Preparation method and application of woven DNA synthesis stationary phase
By using the braided cloth as a stationary phase and modifying it by plasma treatment and silane coupling agent, a braided DNA synthesis stationary phase is formed, which solves the defects in the stability and cost control of the stationary phase in the prior art, and achieves efficient and accurate DNA synthesis.
Patent Information
- Application Number
- CN202510652428.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-21
- Publication Date
- 2025-06-20
- Estimated Expiration
- 2045-05-21
AI Technical Summary
The existing stationary phase vectors for DNA synthesis have defects in stability and cost control, which have affected the stability and accuracy of DNA synthesis, thus limiting the development of high-throughput synthesis.
A woven fabric is used as the stationary phase, and modified by plasma treatment and silane coupling agent to increase its functional groups, followed by hydrophobic treatment and base probe coupling to form a braided DNA synthetic stationary phase.
It realizes the low cost, high stability and high loading performance of the stationary phase, improves the accuracy and efficiency of DNA synthesis, and expands its application prospects in the field of enzymatic synthesis of DNA.
Smart Images

Figure CN120174630A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical fields of bioengineering, biotechnology, and molecular biology materials, and specifically relates to a preparation method and application of a woven DNA synthesis stationary phase. Background Art
[0002] In recent years, with the rapid development of genetic engineering technology, DNA synthesis technology has become the core driving force for promoting research and application breakthroughs in the field of bioengineering. As the cutting-edge third-generation DNA synthesis technology, enzymatic DNA synthesis provides a revolutionary solution for breaking through the bottleneck of traditional chemical synthesis with its high efficiency, high accuracy, and environmental friendliness. This technology achieves precise control through engineered terminal deoxynucleotidyl transferase (TDT) and reversible terminator nucleotides, and precisely adds single bases in multiple rounds at the end of the DNA strand (requiring a solid-phase carrier to immobilize the DNA strand) to complete the synthesis of the target sequence, showing breakthrough potential in biocompatibility and process integration, and opening up a new direction for the development of DNA synthesis technology.
[0003] As the key substrate material for DNA synthesis, the solid-phase carrier undertakes multiple core functions in the synthesis process: not only providing a physical support platform for the reaction system, but also ensuring the orderly progress of the synthesis reaction by immobilizing reaction substrates (such as primers and nucleotides). Among them, DNA immobilization technology, as the key basis for enzymatic synthesis, mainly relies on covalent binding to firmly anchor primer molecules on the surface of the carrier - this process is usually achieved by specific coupling of functional groups modified on the surface of the carrier with active groups at the end of the primer. However, the mainstream chip stationary phase carriers on the current market (such as glass substrates and polymer materials) generally have significant defects: in terms of stability, the functional groups on the surface of the carrier are easily degraded by the environment, resulting in a decrease in primer immobilization efficiency over time; in terms of cost control, the treatment of high-purity base materials and precision surface modification processes drive up production costs. These problems will directly affect the stability and sequence accuracy of DNA synthesis, and thus restrict the development of high-throughput synthesis. It is particularly worth noting that during the synthesis of long-chain DNA, the attenuation of carrier performance may lead to an exponential increase in the synthesis error rate, which makes the development of new high-performance solid-phase carriers a key breakthrough for improving synthesis quality. Summary of the Invention
[0004] The purpose of the present invention is to provide a preparation method and application of a woven DNA synthesis stationary phase.
[0005] The present invention first provides a preparation method of a woven DNA synthesis stationary phase, including the following steps: (1) Treat the woven fabric with plasma, and then place the woven fabric in a silane coupling agent solution for reaction to obtain a functionally modified woven fabric; The silane coupling agent is a silane coupling agent containing a functional group azide; (2) Placing the functionalized modified woven fabric in a hydrophobic reagent for hydrophobic treatment to obtain a hydrophobically treated functionalized woven fabric; (3) Combining a single-stranded oligo with dibenzocyclooctyne modified at the 5' end (hereinafter referred to as the base probe) with the hydrophobically treated functionalized woven fabric to obtain the woven DNA synthesis stationary phase.
