Method for increasing weight of domestic rabbits based on gene editing technology

Abstract

The invention is applicable to the technical field of rabbit breeding, and provides a method for increasing the body weight of a rabbit based on a gene editing technology, which comprises the following steps: designing an action target sgRNA on a rabbit NR6A1 gene aiming at an NR6A1 p.P192S site; uniformly mixing the synthesized sgRNA and SpRY-CBE, injecting fertilized eggs, transplanting the fertilized eggs into fallopian tubes of receptor female rabbits, and feeding the receptor female rabbits until production; dNA is extracted from produced young rabbit ear tissues, PCR and sequencing are carried out, and if C at the fifth site in NR6A1 gene target sites is mutated into T, it is proved that single base mutation is obtained, and the NR6A1 gene edited rabbit is obtained. According to the invention, the rabbit variety with increased weight is successfully cultivated; a new thought of animal genetic breeding is developed by utilizing a gene editing technology, the method has application values in promoting improvement of genetic characters of rabbits and improving production performance and economic value of the rabbits, and powerful support is provided for high-quality development of the animal breeding industry in China.

Description

Technical Field

[0001] The present invention belongs to the technical field of rabbit breeding, and particularly relates to a method for increasing the body weight of domestic rabbits based on gene editing technology. Background Art

[0002] Domestic rabbits are common and important economic livestock in China. As herbivores, they have a wide range of feed sources. They can eat green grass, hay, wild vegetables, and can also make full use of unconventional feeds such as agricultural crop by-products, reducing feed grain consumption. Moreover, the breeding sites are flexible, and slopes, hilly lands, and even idle courtyard lands can be utilized, with little demand for cultivated land, highlighting the characteristics of saving grain and land, and being able to better ensure China's food security. At the same time, domestic rabbits can provide high-quality meat, skin, and hair products, which are closely related to human health and quality of life, and occupy an important position in the modern agricultural industrial technology system.

[0003] However, in the process of pursuing the maximization of rabbit breeding benefits, traditional breeding methods face many bottlenecks. With the rapid development of modern biotechnology, the cultivation of animal improved varieties has entered the era of molecular breeding, aiming to quickly change genotypes, but there are still deficiencies in the existing technologies. Although new gene editing technologies such as the SpRY-CRISPR / Cas9 gene editing system have achieved unrestricted PAM mutations and broadened the scope of precise editing, providing a relatively good tool for rabbit gene editing, there is still no mature and effective method for precisely and efficiently editing key genes related to rabbit growth and development to significantly improve important economic traits such as body weight. For example, the gene encoding the protein nuclear receptor subfamily 6 group A member 1 (NR6A1) is known to be closely related to the number of animal vertebrae and carcass growth and development, and is regarded as a candidate gene related to the number of vertebrae in pig breeding research. However, at present, the industry has not fully explored the potential of this gene, and has not been able to effectively transform the key information related to it into a practical method to increase the body weight of domestic rabbits and improve the genetic characteristics of domestic rabbits. Therefore, the present invention proposes a method for increasing the body weight of domestic rabbits based on gene editing technology. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for increasing the body weight of domestic rabbits based on gene editing technology, aiming to solve the problems raised in the above background art.

[0005] The purpose of the present invention is achieved through the following technical solutions: A method for increasing the body weight of domestic rabbits based on gene editing technology, comprising the following steps: Step S1: Transcription and synthesis of SpRY-CBE mRNA; The SpRY-CBE expression plasmid was digested overnight with enzymes to form linear DNA, which was recovered by electrophoresis and then purified for the transcription synthesis of SpRY-CBE mRNA. The nucleotide sequence of the SpRY-CBE expression plasmid is shown in SEQ ID NO.1. Step S2: Design and synthesis of sgRNA for the rabbit NR6A1 p.P192S site On the rabbit NR6A1 gene, a sgRNA targeting the NR6A1 p.P192S site was designed. The nucleotide sequence of the NR6A1 gene is shown in SEQ ID NO.2. The sequence of the sgRNA oligonucleotide chain is as follows: sgRNA-F: TTCACCAGGTTCCACACTGT, specifically shown in SEQ ID NO.3. sgRNA-R: ACAGTGTGGAACCTGGTGAA, specifically shown in SEQ ID NO.4. Step S3: Preparation of NR6A1 gene-edited rabbits by embryo microinjection technology The synthesized sgRNA and SpRY-CBE mRNA were mixed and injected into fertilized eggs, which were then transplanted into the oviduct of recipient female rabbits. The recipient female rabbits were raised until they gave birth. DNA was extracted from the ear tissues of the newborn rabbits, and PCR and sequencing were performed. If the C at the 5th position in the NR6A1 gene target site mutated to T, it was proved that a single-base mutation was obtained, that is, NR6A1 gene-edited rabbits were obtained.

