Corn pattern wilt disease resistant gene grmzm2g068455 and application thereof

Abstract

The application provides a corn sheath blight resistance gene GRMZM2G068455 The cDNA, coding region nucleotide sequence and coded amino acid sequence are shown as SEQ ID NO: 1-3. Further provided are applications, overexpression of the gene, genetic transformation of corn plants, and improvement of corn resistance to sheath blight; the corn sheath blight resistance gene GRMZM2G068455 The difference between the resistant and susceptible alleles of sheath blight in corn lines is identified to determine the corn resistance to sheath blight; the corn sheath blight resistance gene GRMZM2G068455 The 831bp-length allele natural variation site exists in the 875bp to 1705bp region of the promoter, and the 831bp-length allele is deleted in the corn sheath blight resistant line and inserted in the corn sheath blight susceptible line. The genetic transformation corn GRMZM2G068455 of the application has a significantly improved gene expression amount PR The expression of defense-related genes is significantly increased, ROS accumulation is enhanced, and the resistance to sheath blight is obviously enhanced, GRMZM2G068455 The gene plays an important role in the resistance to sheath blight.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of disease resistance genes, and particularly relates to a corn bacterial leaf streak disease resistance gene GRMZM2G068455 and application thereof. BACKGROUND

[0002] Corn (Zea mays) is one of the important food crops, but extreme weather disasters and the prevalence of major corn diseases often affect corn production, so it is urgent to breed new corn varieties with strong disease resistance, high yield and good quality. Corn bacterial leaf streak disease (BLSB) is caused by the semi-vital nutrition fungus Rhizoctonia solani Xanthomonas campestris pv. cornicola.

[0003] Several defense genes known to be associated with R. solani resistance include genes encoding chitinases, beta-1, 3-glucanases, osmoses, polygalacturonases, oxalate oxidases / decarboxylases, antimicrobial peptides, transcription factors, and genes related to plant hormone signaling, etc. Corn ZmFBL41 encodes an F-box protein that enhances BLSB resistance by regulating the lignin biosynthesis pathway. However, our understanding of the mechanisms of resistance in corn bacterial leaf streak disease is still limited, R. solani and the pathogenic mechanisms are still unclear. R. solani

[0004] Disadvantages of the prior art:

[0005] (1) Hybrid breeding: Traditional breeding techniques often severely limit the cultivation of resistant varieties due to long breeding cycles, low breeding efficiency, and difficulty in predicting the phenotype of hybrid offspring. In addition, the narrow genetic basis of corn inbred lines and the existence of intergeneric reproductive isolation limit the improvement of specific materials to some extent.

[0006] (2) Molecular marker-assisted breeding (MAS): Although many quantitative trait loci have been located using QTL methods, the dependence on the characteristics of molecular marker genetic maps requires large population sizes, high development costs, and cannot be used for the introduction of traits from distant species or non-plant sources, or the exploration of complex genetic mechanisms.

[0007] (3) Gene editing technology (taking CRIS PR / Cas9 as an example): Although CRIS PR / Cas9 technology can be used for precise targeted editing, it also has problems such as off-target effect probability, high technical threshold, and low public acceptance.

[0008] ​As a staple crop globally, maize production is frequently affected by sheath blight, leading to reduced yields and compromised quality. Notably, the pathogen causing maize sheath blight exhibits cross-species infectivity, posing a significant challenge to disease control. In-depth research into the pathogenic mechanism of sheath blight is crucial for developing novel disease-resistant varieties and enhancing crop defense capabilities. In this process, the isolation and cloning of resistance genes are prerequisites for conducting molecular mechanism research.

[0009] Compared to traditional methods of utilizing disease-resistant genes, transgenic technology using genetic engineering can endow crops with a more comprehensive range of resistance and more stable genetic characteristics. In particular, genetic modification of target disease-resistant genes through overexpression technology can not only significantly enhance crop disease resistance but also effectively expand its resistance lineage. These technological advantages are precisely what traditional hybridization breeding and conventional improvement methods cannot achieve. Currently, breeding disease-resistant crops based on gene cloning technology has become a crucial research direction in the field of agricultural biotechnology. Overcoming this technological bottleneck will provide innovative solutions for achieving sustainable control of crop diseases and reducing agricultural production losses, and has significant strategic importance for ensuring global food security. Summary of the Invention

[0010] The technical problem to be solved by the present invention is to provide a maize sheath blight resistance gene, addressing the shortcomings of the prior art. GRMZM2G068455 and its applications, GRMZM2G068455 Genetically transformed maize with significantly increased gene expression PR The expression of defense-related genes, such as the gene for disease response, was significantly increased, and ROS accumulation was enhanced, resulting in significantly improved resistance to sheath blight. GRMZM2G068455 Genes play an important role in resistance to sheath blight. GRMZM2G068455 The promoter of the disease-resistant haplotype contains an 831 bp natural variant site, and a set of specific molecular markers has been developed to distinguish this natural variant site. This 831 bp site is associated with the gene... GRMZM2G068455 Transcriptional response is associated with maize sheath blight resistance; deletion at the 831bp site can cause gene... GRMZM2G068455 Increased expression of this gene and enhanced resistance to maize sheath blight are key natural variation sites for maize sheath blight resistance. GRMZM2G068455 Its 831bp natural variation site is a key genetic component for breeding resistance to maize sheath blight, thus accelerating the process of breeding resistance to maize sheath blight.

