A combination of molecular markers, methods, nucleic acid molecules, and applications for evaluating the S / G lignin monomer content ratio in plants.

Abstract

This invention belongs to the field of plant molecular breeding technology, specifically relating to a combination of molecular markers, a method, nucleic acid molecules, and applications for evaluating the S / G lignin monomer content ratio in plants. This invention provides a combination of molecular markers for evaluating the S / G lignin monomer content ratio in plants, including SNP1, SNP2, SNP3, InDel1, and InDel2. Specific combinations of SNP and InDel site molecular markers can predict the S / G lignin monomer content ratio, enabling precise selection of plant varieties with high S / G lignin monomer content ratios. This invention also provides a method for evaluating the S / G lignin monomer content ratio in plants, based on a combination of specific SNP and InDel site molecular markers from the Pto-MYB48 gene, which can predict the S / G lignin monomer content ratio.

Description

Technical Field

[0001] This invention belongs to the field of plant molecular breeding technology, specifically relating to a combination of molecular markers, methods, nucleic acid molecules, and applications for evaluating the S / G lignin monomer content ratio in plants. Background Technology

[0002] Poplar is an important fast-growing afforestation tree species in my country. Due to its rapid growth and strong adaptability, it is widely used for ecological restoration, windbreak and sand fixation, and timber production. In the paper industry, poplar is an important raw material source. The wood is mainly composed of lignin, cellulose, and hemicellulose. Lignin and cellulose are cross-linked, affecting the extraction and utilization of cellulose. Therefore, the content and composition of lignin directly affect wood quality and pulping efficiency. Lignin is mainly polymerized from three monomers: coumarol, coniferol, and sinigrin, forming p-hydroxyphenyl lignin (H-type lignin), guaiacol-based lignin (G-type lignin), and syringol-based lignin (S-type lignin), respectively. Among them, S-type lignin has a looser structure and is easily chemically degraded, while G-type lignin has a denser structure and is difficult to remove. The content of sinigrin and coniferol monomers in wood is a direct indicator determining the content of S-type and G-type lignin, and can be directly used to evaluate the S / G lignin monomer content ratio in wood. Under conditions of comparable lignin content, a higher S / G lignin monomer content ratio makes lignin removal easier, significantly improving pulping efficiency, reducing energy consumption, and enhancing pulp quality. Therefore, breeding poplar varieties with a high S / G lignin monomer content ratio is of great significance for optimizing papermaking processes and reducing production costs.

[0003] Traditional lignin analysis methods primarily rely on chemical degradation and spectroscopic techniques such as nuclear magnetic resonance (NMR) and mass spectrometry (MS). While these methods can obtain information on the chemical composition and structure of lignin, they are costly, have long development cycles, and involve high technical barriers. Furthermore, the extraction and determination of lignin are easily affected by the state of the plant material and the cell wall structure, leading to unstable results. Therefore, conventional methods for breeding new varieties are insufficient for accurately selecting poplar varieties with high S / G lignin monomer content ratios. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker combination, method, nucleic acid molecule, and application for evaluating the S / G lignin monomer content ratio of plants. A molecular marker combination of specific SNPs and InDel on the nucleic acid molecule Pto-MYB48 can predict the S / G lignin monomer content ratio, enabling precise selection of poplar varieties with high S / G lignin monomer content ratios.

[0005] To address the aforementioned technical problems, the following technical solutions are proposed:

[0006] This invention provides a molecular marker combination for evaluating the S / G lignin monomer content ratio in plants, including SNP1, SNP2, SNP3, InDel1, and InDel2.

[0007] The SNP1 is located at position 1142 of the nucleic acid molecule Pto-MYB48 and exhibits A / G polymorphism;

[0008] The SNP2 is located at position 1150 of the nucleic acid molecule Pto-MYB48 and exhibits C / T polymorphism;

[0009] The SNP3 is located at position 1192 of the nucleic acid molecule Pto-MYB48 and exhibits T / A polymorphism;

[0010] The InDel1 is located after position 1208 of the nucleic acid molecule Pto-MYB48 and exhibits a nucleotide sequence deletion polymorphism as shown in SEQ ID NO: 16.

[0011] The InDel2 is located after position 1375 of the nucleic acid molecule Pto-MYB48 and exhibits a nucleotide sequence deletion polymorphism as shown in SEQ ID NO: 17.

[0012] The nucleotide sequence of the nucleic acid molecule Pto-MYB48 is shown in SEQ ID NO:1.

[0013] Preferably, the plants with SNP1 genotype AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype D2I2 have a high S / G lignin monomer content ratio.

[0014] The plants with SNP1 genotype AA, SNP2 genotype CT, SNP3 genotype TT, InDel1 genotype D1D1 and InDel2 genotype I2I2 have a low S / G lignin monomer content ratio.

[0015] The S / G lignin monomer content ratio of the plants with SNP1 genotype AA, SNP2 genotype CC, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype D2I2 is between high and low.

[0016] The plants with SNP1 genotype AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype I2I2 have an S / G lignin monomer content ratio that is between high and low.

