Application of dsRNA of targeting sphingolipid C-4 hydroxylase coding gene

Abstract

The invention belongs to the technical field of RNA biological prevention and treatment, and particularly relates to application of dsRNA of a targeting sphingolipid C-4 hydroxylase coding gene. The invention provides application of targeted sphingolipid C-4 hydroxylase coding gene dsRNA in prevention and treatment of crop anthracnose and / or preparation of products for prevention and treatment of crop anthracnose, and the targeted sphingolipid C-4 hydroxylase coding gene dsRNA is obtained by transcription of partial sequence of a sphingolipid synthetase coding gene CsSUR2. The targeting sphingolipid C-4 hydroxylase coding gene dsRNA is loaded on the nano layered double hydroxide, so that the pathogenicity of colletotrichum gloeosporioides and mango colletotrichum gloeosporioides can be obviously reduced, and the application prospect of preventing crop anthracnose is achieved.

Description

Technical Field

[0001] The present invention belongs to the technical field of RNA biological control, and specifically relates to the application of dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase. Background Art

[0002] Fungi of the genus Colletotrichum genus are widely recognized as one of the top ten most important fungal phytopathogens globally. Anthracnose caused by them causes serious damage to a variety of crops, cash crops, and horticultural plants, resulting in leaf withering, fruit rot, and yield loss. According to statistics, due to the infection of anthracnose bacteria, the quality of exported fruits in tropical, subtropical, and Mediterranean regions has decreased significantly, and the economic loss after fruit harvest can even be as high as over 60% - 80% annually.

[0003] RNA pesticides are new biological pesticides developed based on RNA interference technology. Their essence is to specifically bind to the mRNA transcribed from specific genes in target organisms, and through the naturally existing RNAi pathway in target organisms, cause the degradation of transcripts or the inhibition of translation, thereby interfering with the normal growth of target organisms and their harm to host plants, and ultimately achieving the purpose of pest control and plant protection. RNA pesticides are defined as biological pesticides. Compared with traditional chemical pesticides, double-stranded RNA pesticides have many advantages. First, dsRNA has strong specificity and high gene silencing ability and does not involve transgenic technology; second, according to the design of the target, dsRNA can inhibit the growth of viruses, bacteria, and fungi, thus playing a control effect on the diseases caused by them; in addition, dsRNA can cross cell membranes and be delivered in vivo; finally, dsRNA is easily degraded in the environment and is an environmentally friendly pesticide. Based on this, RNA pesticides have obvious advantages in pest control: high specificity, good effect, not easy to produce resistance, non-toxic, harmless, and residue-free, and low R & D cost, which is the forefront direction of green prevention and control in agriculture.

[0004] However, the application of RNA pesticides is also accompanied by many challenges. For example, naked dsRNA is easily degraded by enzymes and ultraviolet rays in the environment, resulting in short drug efficacy; the epidermis of pests hinders the absorption of dsRNA, resulting in low delivery efficiency of dsRNA and affecting the target gene silencing effect; the large-scale synthesis of dsRNA is costly, etc. Therefore, how to obtain an RNA pesticide for anthracnose with high efficiency and targeted optimization is an urgent problem to be solved in this field. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase, which can efficiently and targetedly control crop anthracnose.

[0006] The present invention provides the application of dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene; the application includes: preventing and controlling anthracnose of crops and / or preparing a product for preventing and controlling anthracnose of crops; the dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene is transcribed from the target gene segment shown in SEQ ID.No.1; the crops include: rubber trees and / or mangoes.

[0007] Preferably, the nucleotide sequence of the dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene is as shown in SEQ ID.No.2.

[0008] Preferably, the pathogens of the anthracnose include: Colletotrichum siamense and / or Colletotrichum asianum.

[0009] Preferably, the product includes: a preparation containing dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene.

[0010] The present invention provides an LDH-dsCsSUR2 preparation, and the LDH-dsCsSUR2 preparation includes: dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene and nanolayered double hydroxide; The nanolayered double hydroxide is: magnesium / aluminum layered double hydroxide.

