Molecular marker for resistance of chlamydomonas reinhardtii to diflufenican as well as application and detection method of molecular marker
By identifying Ala-113-Val and Phe-269-Tyr mutations as molecular markers in Chlamydomonas reinhardtis, combined with PCR amplification and sequencing analysis methods, the problem of difficulty in detecting Chlamydomonas reinhardtis in the prior art is solved, and rapid and effective resistance detection is achieved.
Patent Information
- Application Number
- CN202510561775.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-06-20
AI Technical Summary
There is a lack of reports on molecular markers of Chlamydomonas reincarnated to pyrolylamine resistance, making it difficult to quickly and efficiently detect and evaluate its resistance levels.
A molecular marker of Chlamydomonas reincarnated resistance to pyrolylamine is provided, specifically Ala-113-Val mutation or Phe-269-Tyr mutation, and corresponding specific primer pairs are formulated for PCR amplification, and subsequently determine whether the sample carries these mutations by sequencing analysis.
Rapid detection of resistance to Chlamydomonas reincarnated against pyrolylamine is achieved, avoiding the complexity and danger of the traditional DNA extraction and purification process, it is simple to operate and is suitable for large-scale sample detection.
Smart Images

Figure CN120174145A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of molecular biology, relates to a molecular marker, and particularly relates to a molecular marker for the resistance of Chlamydomonas reinhardtii to diflufenican, and its application and detection method. Background Art
[0002] Chlamydomonas reinhardtii is a unicellular eukaryotic green alga, which is called "photosynthetic yeast" because of its advantages such as short growth cycle, rapid growth, high photosynthetic efficiency, and easy genetic manipulation. Its genetic background is relatively clear, with three sets of genomes of mitochondria, nucleus, and chloroplast, and a genetic transformation system has been established. In recent years, Chlamydomonas reinhardtii has been proven to be an ideal system for studying important physiological problems such as photosynthesis and chloroplast biogenesis. Chlamydomonas also retains many genes from the common ancestor of plants and animals, which helps us understand the basic structure and function of cilia and basal bodies. In addition, it is also widely used in the research of light signals, stress effects, lipid biosynthesis, pigment biosynthesis and regulation, and carbon concentration mechanism.
[0003] Diflufenican is a pyridinecarboxamide herbicide developed in 1979 and has been widely used in agriculture since the mid-1980s for the selective control of certain broad-leaved weeds in winter cereals. The main target of diflufenican in plants is phytoene desaturase (PDS). When the enzymes in carotenoid biosynthesis are inhibited, the degradation of chlorophyll and the destruction of chloroplast membranes occur. This causes obvious bleaching symptoms and necrosis of susceptible plant tissues, leading to plant death. Diflufenican can be adsorbed by various types of soil in the soil, with poor mobility. Winter rainfall does not reduce its activity. At normal temperature (20-22 °C) and oxygen supply conditions, its half-life is between 15 and 50 weeks, and the length of time depends on the soil type and soil organic matter content. The degradation rate increases with the increase of temperature and soil humidity, but when the field water content is above 60%, humidity does not affect the degradation rate. Under water-holding and anaerobic conditions, its half-life will be longer than 1 year. The ecological risk of diflufenican in water is mainly due to its high toxicity to algae, and its EC50 value (72h) is between 270 and 510 ng / L. Diflufenican has currently been included in the observation list of water quality monitoring substances within the scope of the European Union.
[0004] During the resistance monitoring process, the applicant found that the IC 50 value of the diflufenican-resistant population of Chlamydomonas reinhardtii is as high as 97.9869 μg / mL, showing an extremely high resistance level compared with the indoor sensitive strain (IC50: 0.0253 μg / mL). At present, there is no report on the molecular marker for the resistance of Chlamydomonas reinhardtii to diflufenican, and only a few literatures report the resistance markers of Chlamydomonas reinhardtii, etc. to other phytoene dehydrogenase inhibitors. Summary of the Invention
[0005] In view of the blank in the field of classifying sensitive and resistant strains of Chlamydomonas reinhardtii to flufenacet, the present invention provides a molecular marker for the resistance of Chlamydomonas reinhardtii to flufenacet, and the molecular marker is Ala-113-Val mutation or Phe-269-Tyr mutation.
[0006] In the Ala-113-Val mutation, the CDS sequence of the wild-type PDS gene is as shown in SEQ ID No:1; in the Phe-269-Tyr mutation, the CDS sequence of the wild-type PDS gene is as shown in SEQ ID No:2.
[0007] The gene sequence encoding the Ala-113-Val mutation is as shown in SEQ ID No:3, and the gene sequence encoding the Phe-269-Tyr mutation is as shown in SEQ ID No:4.
[0008] Another object of the present invention is to provide the application of any of the above molecular markers in classifying sensitive and resistant populations of Chlamydomonas reinhardtii to flufenacet.
