Recombinant protein, DNA fragment, expression vector, preparation method of transgenic lettuce and oral hypoglycemic drug

Abstract

The invention discloses a recombinant protein, a DNA fragment, an expression vector, a preparation method of transgenic lettuce and an oral hypoglycemic drug, and relates to the technical field of biological medicines, and the amino acid sequence of the recombinant protein is as shown in SEQ ID NO: 1. The recombinant protein provided by the invention, namely the human transferrin-proinsulin fusion protein, can mediate endocytosis transport of proinsulin by utilizing the natural binding action of a human transferrin-transferrin receptor after being orally taken, and penetrates through the intestinal tract to enter a blood system, so that the blood sugar is reduced. Animal experiments show that the effect of the recombinant protein provided by the invention is close to that of natural insulin, and the recombinant protein provided by the invention realizes oral delivery of insulin.

Description

Technical Field

[0001] The present invention relates to the field of biological medicine technology, and particularly to the preparation methods of recombinant proteins, DNA fragments, expression vectors, transgenic lettuce, and oral hypoglycemic drugs. Background Art

[0002] Diabetes is a silent epidemic that poses a great threat to human health. Currently, insulin administration to diabetic patients is an effective treatment option. And significant progress has been made in the administration methods of insulin, including syringes, pumps, pens, artificial pancreases, skin patches, and inhalers, etc. Although the use of insulin pens continues to increase worldwide, syringes are still the first choice (83.1%) in low-income countries. However, the injection method has many disadvantages, including local pain, injection site infection, inflexibility, causing hypoglycemia, discomfort, irritation, and economic burden, etc.

[0003] Therefore, if oral delivery of insulin can be achieved, it will be of great significance. Summary of the Invention

[0004] Based on the deficiencies of the above-mentioned prior art, the purpose of the present invention is to provide the preparation methods of recombinant proteins, DNA fragments, expression vectors, transgenic lettuce, and oral hypoglycemic drugs, aiming to provide a hypoglycemic drug that can be delivered orally to solve problems such as pain and discomfort caused by patients' insulin uptake through injection methods.

[0005] The technical solution of the present invention is as follows:

[0006] In the first aspect of the present invention, a recombinant protein is provided, wherein the amino acid sequence of the recombinant protein is as shown in SEQ ID NO: 1.

[0007] In the second aspect of the present invention, a DNA fragment is provided, wherein the DNA fragment contains a nucleotide sequence encoding the recombinant protein as described above in the present invention.

[0008] Optionally, the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0009] In the third aspect of the present invention, an expression vector is provided, wherein the expression vector includes a vector and the DNA fragment as described above in the present invention contained in the vector.

[0010] Optionally, the vector is a lettuce chloroplast.

[0011] In the fourth aspect of the present invention, a preparation method of transgenic lettuce expressing the recombinant protein as described above in the present invention is provided, wherein based on the lettuce chloroplast genetic transformation method, it includes the following steps:

[0012] By means of homologous recombination, a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 4 was introduced into the MoChlo plasmid to obtain the vector ChlMF-tf347-H4-ins;

[0013] The vector ChlMF-tf347-H4-ins was transferred into lettuce chloroplasts, and after screening, transgenic lettuce expressing the recombinant protein was obtained.

[0014] In the fifth aspect of the present invention, a method for preparing transgenic lettuce expressing the recombinant protein as described above in the present invention is provided. Based on the lettuce chloroplast genetic transformation method, it includes the following steps:

[0015] The DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 4 was amplified by PCR and then transformed into lettuce chloroplasts. After screening, transgenic lettuce expressing the recombinant protein without a resistance gene was obtained.

[0016] In the sixth aspect of the present invention, an oral hypoglycemic drug is provided, which includes the recombinant protein as described above in the present invention.

[0017] Optionally, the oral hypoglycemic drug further includes a pharmaceutically acceptable carrier.

[0018] In the seventh aspect of the present invention, an oral hypoglycemic drug is provided. The oral hypoglycemic drug is a plant-derived oral hypoglycemic drug, which is prepared by freeze-drying and grinding into powder the transgenic lettuce prepared by the preparation method as described above in the present invention, or is prepared by freeze-drying and grinding into powder the transgenic lettuce prepared by the preparation method as described above in the present invention and then mixing it with a pharmaceutically acceptable carrier.

[0019] Beneficial effects: The recombinant protein provided by the present invention, namely the human transferrin-proinsulin fusion protein, can utilize the natural binding effect of human transferrin-transferrin receptor to mediate the endocytic transport of proinsulin after oral administration, cross the intestine and enter the blood system to lower blood sugar. And according to animal experiments, the effect of the recombinant protein provided by the present invention is close to that of natural insulin. The recombinant protein provided by the present invention realizes the oral delivery of insulin, effectively solving the problems of pain and discomfort caused by patients' ingestion of insulin by injection. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the design of the fragment LsLH-LsRH and the mechanism diagram of lettuce chloroplast genetic transformation in the present invention, where (a) is the schematic diagram of the fragment LsLH-LsRH, (b) is the schematic diagram of knocking out the aadA resistance gene, and (c) is the schematic diagram of the remaining fragment after knocking out the aadA resistance gene.