[0011] The present invention provides a method for preventing and controlling anthracnose of crops, including the following steps: Applying the dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene shown in SEQ ID.No.2 or the LDH-dsCsSUR2 preparation described in the above technical solution to the crops; The crops include: rubber trees and / or mangoes.

[0012] Preferably, the application method includes: spraying; When the crop to be sprayed is a rubber tree, the spraying part is the leaves of the rubber tree; When the crop to be sprayed is a mango, the spraying part is the mango fruit.

[0013] Beneficial effects: The present invention provides the application of dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene; the application includes: preventing and controlling anthracnose of crops and / or preparing a product for preventing and controlling anthracnose of crops; the dsRNA targeting the sphingolipid C-4 hydroxylase-encoding gene is transcribed from the target gene segment shown in SEQ ID.No.1. This gene segment is the segment of the target gene for preventing and controlling anthracnose of crops and can be used to prevent and control anthracnose of crops or prepare a product for preventing and controlling anthracnose of crops.

[0014] Based on the above technical advantages, the present invention also provides an LDH-dsCsSUR2 preparation. By compounding dsRNA with nanomaterials and using highly virulent anthrax bacteria Colletotrichumsiamense HN08 as the experimental material, first, the segmental dsRNA of the target gene is obtained through in vitro dsRNA synthesis technology, and then it is compounded with the nanomaterial layered double hydroxide (LDH) to obtain a dsRNA nanocomposite for preventing and controlling crops. The dsRNA nanocomposite is sprayed on the leaves of rubber trees or mango fruits, and anthrax bacteria Colletotrichum siamense HN08 is inoculated on the leaves of rubber trees, and Colletotrichum asianu Colletotrichum asianum 02-3 is inoculated on mango fruits. The lesion area is measured to obtain a composition of the target gene dsRNA and nano-LDH that can effectively prevent and control anthracnose of rubber tree leaves and mango fruits, and can efficiently and targetedly prevent and control crop anthracnose. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0016] Figure 1 It is the electrophoresis diagram of the transcription product provided by the present invention; Figure 2 It is the prevention and control effect diagram of rubber anthracnose provided by the present invention; Figure 3 It is the prevention and control effect diagram of mango anthracnose provided by the present invention. DETAILED DESCRIPTION OF THE INVENTION

[0017] In the present invention, unless otherwise specified, the materials, reagents, and equipment used are all conventional selections.

[0018] The present invention provides a segment of the target gene for preventing and controlling crop anthracnose, and the target gene segment is anthrax bacteria CsSUR2The gene target gene segment is selected from the N-terminal sequence of the coding region of the gene, and its nucleotide sequence is as shown in SEQ ID.No.1, specifically: 5’-CTTCCGGCCTACACATTGAGGCCCAAGCCGGAACTCATTCCTGGCATTCCAGACAGCTACCTTAACATCTTCGGCCCGATCGTCGTCTACTGGTGCTTGTCAATGTTCTTCCACCTCATTGACACCTACGACGTCTGGCCCCAGTACCGCCTTCACACCCCCGAGGAGATCACCAAGCGCAACCACGTCTCGCGCTACGAGGTCGCCCGCGATGTCCTGATCCAGCAGCTGATCCAGATCGCCATGTCCGTCTTCCTCGAGGTTATTGACGACGAGCAG-3’.

[0019] The present invention provides dsCsSUR2 for preventing and treating crop anthracnose transcribed from the gene target gene segment of Colletotrichum CsSUR2 The nucleotide sequence of the dsCsSUR2 is as shown in SEQ ID.No.2, specifically: 5’-CUGCUCGUCGUCAAUAACCUCGAGGAAGACGGACAUGGCGAUCUGGAUCAGCUGCUGGAUCAGGACAUCGCGGGCGACCUCGUAGCGCGAGACGUGGUUGCGCUUGGUGAUCUCCUCGGGGGUGUGAAGGCGGUACUGGGGCCAGACGUCGUAGGUGUCAAUGAGGUGGAAGAACAUUGACAAGCACCAGUAGACGACGAUCGGGCCGAAGAUGUUAAGGUAGCUGUCUGGAAUGCCAGGAAUGAGUUCCGGCUUGGGCCUCAAUGUGUAGGCCGGAAG-3’; the dsRNA sequence shown in SEQ ID.No.2 is reverse complementary to the nucleotide shown in SEQID.No.1. In the nucleotide sequence shown in SEQ ID.No.2, T represents U in the sequence listing.

