invention also provides a product containing a substance for detecting the polymorphism or genotype of the SNP locus in the pig genome. The SNP locus is the 134th nucleotide of SEQ ID NO:1, and the nucleotide type is A or G. The product is any one of the following: B1) A product for preparing to detect or assist in detecting the content of 2-acetyl-3-methylpyrazine; B2) A product for detecting or assisting in detecting the polymorphism or genotype of the SNP; B3) A product for pig breeding.

[0016] In the above application or product, the substance is any one of the following: C1) The substance is a primer composition for amplifying a pig genomic DNA fragment including the SNP locus; C2) The substance is a PCR reagent containing the primer composition in C1); C3) The substance is a kit containing the primer composition in C1) or the PCR reagent in C2).

[0017] The kit may further include conventional reagents for PCR amplification. The kit may further include conventional reagents for sequencing.

[0018] In the above application or product, the primer composition is any one of F1)-F3): F1), a primer set composed of the single-stranded DNA shown in SEQ ID NO:2 in the sequence listing and the single-stranded DNA shown in SEQ ID NO:3 in the sequence listing; F2), a primer set composed of the single-stranded DNA with the nucleotide sequence of positions 1-20 of SEQ ID NO:1 in the sequence listing and the single-stranded DNA with the nucleotide sequence of positions 220-239 of SEQ ID NO:1 in the sequence listing; F3), a primer set composed of the single-stranded DNA obtained by substituting and / or deleting and / or adding one or several nucleotides to SEQ ID NO:2 and having the same function as SEQ ID NO:2 and the single-stranded DNA obtained by substituting and / or deleting and / or adding one or several nucleotides to SEQ ID NO:3 and having the same function as SEQ ID NO:3.

[0019] The present invention also provides the application of the aforementioned product in pig breeding.

[0020] The present invention also provides a DNA molecule, one strand of which is SEQ ID NO:1.

[0021] The present invention also provides an application of a DNA molecule, the nucleotide sequence of one strand of which is SEQ ID NO:1, and the application is any one of the following: D1) The DNA molecule is used for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; D2) The DNA molecule is used for detecting or assisting in detecting the polymorphism or genotype of SNPs; D3) The DNA molecule is used in pig breeding; D4) The DNA molecule is used for preparing a product for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; D5) The DNA molecule is used for preparing a product for detecting or assisting in detecting the polymorphism or genotype of SNPs; D6) The DNA molecule is used for preparing a product for pig breeding.

[0022] The present invention also protects the application of any of the above methods in breeding.

[0023] The present invention also protects the application of the specific primer in breeding.

[0024] The present invention also protects the application of the kit in breeding.

[0025] The present invention also protects the primer composition.

[0026] Any of the above-mentioned breeding is pig breeding.

[0027] The purpose of the breeding is to select individuals with a high content of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle.

[0028] The purpose of the breeding is to select a population with a high content of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle.

[0029] The purpose of the breeding is to select a breed with a high content of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle.

[0030] In the breeding, individuals with AG genotype and GG genotype are eliminated.

[0031] In the breeding, individuals with AA genotype are retained.

[0032] Any of the above-mentioned pigs is all pig breeds.

[0033] The beneficial effects of the present invention are as follows: The SNP molecular marker of the present invention is related to the trait of 2-acetyl-3-methylpyrazine content in the longissimus dorsi muscle of pigs. It is a new molecular marker. By determining the genotype of the SNP locus of the pigs to be tested, early selection of the trait of 2-acetyl-3-methylpyrazine content in the longissimus dorsi muscle of pigs can be carried out, which can save production costs, improve meat quality and flavor, and accelerate genetic progress, and better serve pig breeding, and has great economic application value and scientific research value. Specific embodiments

[0034] The present invention will be further described in detail below in conjunction with specific embodiments. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0035] In the experimental methods in the following examples, unless otherwise specified, they are all conventional methods, carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0036] In the following examples, GraphPad Prism 8 statistical software was used to process the data. The experimental results were expressed as mean ± standard deviation, and One-way ANOVA test was used. P < 0.05 (*) indicates significant difference.