[0021] Figure 2 Among them, (a) is the nucleic acid band diagram of 16 seedlings derived from the vector ChlMF-tf347-H4-ins in Example 3, and (b) is the nucleic acid band diagram of 16 seedlings derived from the PCR fragment LsLH-LsRH in Example 3.

[0022] Figure 3 It is the result diagram of whether the aadA resistance gene expression cassette is knocked out in 8 seedlings obtained after screening the plants derived from the PCR fragment LsLH-LsRH in Example 3.

[0023] Figure 4 It is the expression result diagram of the recombinant protein tf347-H4-ins in Example 5.

[0024] Figure 5 It is the schematic diagram of the process of establishing a diabetic mouse model and treatment in Example 6.

[0025] Figure 6 It is the in vivo verification result diagram of the therapeutic effect of orally administered recombinant protein tf347-H4-ins in Example 6. Detailed implementation manners

[0026] The present invention provides a recombinant protein, a DNA fragment, an expression vector, a preparation method of transgenic lettuce, and an oral hypoglycemic drug. To make the purpose, technical solution and effect of the present invention clearer and more definite, the present invention is further described in detail below. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0027] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the specification of the present invention are only for the purpose of describing specific implementation manners and are not intended to limit the present invention.

[0028] If there are descriptions involving "first", "second", etc. in the embodiments of the present invention, such descriptions of "first", "second", etc. are only for descriptive purposes and cannot be understood as indicating or implying their relative importance or implicitly indicating the quantity of the indicated technical features.

[0029] The embodiments of the present invention provide a recombinant protein, wherein the amino acid sequence of the recombinant protein is as shown in SEQ ID NO: 1.

[0030] In the embodiments of the present invention, the amino acids 1-347 of human transferrin (tf347), a long helical linker sequence H4-2, and human insulin precursor (i.e., human proinsulin, also known as proinsulin; in order to be modified into active insulin in vivo, 4 amino acids were replaced on the basis of the human insulin precursor shown in Genbank NP_000198.1, generating 2 Furin cleavage sites) were fused and expressed to obtain a recombinant protein with the amino acid sequence shown in SEQ ID NO: 1 (which can also be referred to as recombinant protein tf347-H4-ins, see the example section).

[0031] The recombinant protein provided by the present invention, namely human transferrin-proinsulin fusion protein, after oral administration, can utilize the natural binding effect of human transferrin-transferrin receptor to mediate the endocytic transport of proinsulin, cross the intestine and enter the bloodstream to lower blood sugar. That is to say, the tf347 part of the recombinant protein can bind to the transferrin receptor (TfR) in the intestine, and through endocytic transport, mediate human proinsulin to cross the intestinal epithelial cells and enter the bloodstream, achieving the effect of oral delivery of insulin. And according to animal experiments, the effect of the recombinant protein provided by the present invention is close to that of natural insulin. The recombinant protein provided by the present invention realizes the oral delivery of insulin, effectively solving the problems of pain, discomfort, etc. caused by patients' intake of insulin by injection methods.

[0032] The embodiments of the present invention also provide a DNA fragment, wherein the DNA fragment contains the nucleotide sequence encoding the recombinant protein as described above in the present invention. The recombinant protein encoded by the DNA fragment, after oral administration, can utilize the natural binding effect of human transferrin-transferrin receptor to mediate the endocytic transport of proinsulin, cross the intestine and enter the bloodstream to lower blood sugar. And according to animal experiments, the effect of the recombinant protein provided by the present invention is close to that of natural insulin. The recombinant protein provided by the present invention realizes the oral delivery of insulin.

[0033] In some embodiments, the nucleotide sequence of the DNA fragment is as shown in SEQ ID NO: 2 or SEQ ID NO: 3.

[0034] The embodiments of the present invention also provide an expression vector, wherein the expression vector includes a vector and the DNA fragment as described above in the present invention contained in the vector.

[0035] In some embodiments, the vector is lettuce chloroplast. The existing expression hosts for proteins are human HEK293 cells or tobacco cells, so proteins need to be isolated and purified before oral delivery. The present invention uses lettuce chloroplast as the expression host, and can deliver drugs by direct oral administration, avoiding the cumbersome protein isolation and purification steps and significantly reducing the cost.

[0036] The embodiments of the present invention also provide two methods for preparing transgenic lettuce expressing the recombinant protein as described above. One is a lettuce chloroplast genetic transformation method based on plasmid, and the other is a lettuce chloroplast genetic transformation method based on PCR amplified fragments.

[0037] The lettuce chloroplast genetic transformation method based on plasmid, the method for preparing the transgenic lettuce (which is also a plant chloroplast genetic transformation method for efficiently removing resistance genes) includes the following steps:

[0038] S1. By using the method of homologous recombination, a DNA fragment with the nucleotide sequence shown in SEQ ID NO: 4 is introduced into the MoChlo plasmid to obtain a vector ChlMF-tf347-H4-ins, and its nucleotide sequence is shown in SEQ ID NO: 5;

[0039] S2. The vector ChlMF-tf347-H4-ins is transferred into lettuce chloroplasts, and after screening, transgenic lettuce expressing the recombinant protein is obtained.