[0006] In the above preparation method, the constituent material of the woven fabric is glass fiber; The thickness of the woven fabric is at least one of 0.03 mm, 0.05 mm, and 0.1 mm; The silane coupling agent is covalently bonded to the silicon hydroxyl groups on the surface of the woven fabric to obtain a functionalized modified woven fabric.
[0007] In the above preparation method, in step (1), the power of the plasma treatment is 50 - 500 W; Preferably, the power of the plasma treatment is 100 - 200 W; The time of the plasma treatment is 1 - 500 s; Preferably, the time of the plasma treatment is 30 - 200 s; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon, and air; The flow rate of the working gas for the plasma treatment is 100 - 500 m / s; Preferably, the flow rate of the working gas for the plasma treatment is 150 - 250 m / s; In the above preparation method, in step (1), the silane coupling agent containing a functional group azide is selected from at least one of 3-(azidopropyl)triethoxysilane, azidotrimethylsilane, and 6-azidosulfonylhexyltriethoxysilane; The mass percentage concentration of the silane coupling agent solution is 0.1% - 20%; Preferably, the mass percentage concentration of the silane coupling agent solution is 0.2% - 1%; The solvent of the silane coupling agent solution is acetonitrile; The temperature of the reaction is 25 - 100 °C; Preferably, the temperature of the reaction is 25 - 50 °C; The time of the reaction is 2 - 24 h; Preferably, the time of the reaction is 2 - 15 h; The reaction is carried out under light-shielded conditions.
[0008] In the above preparation method, in step (2), the hydrophobic reagent is at least one of n-octyltrichlorosilane, isooctyltrichlorosilane, butyltrichlorosilane, octadecyltrichlorosilane, and trimethylchlorosilane; The hydrophobic reagent is a solution with a mass percentage concentration of 1% - 10%; Preferably, the hydrophobic reagent is a solution with a mass percentage concentration of 1% - 5%; The solvent of the hydrophobic reagent is at least one of acetonitrile, ethanol, and isopropanol; The temperature of the hydrophobic treatment is 25 - 100 °C; Preferably, the temperature of the hydrophobic treatment is 25 - 50 °C; The time of the hydrophobic treatment is 1 - 30 min; Preferably, the time of the hydrophobic treatment is 1 - 10 min.
[0009] In the above preparation method, in step (3), the nucleotide sequence of the base probe is as follows: 5’-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3’.
[0010] The above preparation method, step (3) specifically includes the following steps: Immerse the functionalized woven fabric treated by hydrophobic treatment in the base probe solution to combine them to obtain the woven DNA synthesis stationary phase.
[0011] In the above preparation method, the concentration of the base probe solution is 0.5 - 10 μM; Preferably, the concentration of the base probe solution is 1 - 5 μM; The volume of the base probe solution is 1 - 200 μL; Preferably, the volume of the base probe solution is 100 - 200 μL; The temperature of the immersion is 25 - 100 °C; Preferably, the temperature of the immersion is 25 - 50 °C; The time of the immersion is 0.5 - 5 h.
[0012] Preferably, the time of the immersion is 0.5 - 1 h; In the above preparation method, there is also a step of cleaning and drying the woven fabric before the plasma treatment of the woven fabric; specifically, the cleaning is first carried out with an organic solvent to remove the oil stains and impurities on the surface; then ultrasonic cleaning is carried out with a glass cleaning agent, and finally water cleaning is carried out.
[0013] The organic solvent is selected from at least one of acetone, chloroform, chloroethane, and xylene; After the hydrophobic treatment in step (2), there are still steps of washing with water and drying.
[0014] In the above preparation method, the drying temperature is 25 - 100 °C, specifically it can be 90 °C; the drying time is 5 - 60 min, specifically it can be 10 min.
[0015] Furthermore, the present invention provides a woven DNA synthesis stationary phase prepared by the above preparation method.
[0016] The application of the above woven DNA synthesis stationary phase in enzymatic DNA synthesis also belongs to the protection scope of the present invention.