[0011] To solve the above-mentioned technical problems, the technical solution adopted by the present invention is: a maize sheath blight resistance gene. GRMZM2G068455 The corn sheath blight resistance gene GRMZM2G068455The nucleotide sequence of the cDNA is shown as SEQ ID NO: 1, the nucleotide sequence of the coding region is shown as SEQ ID NO: 2, and the amino acid sequence is shown as SEQ ID NO: 3.

[0012] The application also provides the use of the above-mentioned corn brown leaf spot disease resistance gene GRMZM2G068455 overexpressed, genetically transformed corn plants, for improving the resistance of corn to brown leaf spot disease (Gaeumannomyces graminis) GRMZM2G068455 . R. solani The application also provides the use of the above-mentioned corn brown leaf spot disease resistance gene overexpressed, genetically transformed corn plants, for improving the resistance of corn to brown leaf spot disease (Gaeumannomyces graminis)

[0013] . GRMZM2G068455 The application also provides the use of the above-mentioned corn brown leaf spot disease resistance gene GRMZM2G068455 to identify the resistance of corn to brown leaf spot disease;

[0014] The application also provides the use of the above-mentioned corn brown leaf spot disease resistance gene GRMZM2G068455 The length of the 831bp allele in the promoter region of the corn brown leaf spot disease resistance gene GRMZM2G068455 is 831bp, which is deleted in the corn brown leaf spot disease resistance strain and inserted in the corn brown leaf spot disease susceptible strain; the length of the 831bp sequence is located in the promoter region of the gene and does not encode an amino acid sequence.

[0015] The base sequence of the 874bp nucleotide sequence of the length of the 831bp allele is:

[0016] 831 bp - cgcaaaaaga tccaggccgg gtccacgcgc ccacgggcac gggcggggat ctcctccgtt gtttcctagg ccgcacgccc ccacgccgcc tcgtctccgt ccgttcgtcg ggcgcaatag agacaccacg gcacgcgccc gccgcctgcc ctgcactttt ctaccaccga aggcgagggc gagggggcca aagacgagcg ctttttcgtg cccgcctgcc tgctgctggt cattgccgct gctcacgagc ctcccgcccc gtgccgccct gccctctacg gctctgccc- caacgagccc caggggagcc aggaaaagga gccgtcaaaa gccgccgccc ggagagcgcg cagggtaacg aagcaccatc tcctctcctt gcccttcttc gattaggttg gatcccagcc gccgtcgctg caggtgggat ctcctccgtt tttgcttcct ctcagtcgtt ccttcgctcg ggccgtgtgt agatctgcac gttccctgta gaattctcct ggtcggttcc attcctctcc gtcatattct cagtagatac tacgtttcat gccttgtccg ggtattagat tatgcttcga aaggcaattt ggtctaggtg tgtagctcga ttgttagtga tggcaaatag gaatggtggc ctgattttca atagagttgg caagtcagga gttagggaac tcaatcatat gatctatttt gttgaacgat tcacgttataga tcacctgctt gatacacgtt tcattcttgg ctcttactgc ttctaaatcc agttcttcaa gatatcctct gtcttgaatt atcttctgcc tcacctgcat atgtgcctga cggaactttg ttgctgcagt caggc-ATG;

[0017] The base sequence of the nucleotide sequence of the allele of 831 bp in length after 181 bp is: gtccaaaccgcaatggcgttcccctgcgtgcgttccaccgtacacggcaccaccacgtcgcgggatattgccgaatccgtcggcttctacctggctggctggccgtgcgcgccccacttttacgcagctccaaacacccggcgcaccagggccgccagtccgccactcgcacggcggcgct- 831 bp;

[0018] complete gene GRMZM2G068455

[0019] 831 bp corresponding sequence (SEQ ID NO: 25): 5'-ataggtgtacattcgggccgcccggtttggctcggttcaagcccgaaaaggcccgtattatttgaatttcgggccggtccggcccgtttgaattttgggctgtgctggaccggcccacgggcctagctctcggcccacggcccggcccgtaattacttaaacgtgccgggctcatttcgggcggaccgaaattataaaagcccgaaattcacattagggcccgaaatacattttttggcccaagattcagtttttggtccgaaattcacatcaagacccgaaattcaaaacaaatttaataaaacaaataaaagataagacaaatacatttgaccaaaagcaaacttaatatttgtattaagtaacatagctatgcaatgactacctcgtttacaaatcattttgttaaaaagaaaaagagtataatcagctctatataaagtttgtaagttcagttcattatctaatgttcataaaaaaaataaaattatatcacatactctaattcaaagctataaaaaacatctaactaacattatctctagctttgtgtttttatcaagtacatgaaaatgtggaatgaagtgtgattttaataaatatatgggcctttttgtgcctctatatgggccatttcgtgcctgccttaaatgggtcgtgttcatgcccgcccatgggtcacgacatcggcccaaacccggctcgatatatcgtgccgtgccggcccggcactaaattattttgtgtcgtctgtgtctgggtcgtgcttttttttcgtacttcgggccagcccatcaggcccggcccaaatgtacacctataggccgtcct-3';

[0020] the complete gene GRMZM2G068455The promoter region sequence, the sequence corresponding to the 831 bp allele, the 874 bp sequence preceding the 831 bp sequence, and the 181 bp sequence following the 831 bp sequence are all in sequence SEQ ID No. 11. GRMZM2G068455 The B73 genomic sequence contains [this information]. In addition to the above, SEQ ID No. 11 GRMZM2G068455 B73 genomic also contains the CDS sequence and the 3'UTR sequence.

