Universal vector system for knocking out cpxA gene

Abstract

The invention provides a carrier system for knocking out a cpxA gene, the carrier system encodes universal gRNA, Cas9 protein and a single-base editing element, and the cpxA gene is knocked out by performing point mutation on an initiation codon sequence in the cpxA gene. The vector system can be used for realizing the knockout of the cpxA gene in any cell containing the cpxA gene. The invention also provides a method for knocking out the cpxA gene in a target cell by using the vector system, and a serratia marcescens mutant strain obtained by the method. The invention also provides a method for constructing the vector system.

Description

Technical Field

[0001] The present application relates to a vector system, in particular to a vector system for knocking out the cpxA gene. The present application also relates to a method for knocking out the cpxA gene in a target cell using the vector system, and a mutant strain of Serratia marcescens obtained thereby. The present application also relates to a method for constructing the vector system. Background Art

[0002] With the continuous use of antibiotics, multidrug-resistant (MDR) bacteria appear frequently and spread widely in clinic. This is because bacteria have evolved many signal delivery systems to adapt to various adverse environments. For example, in Salmonella typhimurium, the MDR regulatory system is composed of the sensor kinase CpxA and the response regulatory protein CpxR. Studies have shown that the loss of the cpxA gene in the body can cause increased resistance to aminoglycosides and β-lactam antibiotics. In many other bacteria, the regulation of CpxA on drug resistance is unknown.

[0003] In the prior art, homologous recombination technology is mainly used for knocking out the cpxA gene. For example, the Red homologous recombination system is used in Chinese invention patent application CN109971782A to achieve deletion mutation of the cpxA gene of Salmonella typhimurium. However, homologous recombination technology involves the construction of homologous arms. Since the upstream and downstream sequences of the cpxA gene in different species are different, when knocking out the cpxA gene in different species, it is necessary to know its upstream and downstream sequences, and the recombinant vector used for knocking out cannot be universal between different species. This field requires a more efficient and universal cpxA gene knockout method than homologous recombination technology. Summary of the invention

[0004] The present application provides a vector system for knocking out the cpxA gene, which encodes a universal gRNA, a Cas9 protein, and a single base editing element. The vector system can be used to knock out the cpxA gene in any cell containing the cpxA gene.

[0005] In one aspect, the present application provides a vector system for knocking out the cpxA gene, which encodes the universal gRNA, Cas9 protein and single-base editing element shown in SEQ ID No: 3.

[0006] In some embodiments, the nucleotide sequence of the cpxA gene is positions 5-1399 in SEQ ID NO:1.

[0007] In some embodiments, the Cas9 protein is xCas9 (3.7). In some embodiments, the single-base editing element is ABE.

[0008] In some embodiments, the knockout includes a point mutation in the start codon sequence of the cpxA gene. In some embodiments, the point mutation includes mutating the start codon sequence from ATG to GTG.

[0009] In some embodiments, the vector system comprises one or more marker genes for removing the vector system.

[0010] In some embodiments, the vector system is a two-vector system.

[0011] In some embodiments, one vector in the two-vector system encodes the Cas9 protein and the single-base editing element, and the other vector encodes the universal gRNA.

[0012] In some embodiments, both vectors of the two-vector system comprise marker genes for removing the vector. In some embodiments, the vector encoding the Cas9 protein and the single-base editing element further comprises a sucrose-sensitive gene. In some embodiments, the vector encoding the universal gRNA further comprises a temperature-sensitive replicon pSC101 expression system.

[0013] In another aspect, the present application provides a method for knocking out the cpxA gene in a target cell, which includes introducing a vector system encoding the universal gRNA shown in SEQ ID No:3, the Cas9 protein, and the single-base editing element into the target cell.

[0014] In some embodiments, the knockout includes a point mutation in the start codon sequence of the cpxA gene. In some embodiments, the point mutation includes mutating the start codon sequence from ATG to GTG.

[0015] In some embodiments, the target cell is Serratia marcescens.

[0016] In some embodiments, the method includes inducing the expression of the vector system using IPTG and L-arabinose.

[0017] In yet another aspect, the present application provides a Serratia marcescens mutant strain containing a cpxA gene with a point mutation, and the nucleotide sequence of the cpxA gene with the point mutation is positions 5-1399 in SEQ ID NO:2.

[0018] In some embodiments, the cpxA gene with the point mutation contained in the Serratia marcescens mutant strain does not express the CpxA protein.