[0017] The present invention provides a primer set for detecting the molecular marker combination described in the above technical solution, comprising: primer sets for detecting SNP1, SNP2, SNP3, InDel1 and InDel2 respectively;

[0018] The primer set used to detect SNP1 includes Pto-MYB48-1142-AF with nucleotide sequence as shown in SEQ ID NO: 2, Pto-MYB48-1142-GF with nucleotide sequence as shown in SEQ ID NO: 3, and Pto-MYB48-R with nucleotide sequence as shown in SEQ ID NO: 4;

[0019] The primer set used to detect SNP2 includes Pto-MYB48-R with nucleotide sequence as shown in SEQ ID NO: 4, Pto-MYB48-1150-CF with nucleotide sequence as shown in SEQ ID NO: 5, and Pto-MYB48-1150-TF with nucleotide sequence as shown in SEQ ID NO: 6;

[0020] The primer set used to detect SNP3 includes Pto-MYB48-1192-TF with nucleotide sequence as shown in SEQ ID NO: 7, Pto-MYB48-1192-AF with nucleotide sequence as shown in SEQ ID NO: 8, and Pto-MYB48-1192-R with nucleotide sequence as shown in SEQ ID NO: 9;

[0021] The primer set used to detect InDel1 includes the nucleotide sequence Pto-MYB48-1208-DF as shown in SEQ ID NO: 10, the nucleotide sequence Pto-MYB48-1208-IF as shown in SEQ ID NO: 11, and the nucleotide sequence Pto-MYB48-1208-R as shown in SEQ ID NO: 12;

[0022] The primer set used to detect InDel2 includes the nucleotide sequence Pto-MYB48-1375-DF as shown in SEQ ID NO: 13, the nucleotide sequence Pto-MYB48-1375-IF as shown in SEQ ID NO: 14, and the nucleotide sequence Pto-MYB48-1375-R as shown in SEQ ID NO: 15.

[0023] This invention provides a kit for evaluating the S / G lignin monomer content ratio in plants, comprising the primer set and PCR amplification reagents described in the above technical solution.

[0024] This invention provides applications of the molecular marker combinations, primer sets, or reagent kits described in the above-described technical solutions, including at least one of the following:

[0025] 1) To identify or assist in the identification of plant lignin monomer composition;

[0026] 2) Determine the level of the S / G lignin monomer content ratio in plants;

[0027] 3) Screen for superior plants with a high S / G lignin monomer content ratio;

[0028] 4) Create superior plants with a high S / G lignin monomer content ratio.

[0029] Preferably, the plant includes poplar; the poplar species includes white poplar.

[0030] This invention provides a method for evaluating the S / G lignin monomer content ratio in plants, comprising the following steps:

[0031] 1) Using the DNA of the plant sample to be evaluated as a template, the genotype combinations of SNP1, SNP2, SNP3, InDel1 and InDel2 are determined using the primer set described in the above technical solution.

[0032] 2) Determine the S / G lignin monomer content ratio of plant samples based on genotype combinations; when the genotype of SNP1 is AG, the genotype of SNP2 is CT, the genotype of SNP3 is TA, the genotype of InDel1 is D1I1 and the genotype of InDel2 is D2I2, the plant sample is judged to have a high S / G lignin monomer content ratio.

[0033] When the genotype of SNP1 is AA, the genotype of SNP2 is CT, the genotype of SNP3 is TT, the genotype of InDel1 is D1D1 and the genotype of InDel2 is I2I2, the plant sample is judged to have a low S / G lignin monomer content ratio.

[0034] The S / G lignin monomer content ratio of the plants with SNP1 genotype AA, SNP2 genotype CC, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype D2I2 is between high and low.

[0035] The plants with SNP1 genotype AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype I2I2 have an S / G lignin monomer content ratio that is between high and low.

[0036] Preferably, the DNA in the plant sample comprises genomic DNA extracted from mature xylem.

[0037] The present invention provides a nucleic acid molecule Pto-MYB48 containing the molecular marker combination described above, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0038] This invention provides applications of the nucleic acid molecule Pto-MYB48 described in the above technical solution, including at least one of the following:

[0039] 1) As a molecular target for evaluating the S / G lignin monomer content ratio in plants;

[0040] 2) Screening for molecular targets in superior plants with high S / G lignin monomer content ratios;

[0041] 3) Identify or assist in the identification of molecular targets composed of plant lignin monomers.

[0042] The beneficial effects of this invention are as follows: This invention provides a combination of molecular markers for evaluating the S / G lignin monomer content ratio in plants. The genotype combination of specific SNPs and InDel sites on the nucleic acid molecule Pto-MYB48 can predict the S / G lignin monomer content ratio, enabling precise selection of poplar varieties with high S / G lignin monomer content ratios.

[0043] This invention also provides a method for evaluating the S / G lignin monomer content ratio in plants. Genotype combinations based on specific SNPs and InDel sites of the Pto-MYB48 gene can predict the S / G lignin monomer content ratio. Research results show that SNP1, SNP2, SNP3, InDel1, and InDel2 within the promoter region of the Pto-MYB48 gene are significantly associated with the S / G lignin monomer content ratio, forming stable haplotype combinations. By detecting the genotypes at these five sites, the S / G lignin monomer content ratio of poplar trees can be accurately predicted, thereby enabling efficient screening of superior individuals with high S / G lignin monomer content ratios in the early stages of poplar growth and significantly shortening the breeding cycle.