[0009] Another object of the present invention is to provide a specific primer pair for any of the above molecular markers, and the primer pair is Ala-113-Val_F / Ala-113-Val_R or Phe-269-Tyr_F / Phe-269-Tyr_R, and the primer sequences are as follows:
[0010] Ala-113-Val_F: 5’-TAAGGATGCTCCCCGCCCG-3’,
[0011] Ala-113-Val_R: 5’-TGAATCTTCTCCGGCCAAGT-3’;
[0012] Phe-269-Tyr_F: 5’-ACCTGAGCGTCACACAGT-3’,
[0013] Phe-269-Tyr_R: 5’-GTAGTGCTTGACGCTGCC-3’.
[0014] Another object of the present invention is to provide a detection method for a molecular marker of the resistance of Chlamydomonas reinhardtii to flufenacet: first extract the total DNA and total RNA of the Chlamydomonas reinhardtii to be detected, use the specific primer pair in claim 5 as a template with the total DNA and the reverse-transcribed cDNA for PCR amplification to obtain the amplified product PDS113 or PDS269 gene fragment, and analyze whether the PCR amplification product contains the aforementioned molecular marker, then it can be judged whether the Chlamydomonas reinhardtii to be detected is a sensitive population or a resistant population to flufenacet.
[0015] The specific method for analyzing whether the PCR amplification product contains the aforementioned molecular marker is:
[0016] The PCR amplification product is sequenced and compared with the molecular marker of the resistance of Chlamydomonas reinhardtii to difluanid in claim 1, 2 or 3. If the PCR amplification product is an Ala-113-Val mutation or a Phe-269-Tyr mutation, it indicates that the detected Chlamydomonas reinhardtii is a difluanid-resistant population.
[0017] As a preference, the method for extracting the total DNA of the Chlamydomonas reinhardtii to be tested is as follows: put the Chlamydomonas reinhardtii to be tested into a centrifuge tube, add STE Buffer and proteinase K, grind it thoroughly with a grinding rod, incubate it in a 37°C water bath for 30 minutes, shake it for 30 seconds, then bath it in a 95°C water bath for 5 minutes, centrifuge it, and use the supernatant obtained as a PCR amplification template. The method for extracting the total RNA of the Chlamydomonas reinhardtii to be tested is as follows: put the Chlamydomonas reinhardtii to be tested into a centrifuge tube, add trizol reagent, grind the algae thoroughly with a grinding rod, then add chloroform and centrifuge it at 4°C, transfer the supernatant and add isopropanol, mix well and centrifuge it at 4°C, dissolve the precipitate with DEPC water, and then reverse transcribe it to obtain CDNA as a PCR amplification template.
[0018] Preferably, the reaction system of the PCR amplification is 12.5 μL 2×PrimeSTARMax Premix, 1 μL each of the forward and reverse primers of the primer pair, 2 μL DNA template or cDNA template, and supplemented with ddH2O to 25 μL.
[0019] Preferably, the reaction conditions of the PCR amplification are: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, 30 cycles; and finally extension at 72°C for 5 min.
[0020] The beneficial effects of the present invention are:
[0021] The molecular markers of Chlamydomonas reinhardtii's resistance to diflufenicol were determined for the first time, and a method for rapidly detecting the molecular markers of Chlamydomonas reinhardtii's resistance to diflufenicol was established. The method of the invention avoids the complexity and danger of the traditional DNA extraction steps, eliminates the time-consuming and labor-intensive experimental steps of protein removal, organic solvent extraction, dialysis, ethanol precipitation and the like required in the traditional DNA purification process, and avoids the harm of organic reagents to the human body. The method of the invention is simple to operate, and a large number of samples can be detected at the same time. The method of the invention can rapidly and effectively detect whether the Chlamydomonas reinhardtii population in the water environment has Ala-113-Val and Phe-269-Tyr mutations and the mutation ratio, and can rapidly and effectively evaluate the mutation frequency of the corresponding sites in a certain geographical population, thereby providing a molecular detection means for the resistance of Chlamydomonas reinhardtii to diflufenicol. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 Electrophoresis detection results of PCR amplification of Chlamydomonas reinhardtii CrPDS1, PDS113 and PDS269 genes of the present invention;
[0023] Figure 2 Analysis diagram of PDS gene mutation in the flufenacet-resistant population of Chlamydomonas reinhardtii of the present invention;
[0024] Figure 3 Analysis diagram of PDS gene mutation in the flufenacet-resistant population of Chlamydomonas reinhardtii of the present invention. Detailed implementation manners
[0025] The following will clearly and completely describe the related technologies in the present invention in combination with the attached drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0026] The experimental methods in the following embodiments are all conventional methods unless otherwise specified.
[0027] The main reagent sources in the embodiments of the present invention are as follows:
[0028] TruSeqTM Nano DNA LT Sample Prep Kit: Brand: Illumina;
[0029] STE Buffer: 100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA.