[0019] In some embodiments, the Serratia marcescens mutant strain is prepared by the method of knocking out the cpxA gene in the target cell described in the present application, which includes introducing a vector system into the target cell, and the vector system encodes a universal gRNA shown in SEQ ID No: 3, a Cas9 protein, and a single-base editing element.

[0020] In some embodiments, the Serratia marcescens mutant strain contains the vector system described in the present application that encodes a universal gRNA shown in SEQ ID No: 3, a Cas9 protein, and a single-base editing element.

[0021] In some embodiments, the Serratia marcescens mutant strain does not contain the vector system described in the present application that encodes a universal gRNA shown in SEQ ID No: 3, a Cas9 protein, and a single-base editing element.

[0022] In yet another aspect, the present application provides the use of the vector system encoding a universal gRNA shown in SEQ ID No: 3, a Cas9 protein, and a single-base editing element in knocking out the cpxA gene in a target cell.

[0023] In some embodiments, the target cell is Serratia marcescens.

[0024] In yet another aspect, the present application provides a method for constructing the vector system encoding a universal gRNA shown in SEQ ID No: 3, a Cas9 protein, and a single-base editing element, which includes replacing the sequence encoding SpCas9 in the pHCY-25A vector with a nucleotide sequence encoding a Cas9 protein and a single-base editing element, and further includes introducing the nucleotide sequence encoding the universal gRNA shown in SEQ ID No: 3 into the pHCY-26D vector.

[0025] In some embodiments, the Cas9 protein is xCas9(3.7). In some embodiments, the single-base editing element is ABE.

[0026] In some embodiments, the pHCY-25A vector contains a sucrose-sensitive gene. In some embodiments, the pHCY-26D vector contains a temperature-sensitive replicon pSC101 expression system.

[0027] Surprisingly, it was found in this application that the cpxA gene (the sequence of which is positions 5 - 1399 in SEQ ID No: 1) has a PAM sequence conforming to the NGG form starting from the 17th base (corresponding to the 21st position in SEQ ID No: 1). The first 16 bases at the 5' end of this gene (corresponding to positions 5 - 20 in SEQ ID No: 1), together with the 4 bases before this gene (such as, but not limited to, positions 1 - 4 in SEQ ID No: 1), can exactly meet the 20 - nt length design requirement of the gRNA. The 20 - nt length universal gRNA designed in this application (the sequence is 5'-NNNNATGATCAACAGTTTGA-3', SEQ ID No: 3, where the first four bases are degenerate bases) can assist the Cas9 protein and the single - base editing element described in this application to localize to the cpxA gene, and through base editing within the editing window (such as the 4th - 7th bases at the end of the gRNA away from the PAM), the start - codon sequence in the cpxA gene can be mutated (such as from ATG to GTG), so that this gene can only be transcribed but not translated into protein, thereby achieving the knockout of the cpxA gene. After the vector system provided in this application is introduced into any target cell containing the cpxA gene and induced to express, it can achieve the knockout of the cpxA gene in this target cell through the above - mentioned principle. And only by knowing that a certain target cell (such as bacteria) contains the drug - resistance regulatory gene cpxA, without knowing the sequences at both ends of this gene (as homologous arms in the homologous recombination method), the knockout of the cpxA gene can be achieved. Based on this, this application has established a set of efficient, universal and widely applicable method for knocking out the cpxA gene, which has great help for the research of, for example, the regulatory mechanism of bacterial drug resistance and the like. Brief Description of the Drawings

[0028] Figure 1 It is the physical map of P25A - ABE. The P25A - ABE plasmid encodes the single - base editing element ABE, the xCas9 protein, and carries a sucrose - sensitive gene, which can be used for the removal of this plasmid after gene editing.

[0029] Figure 2 It is the physical map of P26D - U - gRNA. The P26D - U - gRNA plasmid encodes the universal gRNA and carries a temperature - sensitive replicon pSC101 expression system, which can be used for the removal of this plasmid after gene editing.

[0030] Figure 3PCR amplification electrophoresis diagram constructed for the P25A-ABE vector. Among them, lane M is the 250bp DNA ladder (the bands are 15000, 8000, 5000, 3000, 2000, 1500, 1000, 750, 500, 250, 100bp respectively), A01 is the ABE-xCas9 fragment F1 (5295bp), A02 is the fragment F2 (3968bp) of the P25A vector without spCas9, including the Kan, lacI, sacB promoters and the SacB gene, and A03 is the remaining fragment F3 (2486bp) of this vector.