[0021] Preferably, primers 17 and 18 are used to detect the natural variation sites of the 831 bp allele between the maize sheath blight resistant lines and the susceptible lines;

[0022] The nucleotide sequence of primer 17 is shown in SEQ ID NO:23, and the nucleotide sequence of primer 18 is shown in SEQ ID NO:24.

[0023] Preferably, the PCR reaction system for detection is: 10 μL of 2×T8 High-Fidelity Master Mix, 0.5 μL of 10 μM primer 17, 0.5 μL of 10 μM primer 18, 1 μL of DNA template, and ddH2O to a final volume of 20 μL.

[0024] The PCR reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ for 30 sec, 60℃ for 30 sec, 72℃ for 30 sec, 30 cycles; 72℃ final extension for 5 min.

[0025] The identification results were as follows: the band with the 831 bp natural variation site was 969 bp, which was identified as a maize sheath blight susceptible allele line; while the band lacking the 831 bp natural variation site was 138 bp, which was identified as a maize sheath blight resistant allele line; and the line with both 969 bp and 138 bp bands was identified as a heterozygous line.

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] 1. Enhance corn's resistance to sheath blight

[0028] This invention provides a maize sheath blight resistance gene. GRMZM2G068455 Functional verification and application, utilizing strong promoter-driven transgenic technology to... GRMZM2G068455 Genetic transformation of maize plants ND101 using an overexpression vector of the gene revealed... GRMZM2G068455 Genetically transformed maize with significantly increased gene expression levels exhibited markedly enhanced resistance to sheath blight. PR The expression of defense-related genes, such as genes, was significantly increased, and ROS accumulation was significantly enhanced, proving that...GRMZM2G068455 Genes play an important role in resistance to sheath blight.

[0029] 2. Discovery of disease-resistant genes GRMZM2G068455 An 831 bp natural variation site in the promoter region is associated with resistance to maize sheath blight.

[0030] The core finding of this invention lies in the fact that, through phenotypic-genotypic association analysis of HIF strain populations, it was shown that... GRMZM2G068455 An 831bp natural variation in the gene promoter region regulates GRMZM2G068455 The transcriptional response level directly determines maize's resistance to sheath blight pathogens. R.solani Of particular note is the clear correspondence between the resistance allele (831bp deletion) and the susceptibility allele (831bp presence), providing a quantifiable molecular marker selection standard for the creation of resistant germplasm. This invention, through synergistic analysis of field phenotypic validation and transcriptional responses, systematically reveals the complete regulatory pathway of "structural variation-gene expression-resistance phenotype" at the 831bp natural variation site, providing an innovative technological paradigm for molecular design breeding of crop disease resistance.

[0031] 3. Improve the economic and ecological benefits of corn crop production.

[0032] This invention effectively enhances maize's resistance to sheath blight pathogen by analyzing key resistance genes. The application of this transgenic technology system not only alleviates the threat of the disease to grain yield and nutritional quality but also significantly reduces the amount of chemical pesticides used by establishing an endogenous disease resistance mechanism, thereby lowering the risk of pesticide residue pollution and promoting the sustainable operation of farmland ecosystems. From a practical production perspective, the durable resistance acquired by crops results in the stable expression of excellent genetic traits, ensuring both yield and food security.

[0033] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. Attached Figure Description

[0034] Figure 1 After inoculating the susceptible maize material B73 and the resistant maize material CML496 in Example 1 of this invention with *Rhizoctonia solani*, the gene was... GRMZM2G068455 The transcriptional level response detection diagram.

[0035] Figure 2 In Embodiment 3 of the present invention GRMZM2G068455 Overexpression of T1 generation genetically transformed maize plants ( GRMZM2G068455- The gene expression levels in OE1 and OE2 were significantly increased (Figure).

[0036] Figure 3 In Embodiment 3 of the present invention GRMZM2G068455The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 10 days. GRMZM2G068455- The disease phenotype (left) and lesion length (right) of the T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 10 days.

[0037] Figure 4 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455- The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. PR The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours.

[0038] Figure 5 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455- The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours.

[0039] Figure 6 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours.

[0040] Figure 7 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours.

[0041] Figure 8 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. DETAILED DESCRIPTION

[0042] Example 1

[0043] The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455 The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours.