[0040] Currently, the main methods for removing antibiotic resistance genes are as follows: 1. Site-specific recombinase. When the aadA gene has a direct repeat of 34bp loxP site in the plastid DNA, the aadA gene can be removed by introducing Cre recombinase into the plastid. The disadvantage of this method is that it is necessary to pre-construct the loxP site in the vector and introduce an exogenous Cre recombinase gene into the chloroplast. 2. Stepwise removal. First, a vector containing a resistance gene is transformed. After successful transformation, a vector without a resistance gene but containing the same homologous arm sequence is used for transformation to replace the previous resistance gene. The disadvantage of this method is that two chloroplast transformations are required, increasing the difficulty and time. 3. Introduction of repeat sequences. Identical repeat sequences are added on both sides of aadA. After transformation, the endogenous homologous recombination mechanism in the chloroplast can perform double exchange between the two ends of the repeat sequences to excise the aadA gene. The excision is a spontaneous process, and its frequency depends on the specific sequence and length of the direct repeat sequences. Although this method is the simplest, the disadvantage is that additional repeat sequences need to be introduced and are still retained in the chloroplast genome after excision, and "scarless" excision cannot be achieved.

[0041] In the embodiments of the present invention, under the condition of not introducing additional repeat sequences, such asFigure 1 As shown, simply adding a fragment (LsLH-3’699bp) contained in LsLH itself at the end of the aadA expression cassette as a repeat sequence can simply and efficiently utilize the repeat sequence-mediated homologous recombination mechanism to remove the resistance gene aadA. After removal, except for the expressed recombinant protein sequence, the genome does not contain any non-genomic sequences, achieving the purpose of "scarless" removal.

[0042] This plasmid-based lettuce chloroplast genetic transformation method requires the purchase of a specific vector, and the plasmid vector also needs to be purified using a DNA extraction kit (this helps to eliminate the influence of bacterial endotoxins on plastid transformation efficiency). In addition, the genetic transformation efficiency of the above plasmid-based lettuce chloroplast genetic transformation method still needs to be further improved.

[0043] Aiming at the problems existing in the above plasmid-based lettuce chloroplast genetic transformation method, the present invention uses PCR amplification of a linearized homologous recombination fragment to prepare transgenic lettuce. The lettuce chloroplast genetic transformation method based on PCR amplification fragments, and the preparation method of transgenic lettuce includes the following steps:

[0044] The DNA fragment with the nucleotide sequence shown in SEQ ID NO: 4 (i.e., the sequence from LsLH to LsRH as shown in (a) in Figure 1 ) is amplified by PCR (polymerase chain reaction) and then transformed into lettuce chloroplasts (specifically, it can be transformed into lettuce chloroplasts by gene gun). After screening (specifically, it can be screened through three rounds), transgenic lettuce expressing the recombinant protein without the resistance gene (aadA) is obtained.

[0045] In the present invention, the design of the DNA fragment with the nucleotide sequence shown in SEQ ID NO: 4 uses the 16srRNA / trnV site of the lettuce chloroplast genome as the insertion site, significantly improving the genetic transformation efficiency. Further, the examples of the present invention use PCR amplification fragments to replace plasmid DNA for chloroplast genetic transformation. Under the condition of not introducing additional repeat sequences, the transformation efficiency is 5.33 times that of the above plasmid-based method. In addition, as shown in (a) in Figure 1 , the present invention only needs to add a fragment (LsLH-3’699bp) contained in LsLH itself at the end of the aadA expression cassette as a repeat sequence, and can simply and efficiently utilize the repeat sequence-mediated homologous recombination mechanism to remove the resistance gene aadA (as shown in (b) in Figure 1 ) to obtain the sequence after removing the resistance gene aadA (as shown in Figure 1as shown in (c) therein). After removing the resistance gene, the genome contains no non-genomic sequences except for the expressed recombinant protein sequence, achieving the purpose of "scarless" removal. Moreover, this design greatly improves the efficiency of resistance gene removal, reaching 62.5% after one round of transformation / screening. The transgenic lettuce with the resistance gene aadA removed has normal expression function and can successfully express the recombinant protein. Moreover, by adding one copy of the promoter LsPpsbA, a 2xLsPpsbA promoter was constructed, significantly increasing the expression level of the recombinant protein.

[0046] The embodiment of the present invention also provides an oral hypoglycemic drug, which includes the recombinant protein as described above in the present invention.

[0047] In some embodiments, the oral hypoglycemic drug further includes a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier includes at least one of a glidant, a diluent, a wetting agent, a suspending agent, a solvent, and an emulsifier.

[0048] In some embodiments, the oral hypoglycemic drug further includes an additive, and the additive includes at least one of a preservative, a coloring agent, a flavoring agent, a stabilizer, and an isotonic agent.

[0049] The embodiment of the present invention also provides another oral hypoglycemic drug, wherein the oral hypoglycemic drug is a plant-derived oral hypoglycemic drug, and the oral hypoglycemic drug is prepared by freeze-drying and grinding into powder the transgenic lettuce prepared by the preparation method as described above in the present invention, or is prepared by freeze-drying and grinding into powder the transgenic lettuce prepared by the preparation method as described above in the present invention and then mixing it with a pharmaceutically acceptable carrier.