[0017] Compared with the prior art, the present invention has the following advantages: The present invention innovatively uses a woven fabric as the stationary phase. This material has low cost and can be applied in large-scale production. Its surface characteristics endow the stationary phase with excellent loading performance, which is significantly improved compared with traditional stationary phases. The stationary phase of the present invention shows broad application prospects in biotechnological fields such as enzymatic DNA synthesis, providing important material support for the innovative development of related technologies.
[0018] The woven fabric has strong hydrophilicity, so it is easy to retain the DNA synthesis solution, resulting in a decrease in synthesis efficiency. Therefore, the present invention adopts a unique hydrophobic treatment scheme to improve the hydrophobicity of the woven fabric without affecting probe inoculation, thereby improving the DNA synthesis efficiency. Description of the Drawings
[0019] Figure 1 It is the preparation flow chart of the woven DNA synthesis stationary phase of the present invention. Detailed Embodiments
[0020] To make the objectives, technical solutions and advantages of the present invention clearer, the technical solutions in the present invention will be clearly and completely described below in conjunction with the drawings in the present invention. Obviously, the described embodiments are some but not all of the embodiments of the present invention, and they should not be construed as limitations on the present invention. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention. In the description of the present invention, it should be understood that the terms used are only for the purpose of description and cannot be construed as indicating or implying relative importance.
[0021] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0022] Example 1: Preparation of a woven DNA synthesis stationary phase and enzymatic DNA synthesis (1) Material preparation: Select a clean 5 mm × 5 mm glass fiber cloth (Green Cycle Chemical Industry, thickness 0.03 mm) for subsequent experimental operations.
[0023] (2) Surface cleaning: First, place the above-mentioned glass fiber cloth in acetone for cleaning to remove surface oil stains and impurities. Subsequently, ultrasonically clean it with a 1% (by mass) glass cleaning agent (Alnocox solution) for 5 min, then wash it twice with water. Finally, place it in an environment at 90 °C for drying for 10 min.
[0024] (3) Plasma cleaning: Turn on the gas cylinder and equipment power supply in sequence. Place the glass fiber cloth prepared in step (2) inside a vacuum plasma cleaner (Nain Technology, NE-PE05F) (the gas is oxygen, flow rate 200 m / s). Turn on the radio frequency and vacuum systems, and perform plasma treatment on the glass fiber cloth for 180 s with a power of 130 W to further clean the surface of the glass fiber cloth and improve its activity.
[0025] (4) Functional modification: First, prepare a 1% (by mass) solution of 3-(azidopropyl)triethoxysilane in acetonitrile. Immerse the glass fiber cloth treated above in it and react in the dark at 50 °C for 15 h to obtain a functionally modified glass fiber cloth.
[0026] (5) Prepare a 1% (by mass) solution of n-octyltrichlorosilane in acetonitrile. Immerse the modified glass fiber cloth in it and perform hydrophobic treatment at 25 °C for 10 min; wash it twice with pure water and dry it at 90 °C for 10 min (the functional modification process is as shown), to obtain a hydrophobically treated functionally modified glass fiber cloth. Figure 1 as shown
[0027] (6) Coupling the base probe: Put the above-mentioned hydrophobically treated functionally modified glass fiber cloth into 200 μL of a 2 μM initiating strand solution (the nucleotide sequence of the initiating strand is Sequence I in the sequence listing, i.e., 5’-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3’, and the solvent is 20×SSC), and react at 25 °C for 1 h. After the reaction, a woven DNA synthesis stationary phase is obtained.
[0028] (7) Use the Qubit kit to measure the concentration before and after the binding of the DNA base probe, and calculate the binding amount by the difference method (see Table 1).