[0044] With the development of modern molecular breeding technology, by developing key molecular markers related to the S / G lignin monomer content ratio and analyzing the genetic effects of their combinations on the S / G lignin monomer content ratio of poplar, it is possible to achieve rapid and precise screening of new poplar varieties with high S / G lignin monomer content ratios. This technology will make the selection and breeding of superior poplar germplasm more efficient and intelligent, greatly shorten the breeding cycle and improve breeding accuracy, and has important application prospects in the future evaluation and selection of timber quality in the poplar seedling stage. Attached Figure Description

[0045] Figure 1This is an LD linkage map of the promoter region of the Pto-MYB48 gene, including three SNPs and two InDels;

[0046] Figure 2 This is a genotypic effect diagram of different genotype combinations in the Pto-MYB48 gene on the S / G lignin monomer content ratio. Detailed Implementation

[0047] This invention provides a molecular marker combination for evaluating the S / G lignin monomer content ratio in plants, including SNP1, SNP2, SNP3, InDel1, and InDel2. The associations between SNP1, SNP2, SNP3, InDel1, and InDel2 and the S / G lignin monomer content ratio in this invention are all statistically significant (P < 1 × 10⁻⁶). -6 .

[0048] The SNP1 molecular marker described in this invention is located at position 1142 of the nucleic acid molecule Pto-MYB48 and exhibits an A / G polymorphism, wherein the A / G polymorphism means that the nucleotide is A or G; the SNP2 molecular marker is located at position 1150 of the nucleic acid molecule Pto-MYB48 and exhibits a C / T polymorphism, wherein the C / T polymorphism means that the nucleotide is C or T; the SNP3 molecular marker is located at position 1192 of the nucleic acid molecule Pto-MYB48 and exhibits a T / A polymorphism, wherein the T / A polymorphism means that the nucleotide is T or A; the InDel1 molecular marker is located after position 1208 of the nucleic acid molecule Pto-MYB48 and exhibits a nucleotide sequence deletion polymorphism as shown in SEQ ID NO: 16, wherein the nucleotide sequence deletion polymorphism as shown in SEQ ID NO: 16 is either as shown in SEQ ID NO: 16 or SEQ ID NO: 16 is omitted; the InDel2 molecular marker is located after position 1375 of the nucleic acid molecule Pto-MY B48 and exhibits a SEQ ID NO: 16 polymorphism. The nucleotide sequence deletion polymorphism shown in SEQ ID NO: 17 means that the nucleotide sequence is as shown in SEQ ID NO: 17 or the deletion of SEQ ID NO: 17. The nucleotide sequence of the nucleic acid molecule Pto-MYB48 of the present invention is shown in SEQ ID NO: 1.

[0049] As an optional implementation, the plants with SNP1 genotype AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype D2I2 have a high S / G lignin monomer content ratio.

[0050] The plants with SNP1 genotype AA, SNP2 genotype CT, SNP3 genotype TT, InDel1 genotype D1D1 and InDel2 genotype I2I2 have a low S / G lignin monomer content ratio.

[0051] The S / G lignin monomer content ratio of the plants with SNP1 genotype AA, SNP2 genotype CC, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype D2I2 is between high and low.

[0052] The plants with SNP1 genotype AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype I2I2 have an S / G lignin monomer content ratio that is between high and low.

[0053] The present invention provides a primer set for detecting the molecular marker combination described in the above technical solution, comprising: primer sets for detecting SNP1, SNP2, SNP3, InDel1 and InDel2 respectively;

[0054] The primer set used to detect SNP1 includes Pto-MYB48-1142-AF with nucleotide sequence as shown in SEQ ID NO: 2, Pto-MYB48-1142-GF with nucleotide sequence as shown in SEQ ID NO: 3, and Pto-MYB48-R with nucleotide sequence as shown in SEQ ID NO: 4;

[0055] The primer set used to detect SNP2 includes Pto-MYB48-R with nucleotide sequence as shown in SEQ ID NO: 4, Pto-MYB48-1150-CF with nucleotide sequence as shown in SEQ ID NO: 5, and Pto-MYB48-1150-TF with nucleotide sequence as shown in SEQ ID NO: 6;

[0056] The primer set used to detect SNP3 includes Pto-MYB48-1192-TF with nucleotide sequence as shown in SEQ ID NO: 7, Pto-MYB48-1192-AF with nucleotide sequence as shown in SEQ ID NO: 8, and Pto-MYB48-1192-R with nucleotide sequence as shown in SEQ ID NO: 9;

[0057] The primer set used to detect InDel1 includes the nucleotide sequence Pto-MYB48-1208-DF as shown in SEQ ID NO: 10, the nucleotide sequence Pto-MYB48-1208-IF as shown in SEQ ID NO: 11, and the nucleotide sequence Pto-MYB48-1208-R as shown in SEQ ID NO: 12;

[0058] The primer set used to detect InDel2 includes the nucleotide sequence Pto-MYB48-1375-DF as shown in SEQ ID NO: 13, the nucleotide sequence Pto-MYB48-1375-IF as shown in SEQ ID NO: 14, and the nucleotide sequence Pto-MYB48-1375-R as shown in SEQ ID NO: 15.

[0059] This invention provides a kit for evaluating the S / G lignin monomer content ratio in plants, comprising the primer set and PCR amplification reagents described in the above technical solution.

[0060] The primer set in the kit described in this invention is a primer set for detecting SNP1 molecular marker, SNP2 molecular marker, SNP3 molecular marker, InDel1 molecular marker, and InDel2 molecular marker.