[0044] The T1 generation of the genetically transformed corn plants (OE1, OE2) overexpressing the gene were inoculated with the sheath blight pathogen for 36 hours. GRMZM2G068455The expression of the gene after inoculation of the pathogen was detected by qRT-PCR, and the primers used were primer 3, 5'-TGGCCATGCTGGAATCACAA-3', the sequence of which is shown as SEQ ID NO: 6, and primer 4, 5'-CGCACGGAGAGAAGACTCAA-3', the sequence of which is shown as SEQ ID NO: 7. The anti-disease material CML496 and the susceptible material B73 (the material B73 is derived from the literature Tian, T., Wang, S., Yang, S. et al. Genome assembly and genetic dissection of a prominent drought-resistant maize germplasm. Nat Genet 55, 496-506 (2023); the material CML496 is derived from the literature Lv M, Deng C, Li X, Zhao X, Li H, Li Z, Tian Z, Leonard A, Jaqueth J, Li B, Hao J, Chang Y, Ding J. Identification and fine-mapping of a major QTL for resistance to Gibberella zeae in maize. Plant Genome. 2021 Mar;14(1):e20062) were extracted, and the RNA at 0 hours, 12 hours, 24 hours, 48 hours, and 72 hours after inoculation of the pathogen was obtained, and the cDNA was obtained by reverse transcription, and the cDNA was used as a template for fluorescence quantitative PCR amplification. RppCML496 , a major QTL forresistance to Puccinia polysora in maize. Plant Genome. 2021 Mar;14(1):e20062) were extracted, and the cDNA was obtained by reverse transcription, and the cDNA was used as a template for fluorescence quantitative PCR amplification.

[0045] The fluorescence quantitative PCR reaction system was: 2x Real Fast SYBR qPCR Mix (Low ROX) (Huanyu Biological) 10ul, 10uM upstream primer 1 0.5ul, 10uM downstream primer 2 0.5ul, cDNA template 2ul, and ddH2O was supplemented to 20ul.

[0046] The fluorescence quantitative PCR reaction program was: 95°C pre-denaturation for 2 min; 95°C for 15 sec, 60°C for 30 sec, 40 cycles. The relative expression amount of the gene was calculated by the method of 2^ -ΔΔCt .

[0047] After the fluorescence quantitative PCR was completed, the results showed that the gene could be induced by Rhizoctonia solani in the susceptible maize variety B73 and the resistant variety CML496 GRMZM2G068455 . R. solaniinduction of the susceptible material B73 GRMZM2G068455 The expression levels of all genes reached a peak and then decreased. However, it is worth noting that the peak of the transcriptional response of the gene GRMZM2G068455 in the resistant material CML496 was much higher than that in the susceptible material B73 Figure 1 , indicating that the gene is involved in the resistance of corn to the sheath blight.

[0048] Example 2

[0049] This example is to isolate and clone GRMZM2G068455 the gene.

[0050] According to the database Maize GDB GRMZM2G068455 , a primer, primer 1, 5'-ATGGCATCAACCGTTACCTT-3', the sequence of which is shown as SEQ ID NO: 4, and primer 2, 5'-AACAGATGCAGCAGCTTCCC-3', the sequence of which is shown as SEQ ID NO: 5, are designed to obtain GRMZM2G068455 the gene. The corn B73 RNA is extracted and the cDNA is obtained by reverse transcription, and the PCR amplification is performed by taking the cDNA as a template.

[0051] The PCR reaction system is as follows: 2xT8 High-Fidelity Master Mix (Nanjing Keygen Biotech Co., Ltd.) 25ul, 10uM upstream primer 1 2ul, 10uM downstream primer 2 2ul, cDNA template 1ul, and ddH2O to 50ul.

[0052] The PCR reaction program is as follows: 98℃ pre-denaturation for 2 min; 98℃ for 30 sec, 60℃ for 30 sec, 72℃ for 1 min 30 sec, 32 cycles; and 72℃ for terminal extension for 5 min.

[0053] After the PCR is completed, the amplified fragments are recovered and purified by using the DNA recovery kit of Nanjing Keygen Biotech Co., Ltd., and then the purified DNA fragments are connected to the vector CAUC2829-Ubi (provided by the Crop Functional Genomics and Molecular Breeding Center of China Agricultural University), and the E.coli DH5a competent cells are transformed, and the positive clones are selected to extract plasmids, and the sequencing is completed by Nanjing Keygen Biotech Co., Ltd., to obtain a 1191 bp length GRMZM2G068455 fragment with the DNA sequence of SEQ ID NO: 2.

[0054] Example 3

[0055] This example is to verify the function of GRMZM2G068455 the gene.

[0056] The purified cDNA fragment is connected to the overexpression vector CAUC2829 by homologous recombination, and the recombinant colonies are subjected to colony PCR after heat shock transformation of the competent cells of DH5a, and the band of the same size as the target fragment is detected by agarose gel electrophoresis. The identified recombinant colonies are expanded and cultured to extract plasmids, and the plasmids are sequenced and compared with the original sequence. The connected fragment is the full-length cDNA and has no base mutation and deletion, proving that the overexpression vector CAUC2829-Ubi:- E.coli is successfully constructed. GRMZM2G068455 GRMZM2G068455