[0030] Tris-HCl (Sigma-Aldrich, Germany)
[0031] EDTA (Sigma-Aldrich, Germany)
[0032] Proteinase K: (QIAGEN, Germany)
[0033] 2×PrimeSTAR Max premix (Takara, Japan)
[0034] The rest of the reagents, if not specified, are all conventional reagents in the art and can be obtained commercially.
[0035] Example 1 Detection of the sensitivity of Chlamydomonas reinhardtii to flufenacet
[0036] Sensitive strain: The model organism Chlamydomonas reinhardtii FACHB-2219 was purchased from the Freshwater Algae Culture Collection Center of the Institute of Hydrobiology (FACHB-Culture Collection Center), and was cultured for multiple generations in Tris-Acetate-Phosphate (TAP) liquid medium in a light incubator at 25 °C and 6000 Lx (16 h: 8 h, light: dark photoperiod) for a long time. During this period, it was not exposed to any chemicals, and its IC50 value for flufenacet remained at a low level of 0.0253 μg / mL.
[0037] Resistant population:
[0038] In each 250 mL Erlenmeyer flask, 100 mL of TAP liquid medium was prepared, sealed and autoclaved. Then, a series of TAP liquid media containing different concentrations of flufenacet were prepared. 200 μL of the sensitive population of Chlamydomonas reinhardtii in the logarithmic growth phase was added to each Erlenmeyer flask, and the flask was placed in a light incubator. During this period, the algal solution was shaken three times a day. After 7 days, the OD680 was measured using a UV spectrophotometer, and the IC50 value was calculated. The sensitive population of Chlamydomonas reinhardtii was continuously domesticated with the IC30 concentration of the chemical and passaged, and the IC50 value of each generation was calculated and the resistance index (RI) was calculated. According to the number of passages and RI, the resistance development curve was plotted. It was found that the IC50 value of the flufenacet-resistant population of Chlamydomonas reinhardtii was as high as 97.9869 μg / mL, showing an extremely high level of resistance compared to the indoor sensitive strain (IC50: 0.0253 μg / mL), and the resistance multiple was 3873.
[0039] Table 1 below shows the results of the toxicity determination of the resistant strain and the sensitive strain to flufenacet. Table 2 shows the genetic stability of the resistant population to flufenacet after continuous drug-free culture for 10 generations. Table 1 shows the determination results of the median inhibitory concentration (IC 50 ) and the resistance index (RI) of the sensitive and resistant strains to flufenacet.
[0040] Table 1
[0041]
[0042] Table note: RI: Resistance index; RD: Flufenacet-resistant strain
[0043] Table 2 shows the determination of the genetic stability of the resistant strain after continuous drug-free culture for ten generations.
[0044] Table 2
[0045]
[0046] Table note: RI: Resistance index; RD: Flufenacet-resistant strain
[0047] Example 2 Rapid detection of the resistance of Chlamydomonas reinhardtii to flufenacet
[0048] In Example 1, Chlamydomonas reinhardtii strains at different stages of resistance domestication were obtained. We also detected the resistance markers of Chlamydomonas reinhardtii according to the positions of resistance mutation sites in related species:
[0049] 1) Preparation of PCR amplification template: Spread the collected Chlamydomonas reinhardtii on TAP solid medium, pick single algal cells and inoculate them into 1 mL of TAP liquid medium. After culturing until the OD680 value is about 1.0, centrifuge at 6000 rpm for 1 min to the bottom of the tube. The algal cell precipitate is used as the material for extracting total DNA and total RNA. Add 50 μL of STE Buffer (DNA extraction solution: 100 mM NaCl, 10 mM Tris-HCl, 1 mM EDTA) and 2 μL of Proteinase K (50 mg / mL) to the centrifuge tube, grind the algal cells thoroughly with a grinding rod, incubate in a water bath at 37 °C for 30 min, shake for 30 s, then incubate in a water bath at 95 °C for 5 min, centrifuge at 12000 rpm for 3 min, and the obtained supernatant is used as the PCR amplification template. Add Trizol reagent to the centrifuge tube, grind the algal cells thoroughly with a grinding rod, add chloroform and then centrifuge at 4 °C, transfer the supernatant, add isopropanol, mix well and centrifuge at 4 °C. Dissolve the precipitate with DEPC water and then reverse transcribe to obtain cDNA as the PCR amplification template.
[0050] 2) PCR amplification: PCR reaction system: 12.5 μL of 2×PrimeSTAR Max Premix, 8.5 μL of nuclease-free water, 1 μL each of the forward and reverse primers of the primer pair, and 2 μL of the PCR amplification template prepared in step 1), a total of 25 μL. Reaction conditions: Pre-denaturation at 98 °C for 2 min, denaturation at 98 °C for 10 s, annealing at 55 °C for 15 s, extension at 72 °C for 20 s, 30 cycles, and finally extension at 72 °C for 5 min, and store at 12 °C.