[0029]
[0030] (8) Perform cycles of DNA synthesis reaction and deprotection reaction using the prepared woven DNA synthesis stationary phase to synthesize the target sequence. The nucleotide sequence of the synthesized DNA is shown below (Sequence II); specifically, terminal deoxynucleotidyl transferase (TdT) and dNTPs with protected bases can be used for the enzymatic reaction, and the protected bases are eluted using a deprotection solution. Multiple cycles are used to achieve enzymatic synthesis of the target DNA sequence. The synthesis steps are as follows: (a) Configure the reaction system required for enzymatic DNA synthesis, including reaction solution, deprotection solution, and washing solution. Among them, the composition of the reaction solution is shown in Table 2 below.
[0031]
[0032] The deprotection solution is a 700 mM sodium nitrite solution with pH = 5; the washing solution is a 50 mM potassium phosphate buffer containing 100 mM NaCl.
[0033] (b) Place the woven DNA synthesis stationary phase in the system, add the reaction solution containing nucleotides (containing TdT) for reaction. After the reaction is completed, add the deprotection solution and remove the protecting group at the 3'-end of the synthesis to facilitate the ligation of the next nucleotide.
[0034] (c) Wash 2 - 3 times with the washing solution. After the washing is completed, continue to add the reaction solution containing the next nucleotide for reaction. Repeat the reaction - deprotection group - washing steps in the order of TAGGTATATATGTGCCATGGTGGTTTGTTGCACCCATCAACCCTTCATCT (Sequence II) to achieve enzymatic synthesis of the target DNA sequence and synthesize the required DNA strand.
[0035] (d) Perform next-generation sequencing analysis on the synthesized product. As shown in Table 3, the sequencing results show that the average yield can reach 75.44%, and the average accuracy can reach 99.44% (accuracy calculation formula: accuracy = )
[0036]
[0037] Comparative Example 1 (1) Material preparation: Select a clean 5 mm × 5 mm glass fiber cloth (Green Cycle Chemical Industry, thickness 0.03 mm) for subsequent experimental operations.
[0038] (2) Surface cleaning: First, place the above-mentioned glass fiber cloth in acetone for cleaning to remove surface oil and impurities. Subsequently, ultrasonically clean with a 1% (by mass) glass cleaning agent (Alnocox solution) for 5 min, then wash twice with water. Finally, dry in an environment at 90 °C for 10 min.
[0039] (3) Plasma cleaning: Open the gas cylinder and the device power supply in sequence, and place the glass fiber cloth prepared in step (2) into the vacuum plasma cleaning machine (Nane Technology, NE-PE05F) (the gas is oxygen, and the flow rate is 200 m / s). Turn on the radio frequency and vacuum systems, and perform plasma treatment on the glass fiber cloth for 180 s with a power of 130 W to further clean the surface of the glass fiber cloth and improve its activity.
[0040] (4) Functional modification: First, prepare a 1% mass concentration solution of 3-azidopropyltriethoxysilane in acetonitrile, immerse the glass fiber cloth treated above in it, and react in the dark at 50 °C for 15 h to obtain a functionally modified glass fiber cloth.
[0041] (5) Coupling the base probe: Put the above functionally modified glass fiber cloth into 200 μL of a 2 μM initiating chain solution (the nucleotide sequence of the initiating chain is Sequence I in the sequence listing, i.e., 5’-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3’, and the solvent is 20×SSC), and react at 25 °C for 1 h. After the reaction, a woven DNA synthesis stationary phase is obtained.
[0042] (6) Use the Qubit kit to measure the concentration before and after the binding of the DNA base probe, and calculate the binding amount according to the difference method (see Table 4).
[0043]
[0044] (7) Use the above-prepared woven DNA synthesis stationary phase to carry out cycles of DNA synthesis reaction and deprotection reaction to synthesize the target sequence. The steps and conditions are the same as those in Example 1. The obtained results are shown in Table 5.
[0045]
[0046] The woven DNA synthesis stationary phase proposed by the present invention has excellent physical and chemical properties with a woven cloth as the substrate. By grafting functional groups and hydrophobic modification on the surface of the woven cloth substrate, a woven DNA synthesis stationary phase with low preparation cost and good stability is obtained. Using the stationary phase carrier of the present invention, enzymatic biological DNA synthesis reactions can be carried out, and the synthesis accuracy rate is relatively high, and the yield is also relatively high.