[0061] The present invention does not have any special limitations on the composition and quantity of each component of the PCR amplification reagent in the kit; the composition and quantity of the components of a conventional kit can be used.

[0062] This invention provides the application of the molecular marker combination, primer set, or kit described in the above-mentioned technical solutions in the identification or auxiliary identification of plant lignin monomer composition.

[0063] This invention provides the application of the molecular marker combination, primer set, or kit described in the above-mentioned technical solutions in determining the S / G lignin monomer content ratio in plants.

[0064] In a specific embodiment of the present invention, poplar samples were used for verification. By detecting the genotypes of the five loci to be detected, namely SNP1, SNP2, SNP3, InDel1, and InDel2, when the genotype of SNP1 is AG, the genotype of SNP2 is CT, the genotype of SNP3 is TA, the genotype of InDel1 is D1I1, and the genotype of InDel2 is D2I2, that is, when the genotype combination is AG-CT-TA-D1I1-D2I2, the S / G lignin monomer content ratio of the poplar sample is high. This indicates that the lignin monomer composition is that the content of syringyl (S type) monomer is significantly higher than that of guaiacyl (G type) monomer. This lignin structure is more linear and easier to chemically degrade and pulping. The genotype combination of the present invention, AG-CT-TA-D1I1-D2I2, is just a conventional display of the genotypes of the five molecular markers. It has no limiting effect on the order of the SNP1, SNP2, SNP3, InDel1, and InDel2 genotype combinations, and the same applies below. When the genotype of SNP1 is AA, the genotype of SNP2 is CT, the genotype of SNP3 is TT, the genotype of InDel1 is D1D1 and the genotype of InDel2 is I2I2, that is, when the genotype combination is AA-CT-TT-D1D1-I2I2, the S / G lignin monomer content ratio of the poplar sample is low. This indicates that the lignin monomer composition is that the content of guaiacol (G type) monomers is significantly higher than that of syringyl (S type) monomers. More carbon-carbon cross-links are formed between G type monomers. This lignin structure is more complex, has higher mechanical strength, but is more difficult to degrade. When the genotype of SNP1 is AA, the genotype of SNP2 is CC, the genotype of SNP3 is TA, the genotype of InDel1 is D1I1, and the genotype of InDel2 is D2I2, i.e., the genotype combination is AA-CC-TA-D1I1-D2I2, or when the genotype of SNP1 is AG, the genotype of SNP2 is CT, the genotype of SNP3 is TA, the genotype of InDel1 is D1I1, and the genotype of InDel2 is I2I2, i.e., the genotype combination is AG-CT-TA-D1I1-I2I2, the S / G lignin monomer content ratio of the poplar sample is at a medium level. Its wood characteristics are between a high S / G ratio (easy to pulp) and a low S / G ratio (high mechanical strength), making it suitable for industrial applications that require a balance between pulping efficiency and mechanical properties.

[0065] This invention provides the application of the molecular marker combination, primer set, or kit described in the above-described technical solutions in screening plants with a high S / G lignin monomer content ratio. By detecting the genotypes of five loci (SNP1, SNP2, SNP3, InDel1, and InDel2) in the test plants, this invention found that plants with the genotype combination AG-CT-TA-D1I1-D2I2 have a high S / G lignin monomer content ratio.

[0066] This invention provides the application of the molecular marker combination, primer set, or kit described in the above-mentioned technical solutions in creating superior plant individuals with a high S / G lignin monomer content ratio. This invention uses a method of specific mutation at five sites (SNP1, SNP2, SNP3, InDel1, and InDel2) to edit the plant genotype combination to AG-CT-TA-D1I1-D2I2, resulting in superior plant individuals with a high S / G lignin monomer content ratio.

[0067] As an alternative implementation, the plant includes poplar; the poplar species includes white poplar.

[0068] This invention provides a method for evaluating the S / G lignin monomer content ratio in plants, comprising the following steps:

[0069] 1) Using the DNA of the plant sample to be evaluated as a template, the primer set described in the above technical solution is used to determine the genotype combination of SNP1, SNP2, SNP3, InDel1 and InDel2.

[0070] 2) Determine the S / G lignin monomer content ratio of plant samples based on genotype combinations; when the genotype of SNP1 is AG, the genotype of SNP2 is CT, the genotype of SNP3 is TA, the genotype of InDel1 is D1I1, and the genotype of InDel2 is D2I2, the plant sample is considered to have a high S / G lignin monomer content ratio; when the genotype of SNP1 is AA, the genotype of SNP2 is CT, the genotype of SNP3 is TT, the genotype of InDel1 is D1D1, and the genotype of InDel2 is I2I2, the plant sample is considered to have a low ... The S / G lignin monomer content ratio of plants with genotype CC, SNP3 genotype TA, InDel1 genotype D1I1, and InDel2 genotype D2I2 is between high and low. When the SNP1 genotype is AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1, and InDel2 genotype I2I2 is between high and low, i.e., at a medium level, its wood characteristics are between high S / G ratio (easy to pulp) and low S / G ratio (high mechanical strength), making it suitable for industrial applications that require a balance between pulping efficiency and mechanical properties.