[0020] The layered double hydroxides described in the present invention include magnesium / aluminum layered double hydroxides, zinc / aluminum layered double hydroxides, nickel / iron layered double hydroxides, nickel / aluminum layered double hydroxides. The layered double hydroxides described in the following examples are magnesium / aluminum layered double hydroxides (MgAl-LDH two-dimensional layered double metal hydroxides), purchased from Nanjing Xianfeng Nano Material Technology Co., Ltd.

[0021] To further illustrate the present invention, the solution provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0022] Example 1 1. Preliminary studies have shown that the anthrax sphingolipid C-4 hydroxylase CsSUR2 gene ( CsSUR2 the accession number of the gene on NCBI is PV023913) is an important pathogenic factor of anthrax, and this gene may have the potential to be used as a prevention and control target for anthrax; according to CsSUR2 the gene, a pair of specific primers dsCsSUR2-F (SEQ ID.No.3) and dsCsSUR2-R (SEQ ID.No.4) were designed. Using the DNA of the highly virulent wild-type strain HN08 extracted as a template, a DNA fragment (SEQ ID.No.1) was amplified for subsequent synthesis of dsCsSUR2. The specific primer sequences are shown in Table 1 as follows: Table 1 Primer Information

[0023] 2. Use the T7RNAi Transcription Kit of Nanjing Vazyme Biotech Co., Ltd. to synthesize dsRNA in vitro. T7 RNA ploymerase can recognize the DNA template with the T7 promoter and use four NTPs as substrates to transcribe and synthesize dsCsSUR2 in vitro. The specific method is as follows: a. Prepare the reaction system as shown in Table 2.

[0024] Table 2 Reaction System

[0025] b. React at 37 °C for 6 h in a PCR instrument to obtain the transcription product dsCsSUR2 (SEQ ID.No.2); c. Dilute 100 U / μL RNase T1 to 10 U / μL with RNase T1 Dilution Buffer, and incubate the transcription product to enzymatically digest the excess template DNA and single-stranded RNA. The incubation system is shown in Table 3.

[0026] Note: RNase T1 specifically degrades single-stranded RNA and the 3 G bases at the 5' end. The diluted RNase T1 must be used as soon as possible and is not suitable for storage.

[0027] Table 3 Incubation System

[0028] Note: After mixing the samples, gently pipette to mix well, and briefly centrifuge the reagent to the bottom of the tube.

[0029] d. Incubate at 37 °C for 30 min to obtain pure dsCsSUR2 (SEQ ID.No.2).

[0030] e. Detect the transcription product (i.e., dsCsSUR2 shown in SEQ ID.No.2) by electrophoresis, and the result is as Figure 1 shown (in Figure 1 , a represents the schematic diagram of the position of dsCsSUR2 on the CsSUR2 protein; b represents the electrophoresis pattern of the transcription product. In b, lane M is the DNA DL2000 marker; lane 1 is the electrophoresis result of dsCsSUR2).

[0031] f. Product purification Purify the RNA by the magnetic bead method.

[0032] (1) Take out the RNA Clean Beads from 4 °C and equilibrate at room temperature for 30 min. Please invert or vortex to mix well before use.

[0033] (2) Add 80 μL of the magnetic bead solution to the transcription product, and pipette more than 10 times to mix the solution well.

[0034] (3) Incubate at room temperature for 8 min to allow the RNA to bind to the magnetic beads fully.