[0051] Through manual search, the PDS gene CrPDS1 was found in the Chlamydomonas reinhardtii genome database. The CDS sequence of the wild-type Chlamydomonas reinhardtii PDS gene is shown as SEQ ID No:1.
[0052] The primer pair used in the reaction system was designed based on the PDS genes PDS113 and PDS269 of Chlamydomonas reinhardtii. The primer pairs were Ala-113-Val_F / Ala-113-Val_R, or Phe-269-Tyr_F / Phe-269-Tyr_R, and the primer sequences are as follows:
[0053] Ala-113-Val_F: 5’-TAAGGATGCTCCCCGCCCG-3’,
[0054] Ala-113-Val_R: 5’-TGAATCTTCTCCGGCCAAGT-3’;
[0055] Phe-269-Tyr_F: 5’-ACCTGAGCGTCACACAGT-3’,
[0056] Phe-269-Tyr_R: 5’-GTAGTGCTTGACGCTGCC-3’.
[0057] 3) Gel electrophoresis: Pipette a small amount of the PCR reaction product and perform electrophoresis detection using a 1.5% agarose gel.
[0058] The results are as Figure 1 shown. Target bands appear in the lanes: from left to right, the lanes are the PDS1 (1695bp) band, the PDS113 (1695bp) and PDS269 (1695bp) bands in sequence.
[0059] 4) PCR product sequencing and mutation analysis: Send the remaining PCR product to Beijing Tsingke Biotechnology Co., Ltd. for sequencing, analyze the sequencing results, and the comparative analysis is as Figure 2 , 3 shown. Site mutations related to resistance appear in the flufenacet-resistant population of Chlamydomonas reinhardtii. A mutation from 113-Ala to Val was detected in the PDS amino acid sequence, and a mutation from 269-Phe to Tyr was detected. The gene sequence encoding the Ala-113-Val mutation obtained by sequencing the PCR product is as shown in SEQ ID No:3, and the gene sequence encoding the Phe-269-Tyr mutation is as shown in SEQ ID No:4.
[0060] 5) Repeat steps 1) to 3). Measure the concentration of the obtained PCR product using a NanoDrop One micro nucleic acid concentration detector (Thermo Fisher). Subsequently, equimix the PCR products of the same gene from different strains and send them to Beijing Tsingke Biotechnology Co., Ltd. for amplicon sequencing. Analyze the site mutation and mutation frequency according to the feedback result file.
[0061] Sequence Listing:
[0062] Gansu Agricultural University
[0063] Molecular Marker of Chlamydomonas reinhardtii Resistance to Flufenacet and Its Application and Detection Method
[0064] >SEQ ID No:1
[0065] ATGCAGACCCAGGTCAAGCCCTCTAGCTCGCGCCAGGCTAACCTGGTGGC
[0066] GAAGGGCGCGTCGTGCCCTCGCGTAGCCGTCCGTCGCGTTGCTGGCCGTC
[0067] GCGCTCTGGAGGTTGTTGCACGGGACTACCCGAGGCCTGCCTTTGAGACT
[0068] GCGGAGACATTCCAGGAGGCGAAGGCGCTGTCCAGCAAGCTTAAGGATGC
[0069] TCCCCGCCCGGCGAAGCCCCTTAAGGTTGTAATTGCCGGCGCTGGCCTGGC
[0070] TGGTTTGTCTGCGGCGAAGTACCTTTCGGACGCTGGACACCACCCAATCGT