[0071] In a specific embodiment of the present invention, when testing Populus tomentosa samples, the highest S / G lignin monomer content ratio of the sample was 13.07±1.38 when the genotype combination of SNP1, SNP2, SNP3, InDel1, and InDel2 was AG-CT-TA-D1I1-D2I2; the lowest S / G lignin monomer content ratio of the sample was 2.62±0.57 when the genotype combination of SNP1, SNP2, SNP3, InDel1, and InDel2 was AA-CT-TT-D1D1-I2I2; and the lowest S / G lignin monomer content ratio of the sample was between high and low, at 7.53±1.07 when the genotype combination of SNP1, SNP2, SNP3, InDel1, and InDel2 was AA-CC-TA-D1I1-D2I2 or AG-CT-TA-D1I1-I2I2. The molecular marker combination of the present invention can determine the S / G lignin monomer content ratio of poplar.

[0072] This invention first extracts DNA from the plant sample to be evaluated. There are no special requirements for the extraction method of the genomic DNA from the sample; conventional plant genome extraction methods in the art are sufficient. In the specific implementation of this invention, a plant genomic DNA extraction kit is used.

[0073] After obtaining the DNA of the plant sample to be evaluated, the present invention uses the DNA of the plant sample to be evaluated as a template and uses the primer set described in the above technical solution to determine the genotype combination of SNP1, SNP2, SNP3, InDel1 and InDel2.

[0074] This invention does not have specific limitations on the method for determining the SNP sites at positions 1142, 1150, and 1192 of the Pto-MYB48 gene, as well as the InDel genotype after positions 1208 and 1375. Any SNP and InDel genotype detection method well-known to those skilled in the art can be used. In the specific implementation of this invention, PCR amplification is preferably used. In this invention, the PCR amplification system preferably includes, per 40 μL: 20 μL of 2×Phanta Max Master Mix (Dye Plus), 17 μL of ddH2O, 1 μL of genomic DNA template, and 1 μL each of forward and reverse primers. The PCR amplification program includes: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 57℃ annealing for 30 s, 72℃ extension for 15 s, 35 cycles; and 72℃ final extension for 5 min.

[0075] In this invention, after the PCR amplification is completed, agarose gel electrophoresis is preferably used to detect the amplification products. This invention does not specifically limit the method of agarose gel electrophoresis; any conventional agarose gel electrophoresis method in the art can be used. After PCR amplification product detection, the genotype combinations of SNP1, SNP2, SNP3, InDel1, and InDel2 molecular markers were determined, and the S / G lignin monomer content ratio of the plant sample was calculated based on the genotype combinations. The highest S / G lignin monomer content ratio was observed when the genotypes of SNP1 (AG), SNP2 (CT), SNP3 (TA), InDel1 (D1I1), and InDel2 (D2I2). The lowest S / G lignin monomer content ratio was observed when the genotypes of SNP1 (AA), SNP2 (CT), SNP3 (TT), InDel1 (D1D1), and InDel2 (I2I2).

[0076] As an optional implementation, the plant described in this invention includes poplar; this invention does not specifically limit the variety of poplar, but in this embodiment, white poplar is used for effect verification.

[0077] As an optional implementation, the DNA of the plant sample described in this invention includes genomic DNA extracted from mature xylem.

[0078] This invention provides a nucleic acid molecule, Pto-MYB48, containing the molecular marker combination described in the above-mentioned technical solution. The nucleotide sequence of the nucleic acid molecule Pto-MYB48 is shown in SEQ ID NO:1. Specific SNP and InDel site genotype combinations on the nucleic acid molecule Pto-MYB48 can predict the S / G lignin monomer content ratio, enabling precise selection of plant varieties with high S / G lignin monomer content ratios.

[0079] This invention provides applications of the nucleic acid molecule Pto-MYB48 described in the above technical solution, including at least one of the following:

[0080] 1) As a molecular target for evaluating the S / G lignin monomer content ratio in plants;

[0081] 2) Screening for molecular targets in superior plants with high S / G lignin monomer content ratios;

[0082] 3) Identify or assist in the identification of molecular targets composed of plant lignin monomers.

[0083] This invention discovers that SNP1, SNP2, SNP3, InDel1, and InDel2 are all located on the nucleic acid molecule Pto-MYB48, and the nucleic acid molecule Pto-MYB48 can be used as a molecular target to evaluate the S / G lignin monomer content ratio in plants.

[0084] The specific mutation sites of the nucleic acid molecule Pto-MYB48 of this invention are closely related to the content of lignin monomers. The evaluation method includes: (1) detecting genotype combinations after SNP1 position 1142, SNP2 position 1150, SNP3 position 1192, and InDel1 position 1208 and InDel2 position 1375 in the promoter region of the Pto-MYB48 gene; (2) predicting the S / G lignin monomer content ratio of poplar trees based on the genotype combinations, and then evaluating the wood quality. Through the genotype analysis of the above SNP1, SNP2, SNP3, InDel1 and InDel2 sites, superior individuals with high S / G lignin monomer content ratios can be rapidly screened during the seedling stage, significantly shortening the breeding cycle and improving breeding efficiency. This invention provides efficient molecular markers and targeted gene resources for molecular design breeding of poplar trees.

[0085] The results of the examples show that the evaluation method, primer set, and kit described in this invention can rapidly and accurately determine the S / G lignin monomer content ratio of poplar samples, enabling early screening of superior individuals with high ratios and significantly shortening the breeding cycle. This invention detects the genotypes of five loci (SNP1, SNP2, SNP3, InDel1, and InDel2) in poplar samples. Based on breeding requirements, poplar samples with genotype combinations of AG-CT-TA-D1I1-D2I2 or AA-CT-TT-D1D1-I2I2 can be screened for further breeding operations.