[0031] Figure 4 Diagram of the Sanger sequencing sequence alignment results of the Serratia marcescens mutant strain with cpxA knocked out and the original clinical isolate. Among them, the sequences in the first to third rows of Figure A are the mutant strains, the fourth row is the non-successfully mutated strain after induction, and the fifth row is the original clinical isolate. Figure B is the Sanger sequencing peak diagram of the mutation site and its vicinity of the mutant strain in the first row of Figure A. Detailed implementation methods

[0032] Unless otherwise specified, all technical and scientific terms used herein have the meanings commonly understood by those of ordinary skill in the art.

[0033] The term "or" refers to a single element among the listed alternative elements, unless the context clearly indicates otherwise. The term "and / or" refers to any one, any two, any three, any more or all of the listed alternative elements.

[0034] The terms "comprising", "including", "having" mean "including but not limited to", but also cover the situation consisting only of the listed elements.

[0035] The term "gRNA" refers to a guide RNA sequence used to target a specific polynucleotide sequence, which can specifically bind or hybridize with the target nucleic acid sequence. For example, the sequence of the gRNA can be 20 nucleotides before the PAM (protospacer adjacent motif) sequence in the targeted genomic DNA.

[0036] The term "Cas9" or "Cas9 protein" refers to an enzyme that cleaves nucleic acids, which is derived from or originated from the CRISPR / Cas system of bacteria or archaea. Cas9 includes wild-type Cas9 protein and its functional and non-functional mutants. The Cas9 protein can interact with the gRNA and co-localize with the gRNA molecule at the site containing the target sequence and the PAM sequence.

[0037] The term "single-base editing element" refers to any protein, enzyme, or peptide that can achieve single-base directional conversion within an editing window (e.g., the 4th to 7th bases away from the PAM end of the gRNA) without generating DNA double-strand breaks with the assistance of a protein with single-strand cleavage function (such as Cas9 protein). For example, the exemplary single-base editing element ABE (adenine base editor) is any protein, enzyme, or peptide that can achieve the directional conversion of base A (e.g., to G).

[0038] For example, the single-base editing element used in the embodiments of the present application is ABE, which is an adenine deaminase (TadA) and acts in the form of a fusion protein with Cas9 protein to achieve the conversion of base A to base G. However, those skilled in the art are aware that the single-base editing element can also be an editing element acting on other bases, or can be other types of elements acting on base A; the single-base editing element can form a fusion protein with Cas9 or act together with Cas9 in the form of a non-fusion protein to achieve the specified single-base editing effect.

[0039] The term "knockout" refers to the elimination of a gene, or the elimination of gene expression, or the loss of function of the gene expression product. For example, knockout can be achieved by mutating the start codon sequence in the gene so that the gene cannot be translated into a protein after transcription.

[0040] The present application provides a vector system for knocking out the cpxA gene, which encodes a universal gRNA (sequence: 5'-NNNNATGATCAACAGTTTGA-3', SEQ ID No: 3), Cas9 protein, and a single-base editing element. The vector system can be used to knock out the cpxA gene in any cell containing the cpxA gene. In some embodiments, the vector system is a dual-vector system, which includes recombinant plasmids P25A-ABE and P26D-U-gRNA, where P25A-ABE( Figure 1 ) encodes the single-base editing element ABE, xCas9 protein, and carries a sucrose-sensitive gene for the removal of this plasmid after gene editing; P26D-U-gRNA( Figure 2 ) encodes the universal gRNA and carries a temperature-sensitive replicon pSC101 expression system for the removal of this plasmid after gene editing. This vector system achieves the conversion of the start codon sequence ATG of the cpxA gene to GTG, so that the gene can only be transcribed and cannot be translated into a protein, thus achieving the knockout effect.

[0041] However, those skilled in the art should be aware that any vector system encoding the universal gRNA (SEQ ID No: 3), Cas9 protein, and single-base editing element described in this application can achieve the knockout of the cpxA gene, not limited to the above dual-vector system. Those skilled in the art also know that the vector system can contain any suitable type of marker gene for removing the vector system after gene editing, not limited to the above sucrose-sensitive gene and temperature-sensitive replicon pSC101 expression system.

[0042] This application also provides a method for knocking out the cpxA gene in target cells using the above vector system. In some embodiments, the target cells are Serratia marcescens. In some embodiments, the method for knocking out the cpxA gene comprises the following steps: simultaneously introducing plasmid P26D-U-gRNA and P25A-ABE into Serratia marcescens to be knocked out of the cpxA gene, obtaining transformants by double induction of IPTG and L-arabinose expression, determining the successful point mutation by sanger sequencing, and using the temperature-sensitive replicon and sucrose-sensitive gene to remove the two tool plasmids to achieve scarless point mutation knockout.