[0035] (4) Place the PCR tube on the magnetic rack for about 5 min. After the solution becomes clear, carefully remove the supernatant, and be careful not to disturb the magnetic beads when aspirating the supernatant.

[0036] (5) Keep the PCR tube on the magnetic rack all the time, add 200 μL of freshly prepared 80% ethanol, be careful not to disturb the magnetic beads, incubate at room temperature for 30 sec, and carefully remove the supernatant. Repeat this step once.

[0037] (6) Open the lid and air-dry the magnetic beads for 5 - 10 min. Dry until there is no water shine on the surface of the magnetic beads. Over-drying will affect the elution of RNA.

[0038] (7) Remove the PCR tube from the magnetic rack, add 40 μL of RNase-free H2O, pipette the magnetic beads on the tube wall to blow them down, mix well, and incubate at room temperature for 3 min.

[0039] (8) Place the PCR tube on a magnetic stand. After the solution becomes clear, carefully transfer the supernatant to a new RNase-free EP tube, being careful not to aspirate the magnetic beads. To avoid the influence of magnetic beads on subsequent experiments, leave 1-2 μL of the solution when transferring the product to prevent aspiration of magnetic beads.

[0040] (9) Measure the absorbance at A260 of the product to determine its concentration, and store the purified product (i.e., dsCsSUR2) at -20 °C.

[0041] 3. Preparation of Colletotrichum inoculum: Activate the Colletotrichum gloeosporioides strain HN08 and Colletotrichum mangiferae strain 02-3 in the rubber in the PDA solid medium in the preservation tube. For the activated strains, scrape the fresh mycelium at the edge onto the PDA solid medium and culture at 28 °C for 5 d. Then, take appropriate-sized HN08 and 02-3 fungal cakes for standby.

[0042] 4. Loading dsCsSUR2 onto the nanomaterial layered double hydroxide (LDH) Dissolve the nanomaterial LDH (i.e., magnesium / aluminum layered double hydroxide) in DEPC water to obtain an LDH working solution (50 μg / mL); use the LDH working solution to dilute dsRNA into an LDH-dsRNA mixture (the final concentration of dsRNA in the mixture is 200 ng / μL); place the diluted LDH-dsRNA mixture in a 55 °C water bath and let it stand for 1 min, then quickly transfer it to a high-speed vortex oscillator and oscillate for 2 min, and then let it stand for 2 min. At this time, dsRNA is adsorbed on the surface of LDH to form stable LDH-dsRNA nanoparticles.

[0043] 5. Application of LDH-dsCsSUR2 in the control of rubber anthracnose Conduct preventive tests on Colletotrichum using dsRNA and LDH-dsRNA nanoformulations respectively. The two groups treated with dsRNA (naked dsRNA) are: (1) using water as the control treatment; (2) dsCsSUR2 (diluted with water, the concentration is 200 ng / μL). The two groups sprayed with LDH-dsRNA are: (1) using the blank nanomaterial (50 μg / mL LDH) as the control treatment; (2) using the LDH-dsCsSUR2 nanomaterial treatment.

[0044] Thirty rubber tree leaves in the light green stage of health were processed in each group, and the experiment was repeated 3 times. Wounds were made by acupuncture at symmetric positions on both sides of the leaf veins of each leaf, and 10 μL of dsCsSUR2 and 10 μL of control water, 10 μL of LDH-dsCsSUR2 and 10 μL of control LDH were respectively dropped at the acupuncture points. After 2 days of treatment, a mycelial cake of Colletotrichum gloeosporioides HN08 (a mycelial cake with a diameter of 0.5 cm) was inoculated at the acupuncture points. Three days after inoculation, the lesion areas in each treatment were counted. The results are shown in Figure 2 (in Figure 2 , Figure a shows the phenotype of the leaf lesions after dropping naked dsCsSUR2; Figure b shows the area of the leaf lesions after dropping naked dsCsSUR2; Figure c shows the phenotype of the leaf lesions after spraying LDH-dsCsSUR2; Figure d shows the area of the leaf lesions after spraying LDH-dsCsSUR2).