[0086] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.

[0087] Guaiac lignin is a G-type lignin, while syringin is an S-type lignin; the S / G lignin monomer content ratio is the ratio of the S-type lignin monomer content to the G-type lignin monomer content.

[0088] Example 1

[0089] 1. Using a genome-wide association analysis (GWAS) strategy, SNP loci significantly associated with the S / G lignin monomer content ratio of Populus tomentosa germplasm resource populations and phenotypic data, combined with a mixed linear model in EMMAX software, were screened across the entire Populus tomentosa genome.

[0090] GWAS results showed that the p-values ​​for the association between SNP1, SNP2, and SNP3 in the promoter region of the Pto-MYB48 gene and the S / G lignin monomer content ratio were P = 1.14 × 10⁻⁶. -7 P = 3.61 × 10 -8 P = 1.58 × 10 -8 SNP1, SNP2, and SNP3 were significantly associated with the S / G lignin monomer content ratio. Furthermore, using all SNP and InDel data from the Pto-MYB48 gene promoter and coding region, an association analysis based on candidate genes was conducted. The p-values ​​for the associations between InDel1 and InDel2 in the Pto-MYB48 gene promoter region and the S / G lignin monomer content ratio were found to be P = 1.01 × 10⁻⁶. -7 P = 2.83 × 10 -7 As can be seen, InDel1 and InDel2 are significantly correlated with the S / G lignin monomer content ratio. Haplotype analysis of these correlated sites using LDBlockShow software revealed a high linkage relationship (R0) between InDel1, InDel2, and SNP1, SNP2, and SNP3. 2 >0.8, see Figure 1 This forms a stable haplotype combination.

[0091] The nucleotide sequence of the promoter region of the Pto-MYB48 gene of the present invention is shown in SEQ ID NO: 1, wherein SNP1 is located at position 1142 of SEQ ID NO: 1, and the nucleotide is A or G; SNP2 is located at position 1150, and the nucleotide is C or T; SNP3 is located at position 1192, and the nucleotide is T or A; InDel1 is the nucleotide sequence after position 1208, and the nucleotide sequence is as follows. A TAGCAATTGCTAAAT (SEQ ID NO: 16) or missing A TAGCAATTGCTAAAT (SEQ ID NO: 16), the underlined A is position 1208; InDel2 is the nucleotide sequence after position 1375, and the nucleotide sequence is as follows. G TTTGTCTCGTGAATTATGCA (SEQ ID NO: 17) or missing GTTTGTCTCGTGAATTATGCA (SEQ ID NO: 17), with the underlined G at position 1375. Specifically, SNP1 is located at position 1142 of the Pto-MYB48 gene promoter region, exhibiting genotypes AG and AA in the Populus tomentosa germplasm resource population; SNP2 is located at position 1150, exhibiting genotypes CC and CT; and SNP3 is located at position 1192, exhibiting genotypes TA and TT. InDel1 is located after the 1208th base, and the nucleotide sequence involved is ATAGCAATTGCTAAAT (Insertion 1, I1) or ATAGCAATTGCTAAAT (Deletion 1, D1). There are two genotypes in the population: D1D1 (homozygous deletion) and D1I1 (heterozygous insertion / deletion). InDel2 is located after the 1375th base, and the nucleotide sequence involved is GTTGTCTCGTGAATTATGCA (Insertion 2, I2) or GTTGTCTCGTGAATTATGCA (Deletion 2, D2). There are two genotypes in the population: I2I2 (homozygous insertion) and D2I2 (heterozygous insertion / deletion).

[0092] Based on the genome annotation of Populus tomentosa, the promoter sequence of the Pto-MYB48 gene was obtained as shown in SEQ ID NO: 1:

[0093] A taggcaa C agccagagtaaagtatttgatatgttgacgtaactttcata T tcacctcttgttcta A TAGCAATTGCTAAAT tatcatcccgcggtgccttacctgcctactgggcttgcaggatgttcagtgggcccggggaatagtcgtggtgcgcgtaagctggcccggacaccccgggttaccaaaaaaaaaaaaaaaaaaaaattgctaaattatcacagcactccat gtttgtctcgtgaattatgca 。

[0094] In this context, the underlined uppercase base A represents the site before the SNP1 mutation, the underlined uppercase base C represents the site before the SNP2 mutation, the underlined uppercase base T represents the site before the SNP3 mutation, the underlined uppercase base ATAGCAATTGCTAAAT represents the insertion sequence of InDel1, and the underlined lowercase base gtttgtctcgtgaattatgca represents the deletion sequence of InDel2.

[0095] Example 2

[0096] 1. The primer set for detecting the S / G lignin monomer content ratio in poplar trees is as follows:

[0097] The primer set used to detect SNP1 has the following nucleotide sequences as shown in SEQ ID NO: 2, SEQ ID NO: 3, and SEQ ID NO: 4, respectively.

[0098] The primer set used for detecting SNP2 has the following nucleotide sequences as shown in SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 6, respectively.

[0099] The primer set used for detecting SNP3 has the following nucleotide sequences as shown in SEQ ID NO: 7, SEQ ID NO: 8, and SEQ ID NO: 9, respectively.