[0050] The present invention uses lettuce chloroplasts as a host for recombinant protein expression. The obtained transgenic lettuce can deliver drugs by direct oral administration, avoiding the cumbersome protein separation and purification steps and significantly reducing the cost. The oral hypoglycemic drug provided by the present invention can utilize the natural binding effect of human transferrin-transferrin receptor to mediate the endocytosis and transport of proinsulin, cross the intestine and enter the blood system to lower blood sugar.

[0051] The present invention will be further described below through specific examples.

[0052] In the following examples, the RMOP medium (1 L) contains the following components: 4.33 g of MS salts (Murashige and Skoog), 100 mg of inositol, 1 mg of thiamine hydrochloride, 1 mg of 6-benzyladenine (BAP), 0.1 mg of 1-naphthaleneacetic acid (NAA), 30 g of sucrose, and 6 g of plant agar, with a pH of 5.8. The RMOP medium may or may not contain spectinomycin. When no description of the RMOP medium is given in the following examples, it does not contain spectinomycin. When it is specifically stated that it contains spectinomycin, the RMOP medium contains spectinomycin.

[0053] The MS medium contains the following components: 4.33 g of MS salts (Murashige and Skoog), 30 g of sucrose, and 6 g of plant agar, with a pH of 5.8.

[0054] In the following examples, the meanings of some symbols are as follows:

[0055] v / v: volume-to-volume ratio;

[0056] w / v: mass-to-volume ratio;

[0057] mM: that is, mmol / L;

[0058] PBS: phosphate buffer solution.

[0059] Construction of Fragment LsLH-LsRH and Vector ChlMF-tf347-H4-ins in Example 1

[0060] (1) As shown in (a) of Figure 1 , the 8476-bp fragment from LsLH to LsRH (i.e., LsLH-5’LsLH-3’LsPrbclaadA LsTpsbA LsLH-3’2xLsPpsbA tf347 H4-2 proinsulin Trbcl LsRH) is denoted as fragment LsLH-LsRH. The nucleotide sequence of fragment LsLH-LsRH is as shown in SEQ ID NO: 4, which contains a gene fragment encoding the amino acid sequence shown in SEQ ID NO: 1;

[0061] The nucleotide sequence of chloroplast genome-LsLH-5’LsLH-3’LsPrbcl aadA LsTpsbA LsLH-3’2xLsPpsbAtf347 H4-2proinsulin Trbcl LsRH-chloroplast genome is as shown in SEQ ID NO: 6 (the genomic sequences at both ends are only partial truncations of the lettuce chloroplast genome).

[0062] The construction process of fragment LsLH-LsRH is as follows:

[0063] Using the 16s rRNA / trnV locus of the lettuce (Lactuca sativa) chloroplast genome (Genbank: AP007232.1) as the insertion site, fragments of 1928 bp upstream (nucleotide positions: 98,041 - 99,968) and 2010 bp downstream (nucleotide positions: 99,969 - 101,978) were selected as the upstream and downstream homologous arm fragments LsLH and LsRH, respectively.

[0064] The repeat sequence LsLH-3’ required for removing the resistance gene is a 699-bp nucleotide fragment from the 3’ end of the fragment LsLH.

[0065] The fragment LsPrbcl is derived from this lettuce chloroplast genome, and its nucleotide sequence is the nucleotide sequence corresponding to nucleotide positions 54588 - 55063 of the lettuce chloroplast genome.

[0066] LsTpsbA is derived from this lettuce chloroplast genome, and its nucleotide sequence is the nucleotide sequence corresponding to nucleotide positions 173 - 478 of the lettuce chloroplast genome.

[0067] LsPpsbA is derived from this lettuce chloroplast genome, and its nucleotide sequence is the nucleotide sequence corresponding to nucleotide positions 1541 - 1765 of the lettuce chloroplast genome. In this example, a 2xLsPpsbA promoter was constructed by adding one copy of the promoter LsPpsbA.

[0068] LsTrbcl is derived from this lettuce chloroplast genome, and its nucleotide sequence is the nucleotide sequence corresponding to nucleotide positions 56498 - 56759 of the lettuce chloroplast genome.

[0069] The amino acid sequence encoded by the fragment tf347 is the amino acid sequence corresponding to positions 1 - 347 of human transferrin (Genbank: NP_001054.2).

[0070] The amino acid sequence encoded by the fragment Proinsulin is a sequence that replaces 4 amino acids on the basis of human preproinsulin (Genbank NP_000198.1) and generates 2 Furin cleavage sites.

[0071] The 8476-bp gene fragment from LsLH to LsRH, that is, the fragment LsLH-LsRH, was synthesized by Shanghai Langjing Biotechnology Co., Ltd.

[0072] (2) Construct the vector ChlMF-tf347-H4-ins

[0073] Using the method of homologous recombination, the above fragment LsLH-LsRH (i.e., the 8476 bp gene fragment from LsLH to LsRH) was used to replace the fragments of trnI and trnA in the MoChlo vector (purchased from https: / / www.addgene.org / , Kit#1000000156) respectively, to obtain the vector ChlMF-tf347-H4-ins (its nucleotide sequence is shown in SEQ ID NO: 5).