[0043] However, those skilled in the art should be aware that the method described in this application can achieve the knockout of the cpxA gene in any target cells, not limited to the above-mentioned Serratia marcescens.

[0044] This application also provides a Serratia marcescens mutant strain prepared using the above method, the application of the above vector system in knocking out the cpxA gene in target cells, and a method for constructing the above vector system.

[0045] The following examples facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are all conventional methods unless otherwise specified.

[0046] The reagents, consumables, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0047] The vector xCas9(3.7)-ABE(7.10) used as the amplification template for ABE-xCas9 in the following examples is from addgene (www.addgene.org, Plasmid #108382).

[0048] Example 1. Construction of Recombinant Vector P25A-ABE

[0049] 1. Amplification and Cloning of ABE-xCas9 Fragment

[0050] Using the xCas9 (3.7) -ABE (7.10) vector as a template, Primer 5.0 was used to design primers P1 (5'-AAGCAGTGCTTCAGTCTCCACCGAGCTGA-3', SEQ ID No: 4) and P2 (5'-AAAAATGTCCGAAGTCGAGTTT-3', SEQ ID No: 5), and high-fidelity PCR was performed to amplify the fragment F1. The reaction was pre-denatured at 95°C for 2 minutes; 30 cycles (98°C for 10 seconds, 55°C for 5 seconds, 72°C for 4 minutes); 72°C extension for 5 minutes. Then 1% agarose gel electrophoresis was used to detect the band size, and the gel was cut to recover the fragment, and the concentration was determined for later use.

[0051] 2. Fragment amplification and cloning of P25A vector after removing SpCas9

[0052] Using P25A vector (referring to pHCY-25A vector, which was purchased from Qingdao Kingstar Biotechnology Co., Ltd.) as a template, the fragments except SpCas9 were divided into two segments and cloned separately. Primer 5.0 software was used to design primers P3 (5'-TGTCGCCCTTAAACAGACGAAGAATCCATGG-3', SEQ ID No: 6) and P4 (5'-TGGAGACTGAAGCACTGCTTCCGGTAGTC-3', SEQ ID No: 7), P5 (5'-CTCGACTTCGGACATTTTTTATAACCTCCTTAGAGCTCG-3', SEQ ID No: 8) and P6 (5'-TCGTCTGTTTAAGGGCGACACGGCTGAT-3', SEQ ID No: 9), and high-fidelity PCR was performed to amplify fragments F2 and F3, respectively. The reaction was pre-denatured at 95°C for 2 min; 30 cycles (98°C for 10 s, 55°C for 5 s, 72°C for 4 min); and extended at 72°C for 5 min. Then 1% agarose gel electrophoresis was performed to detect the band size ( Figure 3 ), and cut the gel to recover the fragments, and determine the concentration for later use.

[0053] 3. Construction of recombinant vector P25A-ABE ( Figure 1 )

[0054] Take the above-mentioned cloned gene fragments F1 (100ng), F2 (80ng), and F3 (40ng) respectively, mix them evenly, add them to 20μl Gibson assembly system, incubate them at 50℃ for 15min, and immediately cool them on ice. Thaw the chemically competent E. coli cells for cloning on ice. Take 5-10μl of the recombinant product and add it to 100μl competent cells, flick the tube wall to mix evenly (do not oscillate to mix evenly), and let it stand on ice for 30min. Heat shock in a 42℃ water bath for 90sec, and immediately cool it on ice for 2-3min. Add 900μl LB liquid culture medium (without antibiotics), and shake the bacteria at 37℃ for 1h (speed 200-250rpm). Preheat the kanamycin-resistant LB solid culture medium plate in a 37℃ incubator. Centrifuge at 5,000rpm (2,500×g) for 5min, and discard 900μl of supernatant. Resuspend the bacteria with the remaining culture medium and spread it evenly on the plate with the correct resistance using a sterile spreader. After inverted culture in a 37°C incubator for 12-16 hours, pick a single colony and place it in kanamycin-resistant liquid LB, shake the bacteria for 1-2 hours, verify the positive clones by PCR amplification, and perform Sanger sequencing on the verified bacterial solution to verify that the sequence has no mutations.