[0100] Primer set for detecting InDel1: nucleotide sequences are shown in SEQ ID NO: 10, SEQ ID NO: 11, and SEQ ID NO: 12, respectively;

[0101] The primer set used for detecting InDel2 has the following nucleotide sequences as shown in SEQ ID NO: 13, SEQ ID NO: 14, and SEQ ID NO: 15, respectively.

[0102] To ensure the specificity of the amplification products, the last base of the forward primer is modified with locked nucleic acid (LNA). The primer design requirements for the three SNP sites are that the last base at the 3' end of the forward primer is the base of the corresponding functional site, and the primer design requirements for the two InDel sites are that the end of the forward primer should contain (IF) or not contain (DF) the corresponding insert sequence.

[0103] Table 1 Primer sets used to identify SNPs and InDel

[0104]

[0105]

[0106] Pto-MYB48-R represents a single reverse primer (R primer) used for detecting SNP sites at positions 1142 and 1150. All primers were synthesized by Tsingke Biotechnology Co., Ltd.

[0107] Regarding the interpretation of PCR results:

[0108] If PCR amplification of Pto-MYB48-1142-AF and Pto-MYB48-R yields amplification products, while PCR amplification of Pto-MYB48-1142-GF and Pto-MYB48-R does not yield amplification products, then the genotype of SNP1 in the sample is AA.

[0109] If PCR amplification of Pto-MYB48-1142-AF and Pto-MYB48-R yields amplification products, and PCR amplification of Pto-MYB48-1142-GF and Pto-MYB48-R also yields amplification products, then the genotype of SNP1 in the sample is AG.

[0110] If PCR amplification of Pto-MYB48-1150-CF and Pto-MYB48-R yields amplification products, but PCR amplification of Pto-MYB48-1150-TF and Pto-MYB48-R does not yield amplification products, then the genotype of SNP2 in the sample is CC.

[0111] If PCR amplification of Pto-MYB48-1150-CF and Pto-MYB48-R yields amplification products, and PCR amplification of Pto-MYB48-1150-TF and Pto-MYB48-R also yields amplification products, then the genotype of SNP2 in the sample is CT.

[0112] If no amplification product is obtained when Pto-MYB48-1192-AF and Pto-MYB48-1192-R are amplified by PCR, but amplification products are obtained when Pto-MYB48-1192-TF and Pto-MYB48-1192-R are amplified by PCR, then the genotype of SNP3 in the sample is TT.

[0113] If PCR amplification of Pto-MYB48-1192-AF and Pto-MYB48-1192-R yields amplification products, and PCR amplification of Pto-MYB48-1192-TF and Pto-MYB48-1192-R also yields amplification products, then the genotype of SNP3 in the sample is TA.

[0114] If PCR amplification of Pto-MYB48-1208-DF and Pto-MYB48-1208-R yields amplification products, but PCR amplification of Pto-MYB48-1208-IF and Pto-MYB48-1208-R does not yield amplification products, then the genotype of sample InDel1 is D1D1, i.e., homozygous deletion type.

[0115] If PCR amplification of Pto-MYB48-1208-DF and Pto-MYB48-1208-R yields amplification products, and PCR amplification of Pto-MYB48-1208-IF and Pto-MYB48-1208-R also yields amplification products, then the genotype of sample InDel1 is D1I1, which is a heterozygous insertion-deletion type.

[0116] If no amplification product is obtained when Pto-MYB48-1375-DF and Pto-MYB48-1375-R are amplified by PCR, but amplification products are obtained when Pto-MYB48-1375-IF and Pto-MYB48-1375-R are amplified by PCR, then the genotype of sample InDel2 is I2I2, which is a homozygous insert.

[0117] If PCR amplification of Pto-MYB48-1375-DF and Pto-MYB48-1375-R yields amplification products, and PCR amplification of Pto-MYB48-1375-IF and Pto-MYB48-1375-R also yields amplification products, then the genotype of sample InDel2 is D2I2, i.e., heterozygous insertion / deletion type.

[0118] 2. The genotypes of the SNPs and InDels of 40 individuals in the Populus tomentosa hybrid population were identified using the primer sets in Table 1, and the S / G lignin monomer content ratio of the samples was evaluated. The steps are as follows:

[0119] 1) Forty individuals were randomly selected from the hybrid Populus tomentosa germplasm resource bank planted in Guanxian County, Shandong Province. After removing the bark, two xylem samples of approximately 0.3g each were scraped off with a file and immediately frozen in liquid nitrogen. One sample was sent to Wuhan Maiwei Metabolic Biotechnology Co., Ltd. for targeted metabolomics analysis. Since the contents of sinigrin and coniferol monomers in wood are direct indicators determining the contents of S-type and G-type lignin, they can be directly used to evaluate the S / G lignin monomer content ratio in wood. The sinigrin content was determined by metabolomics sequencing, representing the S-type lignin content; the coniferol content was determined, representing the G-type lignin content, to assess the S / G lignin monomer content ratio and related metabolic characteristics.

[0120] Another sample of xylem was extracted using the FastPure Universal Plant Total DNA Isolation Kit (Vazyme China, Nanjing, China).

[0121] 2) Determine the SNPs at positions 1142, 1150, and 1192, and the InDel at positions 1208 and 1375, in the promoter region of the Pto-MYB48 gene in the genomic DNA of the Populus tomentosa xylem sample. Using the primer set described above, PCR amplification was performed using the genomic DNA obtained in step 1) as a template.