[0074] (3) Obtain the fragment LsLH-LsRH by PCR method (denoted as PCR fragment LsLH-LsRH)

[0075] Using the above fragment LsLH-LsRH synthesized by Shanghai Langjing Biotechnology Co., Ltd. as the DNA template, and using primers Clone-F (its nucleotide sequence is shown in SEQ ID NO: 7, specifically ggaaaagttgacagataagtcaccct) and Clone-R (its nucleotide sequence is shown in SEQ ID NO: 8, specifically gtcgtgcgagcccccc), the entire fragment LsLH-LsRH for genetic transformation (denoted as PCR fragment LsLH-LsRH) was obtained by PCR method.

[0076] The PCR reaction system is as follows:

[0077] 1 μL DNA template, 1 μL primer clone-F, 1 μL primer clone-R, 10 μL 2xOne Shot LA PCR Mix (purchased from TaKaRa Company, containing DNA polymerase) and 7 μL H2O.

[0078] The PCR reaction conditions are as follows:

[0079] Pre-denaturation at 95°C for 5 min;

[0080] Denaturation at 95°C for 30 s;

[0081] Annealing at 60°C for 30 s;

[0082] Extension at 72°C for 5 min;

[0083] A total of 35 cycles.

[0084] Example 2 Genetic transformation of lettuce chloroplasts mediated by gene gun

[0085] In this embodiment, two methods are used for the genetic transformation of lettuce chloroplasts. One is the genetic transformation method of chloroplasts based on plasmid DNA, using the vector ChlMF-tf347-H4-ins constructed in Example 1; the other is the genetic transformation method of chloroplasts based on PCR amplified fragments, using the PCR fragment LsLH-LsRH in Example 1. The specific steps are as follows:

[0086] (1) Put about 100 lettuce seeds (Simpson Elite) into a 1.5 mL Eppendorf tube, and wash them with 1 mL of 75% (v / v) ethanol solution for 30 s to remove any greasy substances.

[0087] (2) Add 1 mL of commercially available bleach diluted with water to the above Eppendorf tube, specifically containing 1.5% (v / v) sodium hypochlorite and 0.1% (v / v) Tween 20. Incubate for 10 minutes and mix gently by inverting the Eppendorf tube.

[0088] (3) Wash the seeds 5 times with 1 mL of sterile deionized water to remove the commercially available bleach.

[0089] (4) Take 40 treated lettuce seeds and inoculate them in MS medium, place them in an incubator at 26 °C, under white fluorescent lamps (1900 lux), and perform cyclic growth with 16 h of light / 8 h of darkness (that is, 16 h of light, then 8 h of darkness, then 16 h of light, then 8 h of darkness, and so on), and cycle for 7 - 10 days.

[0090] (5) Transfer a single germinated seedling to a plant culture box containing MS medium and store it in the incubator for 4 - 7 weeks.

[0091] (6) Harvest the leaves at the 5 - 7 leaf stage of plant growth. Place a 70 mm high-pressure Whatman round filter disc on the RMOP medium in a petri dish. Place the leaf on the filter disc with its front side facing the medium.

[0092] (7) Add 10 μmol of ChlMF-tf347-H4-ins plasmid DNA (i.e., the vector ChlMF-tf347-H4-ins), 50 μg of gold powder particles, 10 μL of a calcium chloride solution with a concentration of 2.5 M, and 20 μL of a spermidine solution with a concentration of 0.1 M onto a sterile rupture membrane and let it dry in a laminar flow hood. Operate according to the manufacturer's instructions and use the standard particle bombardment method (also known as the gene gun method) for DNA delivery. This method is the genetic transformation method of chloroplasts based on plasmid DNA.

[0093] Meanwhile, 10 μmol of the PCR fragment LsLH-LsRH, 50 μg of gold particle, 10 μL of calcium chloride solution with a concentration of 2.5 M, and 20 μL of spermidine solution with a concentration of 0.1 M were added onto a sterile rupture membrane and allowed to dry in a laminar flow hood. According to the manufacturer's instructions, the standard particle bombardment method was used for DNA delivery, and this method is a chloroplast genetic transformation method based on the PCR amplified fragment.

[0094] (8) After placing in the dark for 2 days, the bombarded leaves were cut into fragments of 5 mm 2 and placed on the RMOP medium (containing 50 mg / mL of spectinomycin) such that the bombarded side was in contact with the medium. The petri dish was sealed with plastic wrap for the first round of selection.

[0095] Example 3 Screening and Identification of Positive Plants and Positive Resistance Gene Knockout Plants

[0096] 50 mg / mL of spectinomycin was used to effectively select the transformants of lettuce. The antibiotic was added when the medium cooled to 45 - 50 °C.

[0097] Before the second round of screening, 100 mg of leaf material was harvested from the putative positive seedlings. DNA was isolated using the DNeasy Plant Mini kit according to the manufacturer's instructions. Generally, 20 - 30 μg of DNA was obtained in this process.