[0071] TCTGGAGGGCCGCGACGTGCTCGGTGGCAAGGTCGCTGCATGGAAGGATG
[0072] AGGATGGCGACTGGTACGAGACTGGCTTGCACATCTTCTTCGGCGCGTACC
[0073] CCAACATGATGAATGTCTTCAAGGAGCTAAACATCGAGGAGCGCCTGCAG
[0074] TGGAAGGAGCACTCCATGATCTTTGCTATGCCCGACTCCCCCGGCGAGTTC
[0075] TCCCGCTTCGATTTCCCCGACATCCCCGCCCCCTTCAACGGCGTCTTCGCC
[0076] ATTCTGCGCAACAACCAGATGCTCACTTGGCCGGAGAAGATTCAGTTCGCT
[0077] ATCGGCCTGCTGCCGGCCATCATCTTCGGCCAGAAGTACGTGGAGGAGCA
[0078] GGACCACCTGAGCGTCACACAGTGGATGCGCCAGCAGGGCGTGCCCGAC
[0079] CGCGTGAACGAGGAGGTCTTCATTGCCATGGCCAAGGCCCTGGCCTTCATC
[0080] GACCCCGACCGCCTGTCCATGACCGTGGTCCTGACCGCGCTCAACCGCTT
[0081] CCTGCAGGAGCGCCACGGCTCCAAGATGGCCTTCCTGGATGGCGCGCCCC
[0082] CGGAGCGCCTGTGCCAGCCCATGGTGGACCACTTCACGGCCCGCGGCGGC
[0083] GAGCTGAAGATGAACGCGCGCGTGAAGGACATTGTGCTGAACGACGACG
[0084] GCAGCGTCAAGCACTACAAGCTGACCACCGGGGAGGTGGTGGAGGGCGA
[0085] CCTGTACATGAGCGCCATGCCGGTGGACATCCTGAAGCTGCTGGTGCCGG
[0086] ACCAGTGGAAGCCCAACCCCTACTTCTCCCAGCTGAAGGAGCTGGAGGGC
[0087] GTGCCCGTCATCAACATCCACATCTGGTTTGACCGCAAGCTGACCACCGTG
[0088] GACCACCTGCTGTTCAGCCGCTCGCCGCTGCTGTCGGTGTACGCGGACATG
[0089] AGCACCACCTGCAAGGAGTACTACGACACGGAGAAGTCCATGCTGGAGCT
[0090] CGTGTTCGCGCCCGCCAAGGACTGGATCGGCCGCTCGGATGAGGACATCA
[0091] TCGCCGCCACCATGACTGAGCTGGAGCGCCTGTTTCCCACCGAGATCAAG
[0092] GCCGACCAGTCGCTGGCCAAGATCCGCAAGTACAAGGTCATCAAGACGCC
[0093] GCTGTCCGTGTACGAGAGCCGCGCCGGCCGCGAGGCCTTCCGCCCCAGCC
[0094] AGCGCACGCCCATCAAGAACTTCTTCCTGGCGGGCGACTTCACCAAGCAG
[0095] AAGTACCTGGCTTCCATGGAGGGCGCCATCTTTTCCGGCAAGCTGGCCGCC
[0096] GAGCAGATCGTCAACGACTACAACTACAAGGGCGTGGCACCGCCCGCGCG
[0097] CTCGTCCAGCTCGCCCGAGCTGGTGGCGGCCTCTGCGCTGCTGGCGGTGG
[0098] CGGCCGTGGGCGCCGGCCTGGTCGGCTTTGGCCGGTAA
[0099] >SEQ ID No:2
[0100] ATGCAGACCCAGGTCAAGCCCTCTAGCTCGCGCCAGGCTAACCTGGTGGC
[0101] GAAGGGCGCGTCGTGCCCTCGCGTAGCCGTCCGTCGCGTTGCTGGCCGTC
[0102] GCGCTCTGGAGGTTGTTGCACGGGACTACCCGAGGCCTGCCTTTGAGACT
[0103] GCGGAGACATTCCAGGAGGCGAAGGCGCTGTCCAGCAAGCTTAAGGATGC
[0104] TCCCCGCCCGGCGAAGCCCCTTAAGGTTGTAATTGCCGGCGCTGGCCTGGC
[0105] TGGTTTGTCTGCGGCGAAGTACCTTTCGGACGCTGGACACCACCCAATCGT
[0106] TCTGGAGGGCCGCGACGTGCTCGGTGGCAAGGTCGCTGCATGGAAGGATG
[0107] AGGATGGCGACTGGTACGAGACTGGCTTGCACATCTTCTTCGGCGCGTACC
[0108] CCAACATGATGAATGTCTTCAAGGAGCTAAACATCGAGGAGCGCCTGCAG
[0109] TGGAAGGAGCACTCCATGATCTTTGCTATGCCCGACTCCCCCGGCGAGTTC
[0110] TCCCGCTTCGATTTCCCCGACATCCCCGCCCCCTTCAACGGCGTCTTCGCC
[0111] ATTCTGCGCAACAACCAGATGCTCACTTGGCCGGAGAAGATTCAGTTCGCT
[0112] ATCGGCCTGCTGCCGGCCATCATCTTCGGCCAGAAGTACGTGGAGGAGCA
[0113] GGACCACCTGAGCGTCACACAGTGGATGCGCCAGCAGGGCGTGCCCGAC
[0114] CGCGTGAACGAGGAGGTCTTCATTGCCATGGCCAAGGCCCTGGCCTTCATC
[0115] GACCCCGACCGCCTGTCCATGACCGTGGTCCTGACCGCGCTCAACCGCTT
[0116] CCTGCAGGAGCGCCACGGCTCCAAGATGGCCTTCCTGGATGGCGCGCCCC
[0117] CGGAGCGCCTGTGCCAGCCCATGGTGGACCACTTCACGGCCCGCGGCGGC