[0057] The overexpression vector is genetically transformed in the Crop Functional Genomics and Molecular Breeding Research Center of China Agricultural University, and the overexpression vector is introduced into the maize variety ND101 (the maize variety ND101 is from the literature Liu, C., He, S., Chen, J., Wang, M., Li, Z., Wei, L., Chen, Y., Du, M., Liu, D., Li, C., An, C., Bhadauria, V., Lai, J. and Zhu, W. (2024), A dual-subcellular localized β-glucosidase confers pathogen and insect resistance without a yield penalty in maize. Plant Biotechnol. J, 22: 1017-1032.), and the obtained maize genetic transformation plant is named GRMZM2G068455 -T1. A total of 17 independent transformation plants are obtained in the present application, of which 9 are positive plants, and the expression of the genes in the positive plants (OE1, OE2) is significantly improved. GRMZM2G068455 GRMZM2G068455- GRMZM2G068455 Figure 2 ) respectively. About 40 single plants of each of the T1 generation of the two transgenic plants (OE1, OE2) are inoculated with the corn sheath blight fungus for identification. The results show that after inoculation with the sheath blight fungus GRMZM2G068455- R. solani 10 days later, the overexpression of the T1 generation genetic transformation plants is significantly reduced compared with the wild type, and the average lesion length is shortened by 9.75 cm and 9.51 cm, and the average lesion length is reduced by about 37.3% (Table 1, GRMZM2G068455 ), indicating that the genes Figure 3 participate in the resistance response of corn to sheath blight. GRMZM2G068455

[0058] ​​​​​​​Table 1 GRMZM2G068455 Field inoculation of overexpression vector positive plants with corn sheath blight lesion length statistics

[0059]

[0060]

[0061] Note: "-" in the table means no statistical plant data.

[0062] Example 4

[0063] This example is overexpression of GRMZM2G068455 T1 generation genetic transformation plants PR Gene detection.

[0064] Overexpression of GRMZM2G068455 T1 generation genetic transformation plants were detected after inoculation with sheath blight fungus for 24 hours PR The response expression level of defense-related genes was detected using primer 7, 5'-TGTGCATGCACCTATATGTACT-3', the sequence of which is shown in SEQ ID NO: 12, and primer 8, 5'-TTCGTGAGACATGACGATACAT-3', the sequence of which is shown in SEQ ID NO: 13 ZmPR4 Zm00001d048949 NCBI Accession No: LOC103634525), using primer 11, 5'-CCTACGGCGAGAACCTCTT-3', the sequence of which is shown in SEQ ID NO: 16, and primer 12, 5'-TCGTAGTACTGCTTCTCGGAC-3', the sequence of which is shown in SEQ ID NO: 17 ZmPR10 Zm00001d028816 NCBI Accession No: LOC103634525), using primer 11, 5'-CCTACGGCGAGAACCTCTT-3', the sequence of which is shown in SEQ ID NO: 16, and primer 12, 5'-TCGTAGTACTGCTTCTCGGAC-3', the sequence of which is shown in SEQ ID NO: 17 ZmPR1 Zm00001d018738 NCBI Accession No: LOC103634525), using primer 11, 5'-CCTACGGCGAGAACCTCTT-3', the sequence of which is shown in SEQ ID NO: 16, and primer 12, 5'-TCGTAGTACTGCTTCTCGGAC-3', the sequence of which is shown in SEQ ID NO: 17 ZmAOS1 Zm00001d048021 ​​​​The maize internal reference gene 18S was detected using primer 15, 5'- CCATCCCTCCGTAGTTAGCTTCT-3', the sequence of which is shown as SEQ ID NO: 20, and primer 16, 5'-CCTGTCGGCCAAGGCTATATAC-3', the sequence of which is shown as SEQ ID NO: 21. The overexpression GRMZM2G068455 T1 generation genetic transformation positive plants GRMZM2G068455 RNA of OE1, OE2 and background material ND101 24 hours after inoculation with the sheath blight fungus, and cDNA was obtained by reverse transcription, and then fluorescence quantitative PCR amplification was performed using the cDNA as a template.

[0065] The fluorescence quantitative PCR reaction system was as follows: 2x Real Fast SYBR qPCR Mix (Low ROX) (Huanyu Biology) 10 ul, 10 uM upstream primer 1 0.5 ul, 10 uM downstream primer 2 0.5 ul, cDNA template 2 ul, and ddH2O was supplemented to 20 ul.

[0066] The fluorescence quantitative PCR reaction program was as follows: 95 °C pre-denaturation for 2 min; 95 °C for 15 sec, 60 °C for 30 sec, 40 cycles. The relative expression amount of the gene was calculated by the method of 2^-AACt.

[0067] After the fluorescence quantitative PCR was completed, data analysis was performed, and it was found that, compared with the background material ND101, the overexpression GRMZM2G068455 T1 generation plants GRMZM2G068455 OE1, OE2) of defense-related genes: GRMZM2G068455 ( ZmPR4 NCBI accession number: LOC100191593), Zm00001d048949 ( ZmPR10 NCBI accession number: LOC103634525), Zm00001d028816 ( ZmPR1 NCBI accession number: LOC542352), Zm00001d018738 ( ZmAOS1 NCBI accession number: LOC542150) were significantly increased Zm00001d048021 after inoculation with the sheath blight fungus for 24 hours, indicating that the immune defense pathway related to the resistance of the overexpression Figure 4 plant to sheath blight was induced in response, thereby conferring resistance to corn sheath blight.