[0098] Two separate 50 μL PCR reactions were carried out in two 0.2 mL PCR tubes respectively. Primer PCR-F (whose nucleotide sequence is as shown in SEQ ID NO: 9, specifically TTCCCTGGATCGAGACAGGTATC) and primer PCR-R (whose nucleotide sequence is as shown in SEQ ID NO: 10, specifically aatccgaactgaggacgggt) were used to check whether the target gene expression cassette was integrated into the chloroplast genome in the two methods in Example 2. Meanwhile, the leaf DNA of untransformed wild-type lettuce was detected in a separate PCR tube as a negative control. 5 μL of the PCR product was detected by agarose gel electrophoresis. The amplified PCR product was observed by ethidium bromide staining. The plants confirmed by PCR to be able to carry out transgenic integration would undergo the second and third rounds of selection.

[0099] Sixteen seedlings each from the vector ChlMF-tf347-H4-ins and from the PCR fragment LsLH-LsRH that were preliminarily screened out were subjected to molecular identification by transgenic specific primers PCR-F and PCR-R. The PCR results are as Figure 2 shown. It can be seen that among the 16 seedlings from the vector ChlMF-tf347-H4-ins, only 3 were positive (asFigure 2 as shown in (a) of Figure 2 ), and all 16 seedlings derived from the PCR fragment LsLH-LsRH were positive (as shown in (b) of

[0100] ). The transformation efficiency using the PCR fragment LsLH-LsRH method was much higher than that using the plasmid DNA method (the transformation efficiency was 5.33 times that of the plasmid DNA method).

[0101] The positive plants derived from the PCR fragment LsLH-LsRH (denoted as PCR positive plants) were used for the second and third rounds of screening. 2 Second round of screening: Cut 2-mm

[0102] leaf blades from the PCR positive plants and place them on the RMOP medium (containing 50 mg / mL spectinomycin). Place them in an incubator at 26 °C, under white fluorescent lamps (1900 lux), with a light / dark cycle of 16 h / 8 h. Transgenic shoots will be produced from the leaf blades within 3-4 weeks.

[0103] As a result, Figure 3 as shown, 5 out of 8 seedlings of the PCR positive plants successfully knocked out the aadA resistance gene expression cassette (the corresponding result for successful knockout was 2466 bp, and the corresponding result for unsuccessful knockout was 4793 bp), and the knockout rate of the resistance gene reached 62.5%. The 5 plants that successfully knocked out the aadA resistance gene expression cassette were the positive resistance gene knockout plants.

[0104] Example 4 Growth and Cultivation of Positive Plants

[0105] Take the PCR positive plants with roots obtained in Example 3 (specifically as Figure 3As shown in the figure, wash thoroughly with water to remove the plant mixture or agar (make sure to remove all the plant mixture or agar, otherwise the plants may be infected with fungal diseases and eventually die). Soak the jiffy pellet growing medium (http: / / www.jiffypot.com / ) in water for 20 minutes. Transfer the plants to a small container containing jiffy pellets, add enough water to cover the surface, and cover with a plastic bag to maintain humidity. Keep at 26 °C in a growth chamber with 16 hours of light at 1900 lux per day and 8 hours of darkness. After 4 days, make a small hole in the plastic bag for air exchange. After another 3 days, remove the bag. After removing the bag, grow the plants in the growth chamber for one week, watering once every 2 days. Transfer the soil block containing the plants to a flower pot with soil in the greenhouse. Water the plants every 2 days and add water-soluble all-purpose plant feed once a week according to the manufacturer's instructions. After 5 weeks, collect healthy leaves for identification of transgenic proteins.

[0106] When the flower heads appear, cover the flower heads with waterproof paper bags (the moisture in the pods will increase the risk of fungal infection), and firmly tie the mouth of the waterproof paper bag to the stem below the flower branch with a string or rubber band. When the seed pods are mature, remove the bags, collect the seed pods, and dry them in a desiccator to obtain seeds. These seeds can be further used for growing transgenic lettuce. The seeds can be stored in a sealed Eppendorf tube at 24 - 26 °C for 2 - 3 years, and can be stored for a longer time at 4 °C or 70 °C.

[0107] Example 5 Extraction of total soluble proteins and Western blot detection of expression

[0108] (1) Extraction of total soluble proteins

[0109] Collect green and healthy leaves from genetically transformed and untransformed lettuce grown in the greenhouse (i.e., the former are the lettuce leaves obtained in Example 4 and the latter are wild-type lettuce leaves). Wash the soil and debris off the leaves and cut off the midrib part. Grind the leaf material into a fine powder in liquid nitrogen. Add 200 μL of freshly prepared plant protein extraction buffer (100 mM sodium chloride, 200 mM Tris-HCL pH 8.0, 14 mM β-mercaptoethanol, 200 mM sucrose, 0.05% (v / v) Tween-20, 0.2% (w / v) sodium dodecyl sulfate) to two powdered plant samples (100 mg of powder for each sample) respectively. Spin the homogenized samples at 15000 g for 10 minutes at 4 °C and save the supernatant (containing soluble proteins).