[0055] Example 2. Construction of universal recombinant vector P26D-U-gRNA vector

[0056] 1. Construction of specific P26D-gRNA0 (suitable for cpxA gene knockout of Serratia marcescens) vector

[0057] Using the P26D vector (referring to pHCY-26D vector, which was purchased from Qingdao Kingstar Biotechnology Co., Ltd.) as a template, gRNA (5'-CAACATGATCAACAGTTTGA-3', SEQ ID No: 10) was inserted into the sgRNAfold position, and the primer P7 (5'-GGGTTCCGCGGCACAGATGCGTAAGGAGA-3', SEQ ID No: 10) was designed using Primer 5.0 software.

[0058] SEQ ID No: 11) and P8 (5'-TCAAACTGTTGATCATGTTGATGGAGAAACAGTAGAGAGTTGC-3', SEQ ID No: 12), P9 (5'-

[0059] CAACATGATCAACAGTTTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG-3',

[0060] SEQ ID No: 13) and P10 (5'-GCATCTGTGCCGCGGAACCCCTATTTGTTT-3', SEQ ID No: 14), respectively, high-fidelity PCR amplification fragments F4 and F5, the reaction was pre-denatured at 95°C for 2 minutes; 30 cycles (98°C for 10 seconds, 55°C for 5 seconds, 72°C for 3 minutes); 72°C extension for 5 minutes. Then 1% agarose gel electrophoresis was used to detect the band size, and the gel was cut to recover the fragments, and the concentration was determined for use.

[0061] 2. Construction of specific P26D-gRNA by Gibson assembly method

[0062] Take the above-mentioned cloned gene fragments F4 (30ng) and F5 (60ng) respectively, mix them and add 20μl Gibson assembly system. After incubation at 50℃ for 5min, immediately put them on ice to cool down. Thaw the chemical competent E. coli cells for cloning on ice. Take 5-10μl of the recombinant product and add it to 100μl competent cells. Tap the tube wall to mix (do not oscillate to mix), and let it stand on ice for 30min. Heat shock in a 42℃ water bath for 90sec, and immediately put it on ice to cool down for 2-3min. Add 900μl LB liquid culture medium (without antibiotics) and shake the bacteria at 37℃ for 1h (speed 200-250rpm). Preheat the LB solid culture medium plate with apramycin resistance in a 37℃ incubator. Centrifuge at 5,000rpm (2,500×g) for 5min and discard 900μl supernatant. Resuspend the bacteria with the remaining culture medium and gently spread it on the plate containing the correct resistance with a sterile coating rod. After inverted culture in a 37°C incubator for 12-16 hours, pick a single colony and place it in apramycin-resistant liquid LB, shake the bacteria for 1-2 hours, verify the positive clones by PCR amplification, and perform Sanger sequencing on the verified bacterial solution to verify that the sequence has no mutation.

[0063] 3. Universal recombinant vector P26D-U-gRNA ( Figure 2 )Build

[0064] Replace the gRNA (SEQ ID No: 10) in the above specific P26D-gRNA0 with the universal gRNA (SEQ ID No: 3) of the present application, and design alternative loop primers P11 (5’-NNNNATGATCAA CAGTTTGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAG-3’, SEQ ID No: 15) and P12 (5’-TCAAACTGTTGATCATNNNNATGGAGAAACAGTAGAGAGTTGC-3’, SEQ ID No: 16). Using the specific P26D-gRNA0 plasmid as a template, perform high-fidelity PCR amplification. The reaction is pre-denatured at 95°C for 2 min; 30 cycles (98°C for 10 s, 55°C for 5 s, 72°C for 4 min); extended at 72°C for 5 min. Then, detect the band size by 1% agarose gel electrophoresis, cut the gel and recover the fragment, and measure the concentration for later use respectively.

[0065] Take 5 μl of the above recovered product and add it to 100 μl of competent cells. Gently flick the tube wall to mix evenly (do not shake to mix), and let it stand on ice for 30 min. After heat shock in a 42°C water bath for 90 sec, immediately place it on ice to cool for 2 - 3 min. Add 900 μl of LB liquid medium (without adding antibiotics), and shake the bacteria at 37°C for 1 h (rotation speed 200 - 250 rpm). Preheat the LB solid medium plate with apramycin resistance in a 37°C incubator. Centrifuge at 5,000 rpm (2,500×g) for 5 min, and discard 900 μl of the supernatant. Resuspend the bacterial cells with the remaining medium, and gently spread them evenly on the plate with the correct resistance using a sterile spreading rod.