Claims
1. A method for preparing a braided DNA synthesis stationary phase, comprising the following steps: (1) treating a woven fabric with plasma, and then reacting the woven fabric in a silane coupling agent solution to obtain a functionally modified woven fabric; The silane coupling agent is a silane coupling agent containing a functional group azide; (2) placing the functionally modified woven fabric in a hydrophobic reagent for hydrophobic treatment to obtain a hydrophobically treated functional woven fabric; (3) Combining the single-stranded oligo modified with dibenzocyclooctyne at the 5' end with the hydrophobic treated functionalized woven fabric to obtain the woven DNA synthesis stationary phase.
2. The preparation method according to claim 1, characterized in that: In step (1), the power of the plasma treatment is 50-500 W; The plasma treatment time is 1-500 s; The working gas for the plasma treatment is selected from any one of nitrogen, oxygen, argon and air; The flow rate of the working gas in the plasma treatment is 100-500 m / s.
3. The preparation method according to claim 1, characterized in that: In step (1), the woven cloth is made of glass fiber; The silane coupling agent containing a functional group azide is selected from at least one of 3-(azidopropyl)triethoxysilane, azidotrimethylsilane and 6-azidosulfonylhexyltriethoxysilane; The thickness of the woven fabric is at least one of 0.03 mm, 0.05 mm and 0.1 mm; The mass percentage concentration of the silane coupling agent solution is 0.1%-20%; The reaction temperature is 25-100°C; The reaction time is 2-24 h; The reaction was carried out under light protection conditions.
4. The preparation method according to claim 1, characterized in that: In step (2), the hydrophobic agent is at least one of n-octyltrichlorosilane, isooctyltrichlorosilane, butyltrichlorosilane, octadecyltrichlorosilane and trimethylchlorosilane; The hydrophobic reagent is a solution with a mass percentage concentration of 1%-10%; The solvent of the hydrophobic reagent is at least one of acetonitrile, ethanol and isopropanol; The temperature of the hydrophobic treatment is 25-100°C; The time of the hydrophobic treatment is 1-30 min.
5. The preparation method according to claim 1, characterized in that: In step (3), the nucleotide sequence of the single-stranded oligo modified with dibenzocyclooctyne at the 5' end is as follows: 5'-TTTTTTTTTTTTGGCTAGAGACTCCTACGCGACTTGAGAAAGGATGATG-3'.
6. The preparation method according to claim 1, characterized in that: Step (3) specifically includes the following steps: soaking the hydrophobically treated functionalized woven fabric in a single-stranded oligo solution of 5'-end modified dibenzocyclooctyne to combine them and obtain the woven DNA synthesis stationary phase.
7. The preparation method according to claim 6, characterized in that: The concentration of the single-stranded oligo solution modified with dibenzocyclooctyne at the 5' end is 1-10 μM; The volume of the single-stranded oligo solution with 5'-end modified dibenzocyclooctyne is 1-200 μL; The soaking temperature is 25-100°C; The soaking time is 0.5-5 h.
8. The preparation method according to claim 1, characterized in that: Before the plasma treatment of the woven fabric, there is a step of cleaning and drying the woven fabric; After the hydrophobic treatment in step (2), there are steps of washing with water and drying.
9. The braided DNA synthesis stationary phase prepared by the preparation method according to any one of claims 1 to 8.
10. Use of the braided DNA synthesis stationary phase according to claim 9 in enzymatic DNA synthesis.
Citation Information
Patent Citations
Preparation method of chip for synthesizing DNA (deoxyribonucleic acid), application of chip and DNA synthesis method
CN115591591A
Polymer stationary phase carrier for DNA synthesis as well as preparation method and application of polymer stationary phase carrier
CN119463265A
Stationary phase for DNA synthesis as well as preparation method and application of stationary phase
CN119661617A
Recyclable biochip stationary phase as well as preparation method and application thereof
CN119838653A
Universal biochip as well as preparation method and application thereof
CN119869636A