[0068] Example 5

[0069] This example is to detect ROS in the T1 generation genetic transformation plants overexpressing GRMZM2G068455 This example is to detect ROS in the T1 generation genetic transformation plants overexpressing

[0070] Overexpression GRMZM2G068455 The accumulation level of reactive oxygen species (H2O2) in T1 generation genetically transformed plants 36 hours after inoculation with *Rhizoctonia solani* was detected using a hydrogen peroxide (H2O2) content detection kit (Solepro BC3595-100T / 96S). GRMZM2G068455 The H2O2 content of OE1, OE2 plants and background material ND101 after inoculation with *Rhizoctonia solani* was compared with that of background material ND101. GRMZM2G068455 The H2O2 content of OE1 and OE2 plants increased significantly 36 hours after inoculation with Rhizoctonia solani. GRMZM2G068455 A). Simultaneously, DAB staining was used (Wang Yue, J., Yang, N.). Figure 5 An ERAD-relatedubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. et al. 4, 774–787 (2023).) DAB staining of OE plants and background ND101 plants also revealed that compared with the background material ND101... Nat Food ROS accumulation was significantly enhanced in OE1 and OE2 plants. GRMZM2G068455 B).

[0071] Example 6

[0072] This embodiment is for... Figure 5 Resequencing analysis was performed on disease-resistant and disease-susceptible haplotypes of the gene.

[0073] Using primers 5, 5′-GTCCAAACCGCAATGGCGTT-3′ (sequence shown in SEQ ID NO:8) and 6, 5′-GCCTCTTTGTAGTTTGTAGACTCC-3′ (sequence shown in SEQ ID NO:9), this gene was analyzed. GRMZM2G068455 Resequencing of disease-resistant and disease-susceptible haplotypes revealed that... GRMZM2G068455 The promoter regions of the disease-resistant allele lines (represented by the disease-resistant material CML496, sequence shown in SEQ ID NO:10) and the disease-susceptible allele lines (represented by the disease-susceptible material B73, sequence shown in SEQ ID NO:11) generally exhibit a large 831 bp deletion. GRMZM2G068455 ),Right now Figure 6 Ecotype materials with an 831bp deletion in the gene promoter region exhibited resistance to sheath blight.

[0074] Meanwhile, the results in Example 1 revealed that the gene in the disease-resistant material CML496...GRMZM2G068455 The transcriptional response peak induced by the Aspergillus infection is much higher than that in the susceptible material B73, i.e. GRMZM2G068455 The transcriptional response level of the ecological material with 831bp deletion in the promoter region of the gene is significantly increased after the pathogenic bacteria infection.

[0075] The corn Goss' Wilt resistant gene GRMZM2G068455 There are differences in the resistant and susceptible alleles of Goss' Wilt in the corn lines, and the corn resistance to Goss' Wilt is identified;

[0076] The corn Goss' Wilt resistant gene GRMZM2G068455 There is a natural variation site of the allele with a length of 831bp in the promoter region, and the length of 831bp is deleted in the corn Goss' Wilt resistant line and inserted in the corn Goss' Wilt susceptible line; the length of 831bp is located in the promoter region of the gene and does not encode an amino acid sequence. GRMZM2G068455 The promoter region, does not encode an amino acid sequence;

[0077] The base sequence of the nucleotide sequence of the allele of 831 bp for the first 874 bp is: 831 bp - cgcaaaaagatccaggccgggtccacgcgcccacgggcacgggcggggatctcctccgttgtttcctaggccgcacgccgcccacgccgcctccgtctccgtccgttcgtcgggcgcaatagagacaccacggcacgcgccgccgctcctgccctgcacttttctaccaccgaaggcgagggcgagggggccaaagacgagcgctttttcgtgcccgcctgcctgcctgctggtcattgccgctgctcacgagcctcccgccccgtgccgccctgccctctacggctctgccccaacgagccccaggggagccaggaaaaggagccgtcaaaagccgccgccgaggagagcgcgcagggtaacgaagcaccatctcctctccttgcccttcttcgattaggttggatcccagccgccgtcgctgcaggtgggatctcctccgtttttgcttcctctcagtcgttccttcgctcgggccgtgtgtagatctgcacgttccctgtagaattctcctggtcggttccattcctctccgtcatattctcagtagatactacgtttcatgccttgtccgggtattagattatgcttcgaaaggcaatttggtctaggtgtgtagctcgatttgttagtgatggcaaataggaatggtggcctcattttcaatagagttggcaagtcaggcaagttagggaactcaatcatatgatctattttgttgaacgattcacgttatagatcacctgcttgatacacgtttcattcttggctcttactgcttctaaatccagttcttcaagatatcctctgtcttgaattatcttctgcctcacctgcatatgtgcctgacggaactttgttgctgcagtcaggc-ATG;

[0078] The base sequence of the nucleotide sequence of the allele of 831 bp in length after 181 bp is: gtccaaaccgcaatggcgttcccctgcgtgcgttccaccgtacacggcaccaccacgtcgcgggatattgccgaatccgtcggcttctacctggctggctggccgtgcgcgccccacttttacgcagctccaaacacccggcgcaccagggccgccagtccgccactcgcacggcggcgct- 831 bp;