[0118] GAGCTGAAGATGAACGCGCGCGTGAAGGACATTGTGCTGAACGACGACG
[0119] GCAGCGTCAAGCACTACAAGCTGACCACCGGGGAGGTGGTGGAGGGCGA
[0120] CCTGTACATGAGCGCCATGCCGGTGGACATCCTGAAGCTGCTGGTGCCGG
[0121] ACCAGTGGAAGCCCAACCCCTACTTCTCCCAGCTGAAGGAGCTGGAGGGC
[0122] GTGCCCGTCATCAACATCCACATCTGGTTTGACCGCAAGCTGACCACCGTG
[0123] GACCACCTGCTGTTCAGCCGCTCGCCGCTGCTGTCGGTGTACGCGGACATG
[0124] AGCACCACCTGCAAGGAGTACTACGACACGGAGAAGTCCATGCTGGAGCT
[0125] CGTGTTCGCGCCCGCCAAGGACTGGATCGGCCGCTCGGATGAGGACATCA
[0126] TCGCCGCCACCATGACTGAGCTGGAGCGCCTGTTTCCCACCGAGATCAAG
[0127] GCCGACCAGTCGCTGGCCAAGATCCGCAAGTACAAGGTCATCAAGACGCC
[0128] GCTGTCCGTGTACGAGAGCCGCGCCGGCCGCGAGGCCTTCCGCCCCAGCC
[0129] AGCGCACGCCCATCAAGAACTTCTTCCTGGCGGGCGACTTCACCAAGCAG
[0130] AAGTACCTGGCTTCCATGGAGGGCGCCATCTTTTCCGGCAAGCTGGCCGCC
[0131] GAGCAGATCGTCAACGACTACAACTACAAGGGCGTGGCACCGCCCGCGCG
[0132] CTCGTCCAGCTCGCCCGAGCTGGTGGCGGCCTCTGCGCTGCTGGCGGTGG
[0133] CGGCCGTGGGCGCCGGCCTGGTCGGCTTTGGCCGGTAA
[0134] >SEQ ID No:3
[0135] ATGCAGACCCAGGTCAAGCCCTCTAGCTCGCGCCAGGCTAACCTGGTGGC
[0136] GAAGGGCGCGTCGTGCCCTCGCGTAGCCGTCCGTCGCGTTGCTGGCCGTC
[0137] GCGCTCTGGAGGTTGTTGCACGGGACTACCCGAGGCCTGCCTTTGAGACT
[0138] GCGGAGACATTCCAGGAGGCGAAGGCGCTGTCCAGCAAGCTTAAGGATGC
[0139] TCCCCGCCCGGCGAAGCCCCTTAAGGTTGTAATTGCCGGCGCTGGCCTGGC
[0140] TGGTTTGTCTGCGGCGAAGTACCTTTCGGACGCTGGACACCACCCAATCGT
[0141] TCTGGAGGGCCGTGACGTGCTCGGTGGCAAGGTCGTTGCATGGAAGGATG
[0142] AGGATGGCGACTGGTACGAGACTGGCTTGCACATCTTCTTCGGCGCGTACC
[0143] CCAACATGATGAATGTCTTCAAGGAGCTAAACATCGAGGAGCGCCTGCAG
[0144] TGGAAGGAGCACTCCATGATCTTTGCTATGCCCGACTCCCCCGGCGAGTTC
[0145] TCCCGCTTCGATTTCCCCGACATCCCCGCCCCCTTCAACGGCGTCTTCGCC
[0146] ATTCTGCGCAACAACCAGATGCTCACTTGGCCGGAGAAGATTCAGTTCGCT
[0147] ATCGGCCTGCTGCCGGCCATCATCTTCGGCCAGAAGTACGTGGAGGAGCA
[0148] GGACCACCTGAGCGTCACACAGTGGATGCGCCAGCAGGGCGTGCCCGAC
[0149] CGCGTGAACGAGGAGGTCTTCATTGCCATGGCCAAGGCCCTGGCCTTCATC
[0150] GACCCCGACCGCCTGTCCATGACCGTGGTCCTGACCGCGCTCAACCGCTT
[0151] CCTGCAGGAGCGCCACGGCTCCAAGATGGCCTTCCTGGATGGCGCGCCCC
[0152] CGGAGCGCCTGTGCCAGCCCATGGTGGACCACTTCACGGCCCGCGGCGGC
[0153] GAGCTGAAGATGAACGCGCGCGTGAAGGACATTGTGCTGAACGACGACG
[0154] GCAGCGTCAAGCACTACAAGCTGACCACCGGGGAGGTGGTGGAGGGCGA
[0155] CCTGTATATGAGCGCCATGCCGGTGGACATCCTGAAGCTGCTGGTGCCGGA
[0156] CCAGTGGAAGCCCAACCCCTACTTCTCCCAGCTGAAGGAGCTGGAGGGCG
[0157] TGCCCGTCATCAACATCCACATCTGGTTTGACCGCAAGCTGACCACCGTGG
[0158] ACCACCTGCTGTTCAGCCGCTCACCGCTGCTGTCGGTGTACGCGGACATGA
[0159] GCACCACCTGCAAGGAGTACTACGACACGGAGAAGTCCATGCTGGAGCTC
[0160] GTGTTCGCGCCCGCCAAGGACTGGATCGGCCGCTCGGATGAGGACATCAT
[0161] CGCCGCCACCATGACTGAGCTGGAGCGCCTGTTTCCCACCGAGATCAAGG
[0162] CCGACCAGTCGCTGGCCAAGATCCGCAAGTACAAGGTCATCAAGACGCCG
[0163] CTGTCCGTGTACGAGAGCCGCGCCGGCCGCGAGGCCTTCCGCCCCAGCCA