[0110] (2) Confirmation of transgenic expression by Western blot analysis

[0111] The supernatants in different amounts (such as 100 mg, 10 mg, and 1 mg) prepared in the previous step were diluted with an equal volume (by volume) of sample buffer and boiled for 4 - 20 min. The samples (including the unboiled control samples) were loaded into the wells of a 12% (w / v) sodium dodecyl sulfate - polyacrylamide gel. Proteins were separated by electrophoresis. The initial current was set at 85 V in 1x electrode buffer until the proteins migrated into the resolving gel, then the current was increased to 110 V and electrophoresis was carried out until the dye reached the bottom of the gel. Using a semi - dry transfer apparatus, the separated proteins were transferred onto a nitrocellulose or polyvinylidene difluoride (PVDF) membrane, and transferred at 120 V for about 2 h. Before use, the PVDF membrane was pre - wetted in methanol for 15 s, then soaked in water for 2 min, and then equilibrated in transfer buffer for 5 min. After transfer, it was soaked in a sufficient volume of PBS - T (obtained by adding 0.1% v / v Tween - 20 to PBS), completely covering the membrane at room temperature (25 °C) for 5 min. Pour out the PBS - T. To block non - specific binding, gently shake the membrane in PTM (PBS - T added with 3% w / v non - fat dry milk) at room temperature for 1 h to completely cover the membrane. Pour out the PTM. When detecting total protein, completely cover the membrane with the primary antibody (R&D system, MAB13361) diluted with PTM (the dilution ratio depends on the antibody titer). Incubate the membrane and the primary antibody solution with gentle shaking at room temperature for 2 h (or overnight at 4 °C). Wash the membrane once with 1x PBS - T at room temperature for 5 min, then add the appropriately diluted secondary antibody (R&D system, VC002) in PTM. Incubate with gentle shaking for 1.5 h. Wash the membrane 3 times with PBS - T, 15 min each time, and wash the membrane once with 1 - inch PBS for 10 min. Add the chemiluminescent substrate (ECL), and incubate with gentle shaking at room temperature for 5 min. Generate chemiluminescent signals by exposing the membrane to x - ray film. The initial exposure time is 1 min; according to the signals obtained, the subsequent exposure time can be extended to 30 min.

[0112] The results are as Figure 4 shown, the negative and positive controls were wild - type lettuce (WT) and recombinant human pro - insulin (Proinsulin, R&D system, 1336 - PN) respectively. The recombinant protein tf347 - H4 - ins was expressed in all Figure 3 8 independent positive plants shown (3 plants without the knocked - out aadA resistance gene and 5 plants with the knocked - out aadA resistance gene), with an expression rate of 100%. The highest expression level reached 19.88 mg / gDW. At the same time, it can also indicate that the transgenic lettuce plants with the knocked - out resistance gene aadA have normal expression functions and can successfully express the recombinant protein tf347 - H4 - ins. The molecular weight of the recombinant protein tf347 - H4 - ins is 51.3 KDa.

[0113] The identified lettuce leaves containing the recombinant protein tf347-H4-ins were harvested, freeze-dried, ground, and made into dry freeze-dried plant powder, which was mixed with PBS buffer in a certain proportion to form a suspension preparation for downstream animal experiments.

[0114] Example 6 In Vivo Verification of the Therapeutic Effect of Oral Recombinant Protein tf347-H4-ins

[0115] C57BL / 6 mice at 12 weeks of age were purchased from the Animal Experiment Research Center of Zhejiang Chinese Medical University. After fasting overnight, as Figure 5 shown, streptozotocin (STZ) citrate buffer (50 μg of STZ per gram of mouse) was intraperitoneally injected daily for 5 consecutive days to induce diabetes. Two weeks after the last STZ injection (i.e., the 19th day of the experiment), the blood glucose level was measured (OneTouch Ultra2Meter kit), and animals with a blood glucose level ≥ 300 mg / dL were included in the study.

[0116] The diabetic mice were randomly divided into three groups: PBS (negative control) group, tf347-H4-ins group, and commercially available insulin (positive control) group, with 6 mice in each group (3 males and 3 females). All animals were fasted overnight before the experiment.

[0117] In addition, 6 healthy C57BL / 6 mice at 12 weeks of age (3 males and 3 females) were taken as the healthy group.

[0118] The administration methods are as follows:

[0119] tf347-H4-ins group: The freeze-dried plant powder containing 171.6 μg of the recombinant protein tf347-H4-ins (20 mg, obtained by freeze-drying and grinding the positive resistance gene knockout plants in Example 3 into powder) was rehydrated in PBS (pH 7.4) to a final volume of 200 μL for each gavage, and administered with a 20-gauge gavage needle. 30 minutes before gavage, the plant powder suspension was gently stirred evenly in PBS.

[0120] Negative control group: The mice were intraperitoneally injected with 100 μL of sterile PBS for gavage.

[0121] Positive control group: The mice were intraperitoneally injected with 100 μL of commercially available insulin (0.04 U / kg body weight).

[0122] Healthy group: No drug was given.

[0123] All mice were intraperitoneally injected with 100 μL of glucose solution (2 g of glucose / kg body weight) 60 min after the administration was completed.