[0079] complete gene GRMZM2G068455

[0080] 831 bp corresponds to the following sequence (SEQ ID NO: 25): 5'-ataggtgtacattcgggccgcccggtttggctcggttcaagcccgaaaaggcccgtattatttgaatttcgggccggtccggcccgtttgaattttgggctgtgctggaccggcccacgggcctagctctcggcccacggcccggcccgtaattacttaaacgtgccgggctcatttcgggcggaccgaaattataaaagcccgaaattcacattagggcccgaaatacattttttggcccaagattcagtttttggtccgaaattcacatcaagacccgaaattcaaaacaaatttaataaaacaaataaaagataagacaaatacatttgaccaaaagcaaacttaatatttgtattaagtaacatagctatgcaatgactacctcgtttacaaatcattttgttaaaaagaaaaagagtataatcagctctatataaagtttgtaagttcagttcattatctaatgttcataaaaaaaataaaattatatcacatactctaattcaaagctataaaaaacatctaactaacattatctctagctttgtgtttttatcaagtacatgaaaatgtggaatgaagtgtgattttaataaatatatgggcctttttgtgcctctatatgggccatttcgtgcctgccttaaatgggtcgtgttcatgcccgcccatgggtcacgacatcggcccaaacccggctcgatatatcgtgccgtgccggcccggcactaaattattttgtgtcgtctgtgtctgggtcgtgcttttttttcgtacttcgggccagcccatcaggcccggcccaaatgtacacctataggccgtcct-3';

[0081] the complete gene GRMZM2G068455The promoter region sequence, the sequence corresponding to the 831 bp allele, the 874 bp sequence preceding the 831 bp sequence, and the 181 bp sequence following the 831 bp sequence are all in sequence SEQ ID No. 11. GRMZM2G068455 The B73 genomic sequence contains, in addition to the above, SEQ ID No. 11 GRMZM2G068455 B73 genomic also contains the CDS sequence and the 3'UTR sequence.

[0082] Example 7

[0083] This example demonstrates genotype-phenotype association analysis and transcriptional response level detection for three heterozygous inbred lines (HIF) of the BC2RILs population.

[0084] BC2RILs populations from the resistant strain CML496 and the susceptible strain Lx9801 were used (both the BC2RILs populations and the material Lx9801 were derived from the literature Lv M, Deng C, Li X, Zhao X, Li H, Li Z, Tian Z, Leonard A, Jaqueth J, Li B, Hao J, Chang Y, Ding J. Identification and fine-mapping of GRMZM2G068455 , a major QTL for resistance to RppCML496 Phenotypic gene association analysis was performed using primers 5, 5′-GTCCAAACCGCAATGGCGTT-3′ (sequence shown in SEQ ID NO:8) and 6, 5′-GCCTCTTTGTAGTTTGTAGACTCC-3′ (sequence shown in SEQ ID NO:9). Sequencing analysis showed that Lx980I contains the same genes as the representative infectious ecotype B73. Puccinia polysora Promoter and coding sequence (the sequence of which is shown in SEQ ID NO:22).

[0085] Within this BC2RILs population, this invention identified three heterozygous inbred lines (HIF)—CG2395, CG2350, and CG2453—all of which are in [missing information]. GRMZM2G068455 The promoter region was separated. Field inbreeding of the above three HIF inbred lines was carried out. GRMZM2G068455It was found that CG2395 and CG2350 showed the phenomenon of genotype-phenotype correlation, they were segregated in 831bp region, while CG2453 showed no correlation, it was segregated in 39bp region R. solani A). It was also found that the HIF line with 831bp deletion in CG2350 CB and CG2395 CB (CG2350 CB and CG2395 CB were resistance allele line identified by primer 17 and primer 18 in BC2RILs population in this study, the nucleotide sequence of primer 17 was shown as SEQ ID NO: 23, and the nucleotide sequence of primer 18 was shown as SEQ ID NO: 24) significantly enhanced the resistance to corn sheath blight Figure 7 A). The expression of CG2395 CB and CG2395 BB (CG2395 CB and CG2395 BB were resistance and susceptible allele line identified by primer 17 and primer 18 in BC2RILs population in this study, the nucleotide sequence of primer 17 was shown as SEQ ID NO: 23, and the nucleotide sequence of primer 18 was shown as SEQ ID NO: 24) in 24 hours after inoculation with sheath blight was detected by qRT-PCR, the primers used were primer 3, 5'-TGGCCATGCTGGAATCACAA-3' whose sequence was shown as SEQ ID NO: 6, and primer 4, 5'-CGCACGGAGAGAAGACTCAA-3' whose sequence was shown as SEQ ID NO: 7. The results analysis showed that compared with CG2395 BB, the CG2395 CB HIF line (CG2395 CB line was identified and segregated in RIL line, which was called HIF line) significantly increased the transcription response after inoculation Figure 7 GRMZM2G068455 R.solani GRMZM2G068455 B). The above results showed that, Figure 7 the natural variation of 831bp in the promoter region of the gene was the reason for the difference in the transcription response level and the difference in the resistance to corn sheath blight. GRMZM2G068455

[0086] Example 8

[0087] This example is to develop a set of molecular markers for specific detection of 831bp natural variation to evaluate corn germplasm and genotype-phenotype correlation analysis.