[0066] After inverted culture in a 37°C incubator for 12 - 16 h, pick a single colony into apramycin-resistant liquid LB, shake the bacteria for 1 - 2 h, and verify by PCR and sanger sequencing.

[0067] Example 3. Site-directed mutation knockout of the cpxA gene of Serratia marcescens clinical isolates

[0068] 1. Strain evaluation

[0069] After receiving the bacterial strain, inoculate it into 3 mL of liquid medium and incubate it at 37°C and 200 rpm in a shaker for constant temperature activation. Since a vector needs to be constructed later, it is necessary to verify the antibiotic sensitivity of the strain. Take 1 μL of the above cultured bacterial liquid and inoculate it into 1 mL of LB liquid medium containing neomycin sulfate (50 μg / mL) and apramycin (50 μg / mL) respectively, and use the antibiotic-free medium as an experimental control. Incubate it at a constant temperature in a shaker for 4 h, and then compare the OD values of the media to determine that the strain is sensitive to both neomycin sulfate (50 μg / mL) and apramycin (50 μg / mL).

[0070] 2. Preparation of Competent Cells of Serratia marcescens by Electrotransformation

[0071] Streak the target strain picked on a solid LB culture dish. After it grows, inoculate the monoclonal into 3 mL of liquid medium and incubate the inclined test tube at 37 °C and 200 rpm in a shaker overnight; Take 1 mL of the overnight culture and transfer it to a 500 mL Erlenmeyer flask containing 100 mL of medium, and add EDTA to 0.7 mM. Place it in a shaker and culture at 37 °C and 200 rpm. When the OD reaches about 0.6, competent cells can be prepared; When it grows to the corresponding concentration, take out the Erlenmeyer flask and quickly place the Erlenmeyer flask containing the culture broth into the pre-prepared ice box and ice-bath for 30 minutes. To ensure that the culture broth in the Erlenmeyer flask can be quickly cooled to ensure the maximum transformation efficiency, we need to shake the Erlenmeyer flask in the ice box from time to time; After the culture broth in the Erlenmeyer flask is completely cooled, prepare to pre-cool 50 mL EP tubes in the ice box in the laminar flow hood in advance, and then add the ice-bathed culture broth to the pre-cooled 50 mL EP tubes respectively. After balancing the 50 mL EP tubes on the balance, place them in a refrigerated centrifuge at 4 °C and centrifuge at the maximum speed for 5 minutes. After centrifugation, take out the 50 mL EP tubes from the centrifuge and place them in the ice box, and discard the residual medium in the supernatant; After the residual liquid is completely discarded, suspend the precipitate with ddH2O (gently pipette repeatedly until resuspended), cover the lid of the 50 mL EP tube, and centrifuge it, so as to wash once. Then repeat the washing twice with 15 mL of 10% glycerol. After washing, open the lid of the 50 mL EP tube, discard the supernatant, and invert it for a while to ensure that the residual liquid is completely discarded; Add 1 mL of 10% glycerol, gently shake it, do not shake the cells too vigorously, and gently suspend the precipitated bacteria. After aliquoting 100 μL per portion, write the corresponding label of the competent cells and the time of preparing the competent cells, and then quickly freeze them in liquid nitrogen to obtain several times the transformation efficiency, and then store them at -80 °C for later use.

[0072] 3. Electrotransformation (Bio-Rad MicroPulser Electroporator)

[0073] Mix no less than 100 ng of plasmid (P25A-ABE or P26D-U-gRNA) with competent cells, add to a pre-chilled electroporation cuvette (0.1 cm), let stand on ice for 10 minutes, then electroporate under the conditions of 2.4 KV and automatic time. Immediately add antibiotic-free LB medium and transfer to an EP tube, then place on a shaker and culture for 2 h. The electroporation cuvette is repeatedly rinsed with 75% alcohol and soaked for long-term standby. Centrifuge at 5,000 rpm (2,500×g) for 5 min and discard the supernatant. Resuspend the bacteria in the remaining medium and gently spread evenly on a plate containing the correct antibiotic resistance with a sterile spreading rod. Incubate upside down in a 37°C incubator for 12 - 16 h, then pick single colonies into antibiotic-resistant liquid LB and shake the bacteria for 1 - 2 h. Verify the positive transformants by PCR. Finally, after introducing both plasmids into Serratia marcescens, store the strains for later use.