[0124] Thirty minutes later, as the starting point for blood glucose monitoring (0 min), the blood glucose levels were measured by the tail vein bleeding method at 0 min, 30 min, 60 min, 90 min, 120 min, 150 min, and 210 min, and each animal was measured 3 times.

[0125] The results are as Figure 6 shown. It can be seen that the freeze-dried plant powder containing the recombinant protein tf347-H4-ins has good hypoglycemic effects, and the effects are close to those of natural insulin and can be used to treat diabetes.

[0126] In summary, the recombinant protein provided by the present invention can be delivered orally for hypoglycemic treatment. The present invention selects the more optimal integration site 16s rRNA / trnV in the lettuce chloroplast genome and utilizes the homologous sequences of about 2 Kb each upstream and downstream (LsLH 1928 bp and LsRH 2010 bp), significantly improving the genetic transformation efficiency; the present invention uses the PCR method to obtain a total of 16 seedlings positive for PCR detection, which is 5.33 times that of the 3 positive seedlings obtained by the traditional plasmid DNA method. Under the condition of not introducing additional repetitive sequences, the present invention only needs to add a fragment (LsLH-3’ 699 bp) contained in LsLH itself at the end of the aadA expression cassette as a repetitive sequence, and can simply and efficiently utilize the repetitive sequence-mediated chloroplast homologous recombination mechanism to remove the resistance gene aadA expression cassette. Currently, the most convenient technology for removing the resistance gene mainly introduces two completely identical non-coding repetitive sequences on both sides of the aadA gene expression cassette, and then the natural homologous recombination mechanism of chloroplasts can remove the resistance gene expression cassette between the two ends of the repetitive sequences with a relatively low probability (generally <1%). However, due to the natural limitation of the homologous recombination mechanism, one copy of the repetitive sequence will still be retained after removal, leaving a "trace" on the genome. However, after the removal in the present invention, in addition to the expressed recombinant protein sequence, the genome does not contain any non-genomic sequences, achieving the purpose of "trace-free" removal. Moreover, the present invention greatly improves the efficiency of removing the resistance gene, and after one transformation + screening, the knockout rate of the resistance gene reaches 62.5% and the expression rate of the target protein reaches 100%.

[0127] In the present invention, the transgenic lettuce plants from which the resistance gene aadA has been removed have normal expression functions and can successfully express the recombinant protein. Moreover, the present invention constructs a 2xLsPpsbA promoter by adding 1 copy of the promoter LsPpsbA, significantly increasing the expression level of the recombinant protein. Referring to the previous research results, the maximum expression level of CTB-proinsulin in chloroplasts is about 12 mg / g DW. The expression level of the recombinant protein tf347-H4-ins in the present invention reaches 19.88 mg / g DW, which is 1.65 times that of the former.

[0128] It should be understood that the application of the present invention is not limited to the above examples. For those of ordinary skill in the art, improvements or modifications can be made according to the above description, and all such improvements and modifications shall fall within the protection scope of the appended claims of the present invention.

Claims

1. A recombinant protein, characterized in that The amino acid sequence of the recombinant protein is shown in SEQ ID NO:

1.

2. A DNA fragment, characterized in that: The DNA fragment comprises a nucleotide sequence encoding the recombinant protein according to claim 1.

3. The DNA fragment according to claim 2, characterized in that The nucleotide sequence of the DNA fragment is shown in SEQ ID NO: 2 or SEQ ID NO:

3.

4. An expression vector, characterized in that: The expression vector comprises a vector and the DNA fragment according to claim 2 or 3 contained in the vector.

5. The expression vector according to claim 4, characterized in that The carrier is lettuce chloroplast.

6. A method for preparing transgenic lettuce expressing the recombinant protein of claim 1, characterized in that: The method for genetic transformation of lettuce chloroplasts includes the following steps: By homologous recombination, the DNA fragment with the nucleotide sequence shown in SEQ ID NO: 4 was introduced into the MoChlo plasmid to obtain the vector ChlMF-tf347-H4-ins; The vector ChlMF-tf347-H4-ins is transferred into the chloroplast of lettuce, and after screening, a transgenic lettuce expressing the recombinant protein is obtained.

7. A method for preparing transgenic lettuce expressing the recombinant protein of claim 1, characterized in that: The method for genetic transformation of lettuce chloroplasts includes the following steps: The DNA fragment with the nucleotide sequence shown in SEQ ID NO: 4 is amplified by PCR and then transformed into the chloroplast of lettuce. After screening, the transgenic lettuce expressing the recombinant protein and not containing the resistance gene is obtained.

8. An oral hypoglycemic drug, characterized in that: Comprising the recombinant protein according to claim 1.

9. The oral hypoglycemic drug according to claim 8, characterized in that: The oral hypoglycemic drug also includes a pharmaceutically acceptable carrier.

10. An oral hypoglycemic drug, characterized in that: The oral hypoglycemic drug is a plant-based oral hypoglycemic drug, which is prepared by freeze-drying and grinding the transgenic lettuce prepared by the preparation method described in any one of claims 6-7 into powder, or by freeze-drying and grinding the transgenic lettuce prepared by the preparation method described in any one of claims 6-7 into powder and mixing it with a pharmaceutically acceptable carrier.

Images