[0088] ​​​​Furthermore, the application effectively distinguills the 831 bp natural variation between the corn sheath blight resistant strain and the susceptible strain by developing a molecular marker, the primer 17, 5'-TTACGCAGCTCCAAACACCC-3', the sequence of which is shown as SEQ ID NO: 23, and the primer 18, 5'-GTGCGGCCTAGGAAACAACG-3', the sequence of which is shown as SEQ ID NO: 24, can effectively distinguish the resistant allele and the susceptible allele GRMZM2G068455 A). The electrophoresis result is shown in Figure 8 A, the band with the 831 bp natural variation site is 969 bp, which is identified as the susceptible allele strain (+ 831 bp); and the band without the 831 bp natural variation site is 138 bp, which is identified as the resistant allele strain (Δ 831 bp); and the band with both 969 bp and 138 bp is identified as the heterozygous strain (Het).

[0089] By screening 302 corn germplasm, it is found that 128 corn materials carry the 831 bp deletion resistant allele, 147 corn materials carry the 831 bp susceptible allele, and 27 are heterozygous types Figure 8 B). The genotype-phenotype correlation analysis shows that the plants carrying the 831 bp deletion resistant allele show higher resistance Figure 8 C) compared with the plants carrying the 831 bp susceptible allele, which further indicates that the 831 bp deletion confers corn sheath blight resistance. R. solani C) compared with the plants carrying the 831 bp susceptible allele, which further indicates that the 831 bp deletion confers corn sheath blight resistance.

[0090] The PCR reaction system is: 2xT8 High-Fidelity Master Mix (Qingke Biology) 10 μL, 10 uM primer 17 (SEQ ID NO: 23) 0.5 μL, 10 uM primer 18 (SEQ ID NO: 24) 0.5 μL, DNA template 1 μL, and ddH2O is supplemented to 20 μL.

[0091] The PCR reaction program is: 98℃ pre-denaturation for 2 min; 98℃ for 30 sec, 60℃ for 30 sec, 72℃ for 30 sec, 30 cycles; and 72℃ terminal extension for 5 min.

[0092] The identification result is: the band with the 831 bp natural variation site is 969 bp, which is identified as the susceptible allele strain; and the band without the 831 bp natural variation site is 138 bp, which is identified as the resistant allele strain; and the band with both 969 bp and 138 bp is identified as the heterozygous strain.

[0093] In summary, the present application has the following technical innovations:

[0094] (1) Figure 8 Overexpression of the vector enhances the resistance of the genetically transformed maize plants to sheath blight

[0095] The present application provides a maize sheath blight resistance gene GRMZM2G068455 The function of the gene is verified and applied, and the overexpression vector of the gene is genetically transformed into maize plants ND101 using strong promoter driven transgenic technology. GRMZM2G068455 The genetically transformed maize with significantly improved expression of the gene has significantly enhanced resistance to sheath blight, and the gene plays an important role in resisting sheath blight. GRMZM2G068455 GRMZM2G068455

[0096] (2) Analysis of the key natural variation site 831bp.

[0097] Based on the fine mapping of the HIF strain population, the core regulatory role of the 831bp natural variation site in the promoter region is revealed. GRMZM2G068455 GRMZM2G068455

[0098] (3) Genotype-phenotype association analysis.

[0099] The disease-resistant allele strain (CG2395 / CG2350) carrying the 831bp deletion has a 1.82-2.06 fold increase in field resistance, and the transcription response level is 2.62 times higher than that of the susceptible type (831bp exists).

[0100] (4) Development of a specific molecular marker

[0101] The specific molecular marker is designed to realize rapid detection of resistant / susceptible alleles, and the verification of 302 corn germplasm shows that the resistant type accounts for 42.4% (128 / 302), which provides a throughput screening method for molecular marker assisted selection breeding.

[0102] The above is only a preferred embodiment of the present application, and does not limit the present application. Any simple modification, change and equivalent change of the above embodiment according to the technical essence of the present application are still within the protection scope of the technical solution of the present application.​​​

Claims

1. The application of molecular markers in identifying maize resistance to maize sheath blight, characterized in that, The molecular marker is located in the maize gene. GRMZM2G068455 The sequence at -875bp to -1705bp of the promoter is shown in SEQ ID NO:

25. In maize sheath blight resistant lines, the allele shown in SEQ ID NO:25 is deleted, while in maize sheath blight susceptible lines, the allele shown in SEQ ID NO:25 is inserted.

2. According to the application described in claim 1, primers 17 and 18 are used to detect the natural variation site of the 831 bp allele between the maize sheath blight resistant lines and susceptible lines; The nucleotide sequence of primer 17 is shown in SEQ ID NO:23, and the nucleotide sequence of primer 18 is shown in SEQ ID NO:

24.

3. The application according to claim 2, characterized in that, The PCR reaction system for the detection was as follows: 10 μL of 2×T8 High-Fidelity Master Mix, 0.5 μL of 10 μM primer 17, 0.5 μL of 10 μM primer 18, 1 μL of DNA template, and ddH2O to a final volume of 20 μL. The PCR reaction program was as follows: 98℃ pre-denaturation for 2 min; 98℃ for 30 sec, 60℃ for 30 sec, 72℃ for 30 sec, 30 cycles; 72℃ final extension for 5 min. The identification results were as follows: the band with the 831 bp natural variation site was 969 bp, which was identified as a maize sheath blight susceptible allele line; while the band lacking the 831 bp natural variation site was 138 bp, which was identified as a maize sheath blight resistant allele line; and the line with both 969 bp and 138 bp bands was identified as a heterozygous line.

Images