[0037] Example 1, Determination of the correlation between specific SNP and 2-acetyl-3-methylpyrazine content in the longissimus dorsi muscle

[0038] Experimental animals: Landrace pigs, Yorkshire pigs, and three-way pigs, all from COFCO Jiajia Kang (Chifeng) Co., Ltd.

[0039] I. Determination of the content of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle Feed the pigs for 180 days under the same feeding conditions, randomly select 521 pigs in good health, collect 10 g of longissimus dorsi muscle samples and store them frozen in liquid nitrogen.

[0040] Pretreat the sample: Take the sample evenly, accurately weigh 3.0 g and put it into a headspace vial, add 10 μL of the internal standard 2-methyl-3-heptanone solution (where the content of 2-methyl-3-heptanone is 10 μg / mL), tighten the bottle cap, and wait for measurement. Preparation method of the internal standard 2-methyl-3-heptanone solution: Weigh 1 mg of 2-methyl-3-heptanone (product number: 103128-5g; CAS number: 13019-20-0), add methanol to make up to 100 mL, and ultrasonicate for 30 min to ensure complete dissolution.

[0041] Instrument and equipment: Automatic sampler, gas chromatography, mass spectrometry, olfactometer, headspace solid-phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm × 0.25 µm).

[0042] The relative content of 2-acetyl-3-methylpyrazine Ca = (Sa / Sis) × (Cis × Vis / m) × 1000.

[0043] In the above formula: Ca is the relative content of the volatile compound 2-acetyl-3-methylpyrazine in the sample, with the unit of micrograms per kilogram (μg / kg); Sa is the peak area of the volatile compound 2-acetyl-3-methylpyrazine in the sample; Sis is the peak area of the internal standard 2-methyl-3-heptanone in the sample; Cis is the concentration of the internal standard 2-methyl-3-heptanone, with the unit of micrograms per milliliter (μg / mL); Vis is the volume of the internal standard 2-methyl-3-heptanone, with the unit of milliliter (mL); m is the sample mass, with the unit of gram (g); 1000: The coefficient for converting μg / g to μg / kg; The retention time of 2-acetyl-3-methylpyrazine is 29.779 ± 0.1 min.

[0044]

[0045]

[0046] II. Detection of SNP molecular markers 1. Blood sample collection: Collect the venous blood of the pig wings to be tested using a heparin sodium anticoagulant blood collection tube and store it at -20°C for later use.

[0047] 2. Genomic DNA extraction from whole blood: The specific operation method was carried out according to the instructions of the Blood Genomic DNA Extraction Kit (Tiangen, DP319).

[0048] 3. Genotyping: Take the genomic DNA of each pig to be tested and perform whole-genome individual resequencing using the Hiseq X-Ten sequencing platform of Illumina. The sequencing depth of each individual is about 5×. The specific method refers to the standard operation procedure provided by Illumina. After the off-machine data passes quality control, sequence alignment and genotype extraction are performed using two bioinformatics software, BWA and GATK, respectively.

[0049] III. Genome-wide association analysis of 2-acetyl-3-methylpyrazine in the longissimus dorsi muscle The genome-wide association analysis of 2-acetyl-3-methylpyrazine and genotype in the longissimus dorsi muscle was statistically analyzed using the compressed mixed linear model of the EMMAX software. A SNP significantly associated with the 2-acetyl-3-methylpyrazine trait was found, namely the nucleotide at position 6328556 on chromosome 9. Therefore, this SNP was named "Chr9: 6328556 SNP", which is also the nucleotide at position 6328556 on chromosome 9 of the pig genome (Sscrofa11.1, GCF_000003025.6) (corresponding to the 134th nucleotide of the nucleotide sequence SEQ ID NO:1). The multiple nucleotide types of this SNP are A / G. For simplicity, it is hereafter referred to as the specific SNP.

[0050] Based on the specific SNP, a pair of primers was designed, consisting of F and R. The target sequences of F and R in the pig genomic DNA are 239 bp, and the specific SNP is located at the 134th nucleotide of the target sequence.

[0051] F (SEQ ID NO:2): 5'- GGACTCCAGACTCGAGCGTA -3'; R (SEQ ID NO:3): 5'- CTGGCCCCAAATGAAACCCT -3'.