[0074] 4. Induced expression

[0075] Obtain co-transformed strains of P25A-ABE and the universal P26D-U-gRNA by electroporation, streak on an LB (neomycin sulfate + apramycin) plate, and culture at 30°C. When the colonies grow, pick 7 - 8 colonies from the plate and inoculate them into 2 ml of antibiotic-containing LB, culture at 30°C for 1 h, then add 20 μl of IPTG (100 mM), culture at 30°C for 1 h, then add L-arabinose (final concentration 2%), culture at 30°C for 5 h. Dilute the bacterial solution 100-fold, take 100 μl of the diluted bacterial solution and spread it on an LB (neomycin sulfate + apramycin + L-arabinose) plate, culture at 30°C. After the colonies grow, perform PCR amplification and then send the samples for sequencing verification ( Figure 4 ).

[0076] 5. Removal of the dual tool plasmids

[0077] If a new round of gene editing is not planned and the dual plasmids need to be eliminated, the successfully edited colonies can be inoculated into 2 ml of LB without antibiotics and cultured overnight at 37°C for 12 - 16 h. Then take 2 μl of the bacterial solution and streak it on an LB plate containing 1% sucrose, and culture at 37°C. Most of the colonies that grow on the plate have lost the dual plasmids. After verification by PCR, retain the strains with successful elimination of the dual plasmids for subsequent experiments.

[0078] Example 4. Drug sensitivity analysis after point mutation of the cpxA gene in a clinical isolate of Serratia marcescens

[0079] Use the Meihua microbial identification and drug sensitivity analyzer MA120 and its supporting Enterobacter drug sensitivity analysis kit to analyze the drug resistance of the strain after the start codon of the point mutation gene cpxA. This detection technology uses multi-CCD photosensitive detection, colorimetric + turbidimetric detection technology, and the algorithm is the dual matrix method plus the probability method, which can ensure the accuracy of the results.

[0080] The specific process is as follows: Dilute the bacterial liquid sample to a turbidity of 0.5 McFarland units using the diluent in the kit; Take 50 μL of the diluent and add it to the MH broth solution and mix well; Take 100 μL of the mixed solution and add it to the 96-well plate in which the detection reagent has been embedded; Seal the film, put the 96-well plate into the analytical instrument for detection and reading the plate, and the specific results are shown in Table 1.

[0081] Table 1 Drug sensitivity analysis of clinical isolates of Serratia marcescens before and after point mutation

[0082]

[0083] The nucleotide sequence of the cpxA gene involved in this application is as follows:

[0084] SEQ ID No:1 (Wild-type cpxA gene in Serratia marcescens and 4 bases before this gene)

[0085] caacatgatcaacagtttgacggcacgcatcttcgccattttctggttcacgttagccttggtgctaatgctggtgctgatggtgccca

[0086] agctcgactcccgccagatgacctcattgctcgacagcgagcagcggcaggggttgatgctggaacagcacgtcgaggccgagttgc

[0087] aaaacgatccggccaacgatctgatgtggtggcgccgcctgttccgcgccatcgacaaatgggcgccgccgggccagcgcctgctgc

[0088] tggtcaccagcgaaggccgggtgatcggcgcgcagcgcaacgaaatgcagatcgtccgcaacttcatcggccaatccgacaactcgg

[0089] atcatcccaagaagaaaaagtacggccgcgtcgagctggtcgggccgttcgcggtgcgcgacggcgaagacaactaccagctgtacc

[0090] tgatccgtcccgccaacagcccgcaatccgatttcatcaacctgatgttcgaccggccgctgctgctgctgatcgtcaccatgctgatcag

[0091] cgccccgctgctgctgtggctggcctggagcctggcgaaaccggctcgcaagctgaagaacgccgccgatgacgtggcgcgcggca

[0092] acctgaagcagcatccggaactggaggccggcccgcaggagttcctggccaccggcgccagcttcaaccagatggtcagcgcgctg

[0093] gaacgcatgatgaacgcccagcaacggttgatctcggacatctcgcacgagctgcgcacgccgctgactcgcctgcagctggccacc

[0094] gcgctgatgcgccgccgccacggcgaaggccacgagctggcgcgcatcgaaaccgaagcgcaacggctggattcgatgatcaacg

[0095] atctgctggcgctgtcgcgcgggcagcaaaagggcgagctggcgcgcgagcagttgaaggccaacgaactgtgggccgacgtgctg

[0096] gataacgcccgtttcgaagccgaacagatgggcaagcagttggagatcgctgcgccgcccggcccgtggacgctgttcggcaacgcg