[0045] Combined with Figure 2 it can be seen that the lesion area of the naked dsRNA treatment decreased by 49.17% compared with the control water treatment; the lesion area of the LDH-dsCsSUR2 treatment decreased by 94.23% compared with the LDH control treatment. This indicates that applying naked dsCsSUR2 or LDH-dsCsSUR2 can effectively reduce the infection of Colletotrichum gloeosporioides on rubber leaves and has a good protective effect, but LDH can improve the control efficacy.

[0046] 6. Application of LDH-dsCsSUR2 in the control of mango anthracnose The preventive tests of dsCsSUR2 and LDH-dsCsSUR2 nanoformulations on Colletotrichum gloeosporioides of mango were analyzed, and 4 groups of treatments were designed respectively; The first group dropped naked dseGFP (dsRNA synthesized from the green fluorescent protein coding gene sequence, and the preparation method was the same as that of the dsCsSUR2 treatment) as control 1; The second group dropped LDH-dseGFP as control 2; The third group dropped naked dsCsSUR2; The fourth group dropped LDH-dsCsSUR2 treatment.

[0047] Mangoes with basically the same growth trend and similar sizes were selected for inoculation. Six inoculation points were made on each mango fruit, and the experiment was repeated 5 times.

[0048] Wounds were made by acupuncture on the mango fruit surface, and 20 μL of dsCsSUR2 and 20 μL of control dseGFP, 20 μL of LDH-dsCsSUR2 and 20 μL of control LDH-dseGFP were respectively dropped at the acupuncture points. After 2 days of treatment, a mycelial cake of Colletotrichum gloeosporioides 02-3 (a mycelial cake with a diameter of 0.5 cm) was inoculated, and the results are shown in Figure 3(In Figure 3 , Figure a shows the phenotypes of mango anthracnose lesions in each treatment; Figure b shows the areas of mango anthracnose lesions in each treatment).

[0049] Combined with Figure 3 The results showed that there was no significant difference between the control naked dseGFP and LDH-dseGFP, and the lesion area of the naked dsCsSUR2 treatment decreased by 45.28% compared with that of the control 1 treatment; the lesion area of the LDH-dsCsSUR2 treatment decreased by 72.31% compared with that of the control 2 treatment. This indicates that applying naked dsCsSUR2 or LDH-dsCsSUR2 can effectively reduce the infection of anthracnose on mango fruits and has a good protective effect, but LDH can improve the control efficacy.

[0050] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on these embodiments without creative efforts, and these embodiments all fall within the protection scope of the present invention.

Claims

1. Application of dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase; The application includes: Preventing and treating anthracnose of crops and / or preparing a product for preventing and treating anthracnose of crops; The dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase is transcribed from the target gene segment shown in SEQ ID.No.1; The crops include: rubber tree and / or mango.

2. The application according to claim 1, wherein The nucleotide sequence of the dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase is shown in SEQ ID.No.

2.

3. The application according to claim 1, wherein The pathogens of the anthracnose include: Colletotrichum siamense and / or Colletotrichum asianum.

4. The application according to claim 1, wherein The product includes: a preparation containing dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase.

5. An LDH-dsCsSUR2 preparation, characterized in that, The LDH-dsCsSUR2 preparation includes: dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase and nanolayered double hydroxide; The nanolayered double hydroxide is: magnesium / aluminum layered double hydroxide.

6. A method for preventing and treating anthracnose of crops, characterized in that, Including the following steps: Applying the dsRNA targeting the gene encoding sphingolipid C-4 hydroxylase shown in SEQ ID.No.2 or the LDH-dsCsSUR2 preparation according to claim 5 to the crops; The crops include: rubber tree and / or mango.

7. The method according to claim 6, characterized in that, The application method includes: spraying; When the crop to be sprayed is a rubber tree, the spraying site is the rubber tree leaves; When the crop to be sprayed is a mango, the spraying site is the mango fruit.

Images