[0122] The PCR amplification reaction system is as follows:

[0123] (1) 2×Phanta Max MasterMix (Dye Plus) 20μL;

[0124] (2) ddH2O 17μL;

[0125] (3) 1 μL of genomic DNA template;

[0126] (4) 1 μL each of upstream and downstream primers.

[0127] The amplification procedure is as follows:

[0128] Step 1: Pre-denaturation at 95℃ for 3 minutes;

[0129] Step 2: 95℃ denaturation for 15s, 57℃ annealing for 30s, 72℃ extension for 15s, and repeat Step 2 35 times.

[0130] Step 3: Extend thoroughly at 72℃ for 5 minutes.

[0131] Based on the above evaluation indicators, and combined with the actual sample test data (see Table 2 and...), Figure 2The overall average S / G lignin monomer content ratio of the 40 individuals was 7.69±3.85. When the genotype combination of InDel after positions 1142, 1150, and 1192, and positions 1208 and 1375 in the Pto-MYB48 promoter region was AA-CT-TT-D1D1-I2I2, the mean S / G lignin monomer content ratio of the candidate individuals was 2.62±0.57, which was the lowest. The S / G lignin monomer content ratio of 2.62±0.57 was significantly lower than the overall S / G lignin monomer content ratio of 7.69±3.85. The S / G lignin monomer content ratio was 65.93% lower than that of the overall S / G lignin monomer content ratio (7.69±3.85). When the genotype combination of InDel after the 1142nd, 1150th, and 1192nd SNPs and the 1208th and 1375th SNPs in the Pto-MYB48 promoter region was AG-CT-TA-D1I1-D2I2, the mean S / G lignin monomer content ratio of the candidate individuals was 13.07±1.38, which was the highest. The S / G lignin monomer content ratio of 13.07±1.38 was 69.96% higher than that of the overall S / G lignin monomer content ratio (7.69±3.85).

[0132] Table 2. Genotypes and S / G lignin monomer content ratios at five predetermined loci in individual Populus tomentosa individuals.

[0133]

[0134]

[0135] It can be seen that the genotype combinations of the above five loci, InDel1, InDel2, and SNP1, SNP2, and SNP3, can determine the S / G lignin monomer content ratio in poplar samples: when the genotype of SNP1 is AG, the genotype of SNP2 is CT, the genotype of SNP3 is TA, the genotype of InDel1 is D1I1, and the genotype of InDel2 is D2I2, that is, when the genotype combination is AG-CT-TA-D1I1-D2I2, the S / G lignin monomer content ratio in the poplar sample is the highest; when the genotype of SNP1 is AA, the genotype of SNP2 is CT, the genotype of SNP3 is TT, the genotype of InDel1 is D1D1, and the genotype of InDel2 is I2I2, that is, when the genotype combination is AA-CT-TT-D1D1-I2I2, the S / G lignin monomer content ratio in the poplar sample is the lowest.

[0136] As can be seen from the above embodiments, the method, primer set and kit of the present invention can quickly and accurately determine the S / G lignin monomer content ratio of the poplar sample to be tested, and efficiently and accurately screen timber species with good wood quality in the early stage of poplar growth, thus shortening the breeding cycle of poplar wood properties.

[0137] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An application of a molecular marker combination for evaluating the S / G lignin monomer content ratio in plants, characterized in that, Includes at least one of the following: 1) Determine the level of S / G lignin monomer content in plants; 2) Screen for superior plants with a high S / G lignin monomer content ratio; 3) Create superior plants with a high S / G lignin monomer content ratio; The plant in question is Populus tomentosa; The molecular marker combination is SNP1, SNP2, SNP3, InDel1, and InDel2; The SNP1 is located at position 1142 of the nucleic acid molecule Pto-MYB48 and exhibits A / G polymorphism; The SNP2 is located at position 1150 of the nucleic acid molecule Pto-MYB48 and exhibits C / T polymorphism; The SNP3 is located at position 1192 of the nucleic acid molecule Pto-MYB48 and exhibits T / A polymorphism; The InDel1 is located after position 1208 of the nucleic acid molecule Pto-MYB48 and exhibits a nucleotide sequence deletion polymorphism as shown in SEQ ID NO:

16. The InDel2 is located after position 1375 of the nucleic acid molecule Pto-MYB48 and exhibits a nucleotide sequence deletion polymorphism as shown in SEQ ID NO:

17. The nucleotide sequence of the nucleic acid molecule Pto-MYB48 is shown in SEQ ID NO:1; The plants with genotypes AG for SNP1, CT for SNP2, TA for SNP3, D1I1 for InDel1, and D2I2 for InDel2 have a high S / G lignin monomer content ratio. The plants with SNP1 genotype AA, SNP2 genotype CT, SNP3 genotype TT, InDel1 genotype D1D1 and InDel2 genotype I2I2 have a low S / G lignin monomer content ratio. The S / G lignin monomer content ratio of the plants with SNP1 genotype AA, SNP2 genotype CC, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype D2I2 is between high and low. The plants with SNP1 genotype AG, SNP2 genotype CT, SNP3 genotype TA, InDel1 genotype D1I1 and InDel2 genotype I2I2 have an S / G lignin monomer content ratio that is between high and low.

Images