[0097] agcgcgctggacagcgcgttggaaaacatcgtgcgcaacgccctgcggtattcacacacccgcatcgccgtggcgttcagcgccgac

[0098] aatcagggcgtgaccatccaggttgacgacgacggccccggcgtcagcgccgaagaccgcgagcagatcttccgtccgttctaccgc

[0099] accgatgaggcgcgcgaccgtgagtccggcggcaccggccttggcctggctatcgtcgaggcggcggtcaatcagcatcgcggctg

[0100] ggtgaaggccgaagacagcccgcttggcggtctgcggctggtgctgtggctgccgctgcatcatcaacgcctatcgtctaagacagaa

[0101] cagtaa

[0102] SEQ ID No:2 (cpxA gene with point mutations in Serratia marcescens and the 4 bases before this gene, where the bold and underlined bases are the mutation sites)

[0103] caac g

[0105] Although the above refers to particular preferred embodiments, it should be understood that the present invention is not limited thereto. Those of ordinary skill in the art will recognize that various modifications can be made to the disclosed embodiments, and such modifications are also intended to fall within the scope of the present invention.

Claims

1. A vector system for knocking out the cpxA gene, which encodes a universal gRNA shown in SEQ ID No: 3, a Cas9 protein, and a base editing element.

2. The vector system according to claim 1, wherein the nucleotide sequence of the cpxA gene is positions 5 - 1399 in SEQ ID NO:

1.

3. The vector system according to claim 1, wherein the Cas9 protein is xCas9(3.7).

4. The vector system according to claim 1, wherein the base editing element is ABE.

5. The vector system according to any one of claims 1 - 4, wherein the knockout includes introducing a point mutation into the start codon sequence in the cpxA gene.

6. The vector system according to claim 5, wherein the point mutation includes mutating the start codon sequence from ATG to GTG.

7. The vector system according to any one of claims 1 - 4, which comprises one or more marker genes for removing the vector system.

8. The vector system according to any one of claims 1 - 4, which is a dual - vector system.

9. The vector system according to claim 8, wherein one vector in the dual - vector system encodes the Cas9 protein and the base editing element, and the other vector encodes the universal gRNA.

10. The vector system according to claim 8, wherein both dual - vectors comprise marker genes for removing the vectors.

11. The vector system according to claim 9, wherein the vector encoding the Cas9 protein and the base editing element further comprises a sucrose - sensitive gene.

12. The vector system according to claim 9, wherein the vector encoding the universal gRNA further comprises a temperature - sensitive replicon pSC101 expression system.

13. A method for knocking out the cpxA gene in a target cell, which comprises introducing the vector system according to any one of claims 1 - 12 into the target cell.

14. The method according to claim 13, wherein the knockout includes introducing a point mutation into the start codon sequence in the cpxA gene.

15. The method according to claim 13, wherein the point mutation includes mutating the start codon sequence from ATG to GTG.

16. The method according to any one of claims 13 - 15, wherein the target cell is Serratia marcescens.

17. The method according to any one of claims 13 - 15, which comprises inducing the expression of the vector system using IPTG and L - arabinose.

18. A Serratia marcescens mutant strain, which contains a cpxA gene with a point mutation, and the nucleotide sequence of the cpxA gene with the point mutation is positions 5 - 1399 in SEQ ID NO:

2.

19. The Serratia marcescens mutant strain according to claim 18, wherein the cpxA gene with the point mutation does not express the CpxA protein.

20. The Serratia marcescens mutant strain according to claim 18 or 19, which is prepared by the method according to any one of claims 13 - 17.

21. The Serratia marcescens mutant strain according to claim 18 or 19, which contains or does not contain the vector system according to any one of claims 1-12.

22. Use of the vector system according to any one of claims 1-12 in knocking out the cpxA gene in a target cell.

23. The use according to claim 22, wherein the target cell is Serratia marcescens.

24. A method for constructing the vector system according to any one of claims 1-12, which includes replacing the sequence encoding SpCas9 in the pHCY-25A vector with a nucleotide sequence encoding a Cas9 protein and a single-base editing element, and which further includes introducing a nucleotide sequence encoding the universal gRNA shown in SEQ ID No: 3 into the pHCY-26D vector.

25. The method according to claim 24, wherein the Cas9 protein is xCas9(3.7), and / or the single-base editing element is ABE.

26. The method according to claim 24 or 25, wherein the pHCY-25A vector contains a sucrose-sensitive gene, and / or the pHCY-26D vector contains a temperature-sensitive replicon pSC101 expression system.

Images