[0052] Thus, the genotype of the pig to be tested can be defined according to the following rules: AA genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R only contains a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 134th nucleotide of SEQ ID NO:1 is A, and does not contain a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 134th nucleotide of SEQ ID NO:1 is G, then the aforementioned SNP genotype of the pig to be tested is AA.

[0053] GG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R does not contain a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 134th nucleotide of SEQ ID NO:1 is A, and only contains a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 134th nucleotide of SEQ ID NO:1 is G, then the aforementioned SNP genotype of the pig to be tested is GG.

[0054] AG genotype: If the PCR product obtained by amplifying the genomic DNA of the pig to be tested using the upstream primer F and the downstream primer R contains both a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 134th nucleotide of SEQ ID NO:1 is A, and a DNA fragment with a nucleotide sequence of SEQ ID NO:1 and the 134th nucleotide of SEQ ID NO:1 is G, then the aforementioned SNP genotype of the pig to be tested is AG.

[0055] Example 2. Application of Specific SNP in the Genetic Improvement of 2-Acetyl-3-Methylpyrazine Content Trait in Porcine Longissimus Dorsi Muscle Experimental animals: 493 Landrace pigs, Yorkshire pigs, and three-way cross pigs, sourced from COFCO Jiacakang (Chifeng) Co., Ltd.

[0056] I. Detection of Genotypes Based on Specific SNP Loci 1. Collection of blood samples Collect the wing vein blood of the experimental animals using heparin sodium anticoagulant blood collection tubes and store it at -20°C for later use.

[0057] 2. Extraction of genomic DNA Take the venous blood obtained in step 1 and extract genomic DNA.

[0058] 3. Detection of genotypes Using the genomic DNA obtained in step 2 as a template, perform PCR amplification with the primer pair composed of F and R, and then sequence the PCR amplification product.

[0059] The results showed that PCR amplification products with a size of 239 bp were obtained for all 493 experimental animals.

[0060] According to the genotype definition rules in Example 1, 493 experimental animals were divided into three genotypes: AA genotype (237 experimental animals), AG genotype (205 experimental animals), and GG genotype (51 experimental animals).

[0061] II. Determination of 2-acetyl-3-methylpyrazine content in the longissimus dorsi muscle 2-Methyl-3-heptanone: Purchased from Sigma-Aldrich, with the product number 103128-5g.

[0062] Preparation method of 10 ug / mL 2-methyl-3-heptanone solution: Weigh 1 mg of 2-methyl-3-heptanone, add methanol to make up to 100 mL, and ultrasonicate for 30 min to ensure complete dissolution.

[0063] Feed the pigs under the same feeding conditions until 180 days. Randomly select 493 pigs in good health, collect 10 g of longissimus dorsi muscle samples and store them frozen in liquid nitrogen.

[0064] Pretreat the sample: Take the sample evenly, accurately weigh 3.0 g and put it into a headspace vial, add 10 uL of the prepared 10 ug / mL internal standard 2-methyl-3-heptanone solution, tighten the bottle cap, and wait for measurement.

[0065] Instrumentation: Automatic sampler, gas chromatography, mass spectrometry, olfactometer, headspace solid-phase microextraction needle, gas chromatography column (VF-WAX ms, 60 m × 0.25 mm × 0.25 µm).

[0066] The solid-phase microextraction conditions and gas chromatography-mass spectrometry conditions are shown in Table 1 and Table 2. The results in Table 3 show that the relative contents of 2-acetyl-3-methylpyrazine in pigs of the three genotypes are extremely significantly different ( P <0.001). The relative content of 2-acetyl-3-methylpyrazine in the pigs to be tested with the AA genotype is higher than that in the pigs to be tested with the AG genotype ( P <0.001) and AA ( P <0.001) pigs to be tested. The relative content of 2-acetyl-3-methylpyrazine in the pigs to be tested with the AG genotype is higher than that in the pigs to be tested with the GG genotype.