[0006] Furthermore, the specific process of step S1 is as follows: The SpRY-CBE expression plasmid was digested overnight with enzymes at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction, and then the purified linear DNA was used as a template for the transcription synthesis of SpRY-CBE mRNA. The digestion system was: AgeI 1 μL; xBaI 1 μL; SpRY-CBE plasmid 20 μL; rCut Smart Buffer 10 μL; ddH2O 18 μL. The transcription synthesis system was: linear SpRY-CBE 1.5 μg; NTP Buffer 10 μL; T7 RNA polymerase 2 μL; ddH2O 6 μL. The specific operation of transcription synthesis was: after mixing, incubate at 37°C for 1 h. After transcription was completed, 1 μL of DNaseI was added to digest the transcription template, and the reaction was carried out at 37°C for 15 min, and then a polyA tail was added.

[0007] Furthermore, in step S3, the PCR primers are as follows: Forward primer: CCACTCCTCAAACTGGACATT, specifically as shown in SEQ ID NO.5; Reverse primer: GCTCAGAATTCCTTAGGTCCTTTA, specifically as shown in SEQ ID NO.6; The PCR reaction system is as follows: 1 μL of template DNA; 1.5 μL of forward primer; 1.5 μL of reverse primer; 12.5 μL of 2×Taq plus; 8.5 μL of ddH2O; The PCR reaction conditions are as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

[0008] Compared with the prior art, the beneficial effects of the present invention are as follows: The present invention discloses a method for increasing the body weight of rabbits based on gene editing technology. By using the SpRY-CBE gene editing technology, a single-base mutation is performed on the rabbit NR6A1 p.P192S site to obtain a rabbit breed with increased body weight. The present invention exploits a new idea for animal genetic breeding by using gene editing technology, has application value in promoting the improvement of rabbit genetic traits, enhancing rabbit production performance and economic value, and provides strong support for the high-quality development of China's animal breeding industry. Brief Description of the Drawings

[0009] Figure 1 It is a schematic diagram of the design of sgRNA.

[0010] Figure 2 It is a sanger sequencing map of the NR6A1 gene mutation in newborn rabbits.

[0011] Figure 3 It is the statistical analysis result of the body weights of 5-month-old normal rabbits and gene-edited rabbits.

[0012] Figure 4 It is the comparison of the body shapes of 5-month-old normal rabbits and gene-edited rabbits. Detailed Embodiments

[0013] For a clearer understanding of the technical features, objectives, and beneficial effects of the present invention, the technical solutions of the present invention are described in detail below, but it should not be construed as a limitation on the implementable scope of the present invention.

[0014] The present invention provides a method for increasing the body weight of rabbits based on gene editing technology, and the method includes the following steps: Step S1: Transcriptional synthesis of SpRY-CBE mRNA; The SpRY-CBE expression plasmid (preserved in our laboratory, whose nucleotide sequence is shown in SEQ ID NO.1) was digested overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction, and then according to the instructions of the in vitro transcription kit, the purified linear DNA was used as a template for the transcription synthesis of SpRY-CBE mRNA.

[0015] The digestion system was as follows: AgeI 1 μL; xBaI 1 μL; SpRY-CBE plasmid 20 μL; rCut Smart Buffer 10 μL; ddH2O 18 μL.