[0164] GCGCACGCCCATTAAGAACTTCTTCCTGGCTGGCGACTTCACCAAGCAGA
[0165] AGTACCTGGCTTCCATGGAGGGCGCCATCTTTTCCGGCAAGCTGGCCGCCG
[0166] AGCAGATCGTCAACGACTACAACTACAAGGGCGTGGCGCCGCCCGCGCGC
[0167] TCGTCCAGCTCGCCCGAGCTGGTGGCGGCCTCCGCGCTGCTGGCGGTGGC
[0168] GGCCGTGGGCGCTGGCCTGGTCGGCTTTGGCCGGTAA
[0169] >SEQ_ID_No:4
[0170] ATGCAGACCCAGGTCAAGCCCTCTAGCTCGCGCCAGGCTAACCTGGTGGC
[0171] GAAGGGCGCGTCGTGCCCTCGCGTAGCCGTCCGTCGCGTTGCTGGCCGTC
[0172] GCGCTCTGGAGGTTGTTGCACGGGACTACCCGAGGCCTGCCTTTGAGACT
[0173] GCGGAGACATTCCAGGAGGCGAAGGCGCTGTCCAGCAAGCTTAAGGATGC
[0174] TCCCCGCCCGGCGAAGCCCCTTAAGGTTGTAATTGCCGGCGCTGGCCTGGC
[0175] TGGTTTGTCTGCGGCGAAGTACCTTTCGGACGCTGGACACCACCCAATCGT
[0176] TCTGGAGGGCCGTGACGTGCTCGGTGGCAAGGTCGCTGCATGGAAGGATG
[0177] AGGATGGCGACTGGTACGAGACTGGCTTGCACATCTTCTTCGGCGCGTACC
[0178] CCAACATGATGAATGTCTTCAAGGAGCTAAACATCGAGGAGCGCCTGCAG
[0179] TGGAAGGAGCACTCCATGATCTTTGCTATGCCCGACTCCCCCGGCGAGTTC
[0180] TCCCGCTTCGATTTCCCCGACATCCCCGCCCCCTTCAACGGCGTCTTCGCC
[0181] ATTCTGCGCAACAACCAGATGCTCACTTGGCCGGAGAAGATTCAGTTCGCT
[0182] ATCGGCCTGCTGCCGGCCATCATCTTCGGCCAGAAGTACGTGGAGGAGCA
[0183] GGACCACCTGAGCGTCACACAGTGGATGCGCCAGCAGGGTGTGCCCGACC
[0184] GCGTGAACGAGGAGGTCTTCATTGCCATGGCCAAGGCCCTGGCCTTCATC
[0185] GACCCCGACCGCCTGTCCATGACCGTGGTCCTGACCGCGCTCAACCGCTA
[0186] CCTGCAGGAGCGCCACGGCTCCAAGATGGCCTTCCTGGATGGCGCGCCCC
[0187] CGGAGCGCCTGTGCCAGCCCATGGTGGACCACTTCACGGCCCGCGGCGGC
[0188] GAGCTGAAGATGAACGCGCGCGTGAAGGACATTGTGCTGAACGACGACG
[0189] GCAGCGTCAAGCACTACAAGCTGACCACCGGGGAGGTGGTGGAGGGCGA
[0190] CCTGTATATGAGCGCCATGCCGGTGGACATCCTGAAGCTGCTGGTGCCGGA
[0191] CCAGTGGAAGCCCAACCCCTACTTCTCCCAGCTGAAGGAGCTGGAGGGCG
[0192] TGCCCGTCATCAACATCCACATCTGGTTTGACCGCAAGCTGACCACCGTGG
[0193] ACCACCTGCTGTTCAGCCGCTCACCGCTGCTGTCGGTGTACGCGGACATGA
[0194] GCACCACCTGCAAGGAGTACTACGACACGGAGAAGTCCATGCTGGAGCTC
[0195] GTGTTCGCGCCCGCCAAGGACTGGATCGGCCGCTCGGATGAGGACATCAT
[0196] CGCCGCCACCATGACTGAGCTGGAGCGCCTGTTTCCCACCGAGATCAAGG
[0197] CCGACCAGTCGCTGGCCAAGATCCGCAAGTACAAGGTCATCAAGACGCCG
[0198] CTGTCCGTGTACGAGAGCCGCGCCGGCCGCGAGGCCTTCCGCCCCAGCCA
[0199] GCGCACGCCCATTAAGAACTTCTTCCTGGCTGGCGACTTCACCAAGCAGA
[0200] AGTACCTGGCTTCCATGGAGGGCGCCATCTTTTCCGGCAAGCTGGCCGCCG
[0201] AGCAGATCGTCAACGACTACAACTACAAGGGCGTGGCGCCGCCCGCGCGC
[0202] TCGTCCAGCTCGCCCGAGCTGGTGGCGGCCTCCGCGCTGCTGGCGGTGGC
[0203] GGCCGTGGGCGCTGGCCTGGTCGGCTTTGGCCGGTAA。
[0204] It should be emphasized that the above are only the preferred embodiments of the present invention, and there is no restriction on the present invention in any form. Any simple modification, equivalent change and modification made to the above embodiments based on the technical essence of the present invention still fall within the scope of the technical solution of the present invention.