[0067]

[0068] Table 4. Genotypes and relative contents of 2-acetyl-3-methylpyrazine in 493 pigs to be tested

[0069]

[0070]

[0071]

[0072]

[0073]

[0074]

[0075]

[0076]

[0077]

[0078]

[0079]

[0080]

[0081] SEQ ID NO:1 5'-GGACTCCAGACTCGAGCGTAATCTCGAGAGTCCATAGTAACTTTGTGATCTTGGTCATGTTACTTCAGTCTCAATTTCACCATTTGTGAAATAGGGATAAAAATACTTACCTCATTGGATTCTTGGGAGGTTTRTATGAGATAATTCATAAAAAGCACTTAAAACAGTGGTTGGGACAAAATAAGAACTCAAATGTTAGCTAGTATTATTTACTCTAGGAGGGTTTCATTTGGGGCCAG-3'.

[0082] R is A or G.

[0083] The present invention has been described in detail above. For those skilled in the art, without departing from the spirit and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a wide range under equivalent parameters, concentrations and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any variations, uses or improvements of the present invention, including changes made by using conventional techniques known in the art that depart from the scope disclosed in this application.

Claims

1. Application of a substance for detecting polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 134th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G, and the application is any of the following: A1) Use of the substance in detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; A2) Use of the substance in detecting or assisting in detecting the polymorphism or genotype of SNP; A3) Use of the substance in pig breeding; A4) Use of the substance in the preparation of a product for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; A5) Use of the substance in the preparation of a product for detecting or assisting in detecting the polymorphism or genotype of a SNP; A6) Use of the substance in the preparation of products for pig breeding.

2. The use according to claim 1, characterized in that: The substance is any of the following: C1) a primer composition for amplifying a pig genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit comprising the primer combination described in C1) or the PCR reagent described in C2).

3. A method for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine, characterized in that: The method comprises the following steps: detecting the genotype of the SNP site in claim 1 in the pig to be tested, and detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine according to the genotype.

4. A method for pig breeding, characterized in that: The method comprises detecting the genotype of the SNP site in claim 1 in the genome of the pig to be tested, and selecting the pig to be tested whose genotype of the SNP site is AA as a parent for breeding, wherein AA is the homozygous type of the SNP site A.

5. A product containing a substance for detecting the polymorphism or genotype of a SNP site in a pig genome, characterized in that: The SNP site is the 134th nucleotide of SEQ ID NO: 1, and the nucleotide type is A or G; the product is any of the following: B1) Products used for the preparation or auxiliary detection of 2-acetyl-3-methylpyrazine content; B2) Products used to detect or assist in detecting the polymorphism or genotype of SNPs; B3) Products for pig breeding.

6. The product according to claim 5, characterized in that The substance is any of the following: C1) a primer composition for amplifying a pig genomic DNA fragment including the SNP site; C2) a PCR reagent containing the primer combination described in C1); C3) A kit comprising the primer combination described in C1) or the PCR reagent described in C2).

7. The product according to claim 6, characterized in that The primer composition is any one of F1) to F3): F1), a primer set consisting of the single-stranded DNA shown in SEQ ID NO: 2 in the sequence list and the single-stranded DNA shown in SEQ ID NO: 3 in the sequence list; F2), a primer set consisting of a single-stranded DNA having a nucleotide sequence of positions 1 to 20 of SEQ ID NO: 1 in the sequence listing and a single-stranded DNA having a nucleotide sequence of positions 220 to 239 of SEQ ID NO: 1 in the sequence listing; F3), a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 2 after one or several nucleotides are substituted and / or deleted and / or added, and a primer set consisting of a single-stranded DNA having the same function as SEQ ID NO: 3 after one or several nucleotides are substituted and / or deleted and / or added.

8. Application, characterized in that, The application is the application of the product described in any one of claims 5 to 7 in pig breeding.

9. A DNA molecule, characterized in that One strand of the DNA molecule is SEQ ID NO:

1.

10. Use of DNA molecules, characterized in that The nucleotide sequence of one strand of the DNA molecule is SEQ ID NO: 1, and the application is any one of the following: M1) Use of the DNA molecule in detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; M2) Use of the DNA molecule in detecting or assisting in detecting polymorphism or genotype of SNP; M3) Application of the DNA molecule in pig breeding; M4) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting the content of 2-acetyl-3-methylpyrazine; M5) Use of the DNA molecule in the preparation of a product for detecting or assisting in detecting the polymorphism or genotype of a SNP; M6) Use of the DNA molecule in the preparation of pig breeding products.

Images