Claims
1. A molecular marker for the resistance of Chlamydomonas reinhardtii to difluanid, characterized in that: The molecular marker is CrPDS_A113V mutation or CrPDS_F269Y mutation, Ala-113-Val mutation or Phe-269-Tyr mutation.
2. A molecular marker for the resistance of Chlamydomonas reinhardtii to difluanid according to claim 1, characterized in that: The CDS sequence of the wild-type PDS1 gene in the Ala-113-Val mutation is shown in SEQ ID No: 1; the CDS sequence of the wild-type PDS gene in the Phe-269-Tyr mutation is shown in SEQ ID No:
2.
3. A molecular marker for the resistance of Chlamydomonas reinhardtii to difluanid according to claim 1 or 2, characterized in that: The gene sequence encoding the Ala-113-Val mutation is shown in SEQ ID No:3, and the gene sequence encoding the Phe-269-Tyr mutation is shown in SEQ ID No:
4.
4. Use of the molecular marker according to any one of claims 1 to 3 in the classification of Chlamydomonas reinhardtii populations that are sensitive and resistant to diflufenicol.
5. A specific primer pair for amplifying the molecular marker according to any one of claims 1 to 3, characterized in that: The primer pair is Ala-113-Val_F / Ala-113-Val_R, or Phe-269-Tyr_F / Phe-269-Tyr_R, and the primer sequences are as follows: Ala-113-Val_F: 5'-TAAGGATGCTCCCCGCCCG-3', Ala-113-Val_R: 5'-TGAATCTTCTCCGGCCAAGT-3'; Phe-269-Tyr_F: 5'-ACCTGAGCGTCACACAGT-3', Phe-269-Tyr_R: 5'-GTAGTGCTTGACGCTGCC-3'.
6. A method for detecting molecular markers of Chlamydomonas reinhardtii resistance to difluanid, characterized in that: First, the total DNA and total RNA of the Chlamydomonas reinhardtii to be tested are extracted, and PCR amplification is performed using the total DNA and the reverse transcribed CDNA as templates using the specific primer pair in claim 5 to obtain an amplified product PDS113 or PDS269 gene fragment, and the PCR amplification product is analyzed to determine whether it contains the molecular marker described in claim 1, so as to determine whether the Chlamydomonas reinhardtii to be tested is a sensitive population or a resistant population to difluanid.
7. The detection method according to claim 6, characterized in that: The specific method for analyzing whether the PCR amplification product contains the molecular marker described in claim 1 is: sequencing the PCR amplification product, and comparing the sequence with the molecular marker of the resistance of Chlamydomonas reinhardtii to difluanid in claim 1, 2 or 3. If the PCR amplification product is an Ala-113-Val mutation or a Phe-269-Tyr mutation, it means that the Chlamydomonas reinhardtii detected is a difluanid-resistant population.
8. The detection method according to claim 6, characterized in that: The method for extracting the total DNA of the Chlamydomonas reinhardtii to be tested is as follows: put the Chlamydomonas reinhardtii to be tested into a centrifuge tube, centrifuge at 5000rpm for 5min, and then discard the supernatant to obtain the algae. Add STE Buffer and proteinase K, grind the algae with a grinding rod, incubate in a 37℃ water bath for 30min, shake for 30s, bathe in 95℃ water bath for 5min, centrifuge, and use the supernatant as a PCR amplification template. The method for extracting the total RNA of the Chlamydomonas reinhardtii to be tested is as follows: put the Chlamydomonas reinhardtii to be tested into a centrifuge tube, add trizol reagent, grind the algae with a grinding rod, add chloroform and centrifuge at 4℃, transfer the supernatant and add isopropanol, mix and centrifuge at 4℃, dissolve the precipitate with DEPC water, and then reverse transcribe it as a PCR amplification template.
9. The detection method according to claim 6, characterized in that: The reaction system of the PCR amplification is 12.5 μL 2× PrimeSTAR Max Premix, 1 μL each of the forward and reverse primers of the primer pair, 2 μL DNA template or cDNA template, and ddH2O is added to 25 μL.
10. The detection method according to claim 6, characterized in that: The reaction conditions of the PCR amplification are: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 20 s, 30 cycles; and finally extension at 72°C for 5 min.