[0016] The transcription synthesis system was as follows: linear SpRY-CBE 1.5 μg; NTP Buffer 10 μL; T7 RNA polymerase 2 μL; ddH2O 6 μL.

[0017] The specific operation of transcription synthesis was as follows: after mixing, incubate at 37°C for 1 h. After transcription was completed, 1 μL of DNaseI was added to digest the transcription template, and the reaction was carried out at 37°C for 15 min, and then the polyA tail was added.

[0018] Step S2: Design and synthesis of sgRNA for the rabbit NR6A1 p.P192S site; On the rabbit NR6A1 gene (the nucleotide sequence of the NR6A1 gene is shown in SEQ ID NO.2), a targeting sgRNA was designed for the NR6A1 p.P192S (NR6A1 p.Pro192Ser) site. The sequence of the sgRNA oligonucleotide chain was as follows: sgRNA-F: TTCACCAGGTTCCACACTGT (shown in SEQ ID NO.3); sgRNA-R: ACAGTGTGGAACCTGGTGAA (shown in SEQ ID NO.4); The principle for selecting the sgRNA oligonucleotide chain was: select an sgRNA oligonucleotide chain with the mutation base position at the 5th position, as Figure 1 shown, and the sgRNA was rapidly synthesized through a commercial chemical synthesis platform (GenScript Biotech Corporation).

[0019] SEQ ID NO.1:

[0020] SEQ ID NO.2: AGGCCAATCACTGGAGCAACCATGGTGACAGTGATCACAGTTCCCCTGGAAACAGGGCTTCAGAGAGCAACCAGCCTTCACCAGGTTCCACACTGTCCTCCAGGTCTGTGGAACTAAATGGATTCATGGCATTCAGGGAGCAGTATGTGGGGATGTCCGTT。

[0021] Step S3: Preparation of NR6A1 gene - edited rabbits by embryo microinjection technique; Using a microinjector, after mixing 15 ng / μL of the synthesized sgRNA and 80 ng / μL of SpRY - CBE, aspirate 3 μL into the injection needle and perform embryonic cell nucleus injection. The fertilized eggs after injection are transplanted into the oviducts of synchronized recipient female rabbits. The recipient female rabbits are provided with sufficient water and food until they give birth.

[0022] Extract DNA from the ear tissues of the newborn rabbits. The extraction method is operated according to the kit instructions (purchased from Tiangen Biotech Co., Ltd., Beijing, China). Then, perform PCR using the designed PCR primers. After completing PCR, perform electrophoresis identification. If the PCR amplification is successful, send the PCR product to Sangon Biotech Co., Ltd. for DNA sequencing to screen for NR6A1 gene - edited rabbits.

[0023] The designed PCR primers are as follows: Forward primer: CCACTCCTCAAACTGGACATT (as shown in SEQ ID NO.5); Reverse primer: GCTCAGAATTCCTTAGGTCCTTTA (as shown in SEQ ID NO.6); The PCR reaction system is: template DNA 1 μL; forward primer 1.5 μL; reverse primer 1.5 μL; 2×Taq plus 12.5 μL; ddH2O 8.5 μL.

[0024] The PCR reaction conditions are: pre - denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

[0025] The specific operation for screening NR6A1 gene - edited rabbits is: check the sequencing results. If the C at the 5th position in the NR6A1 gene target site mutates to T, it proves that a single - base mutation is obtained. As Figure 2 shown, the C at the 5th position in the NR6A1 gene target site mutates to T, and NR6A1 gene - edited rabbits are obtained.

[0026] The specific implementation of the present invention will be described in detail below in conjunction with specific embodiments.

[0027] Example 1: Verification of weight gain in NR6A1 gene-edited rabbits; To explore the effect of NR6A1 gene editing on the growth status of rabbits, in this example, adult 5-month-old normal rabbits (WT) and NR6A1 gene-edited rabbits were selected, and their weights and body sizes were compared and statistically analyzed.

[0028] From Figure 3 the weight data, it can be seen that the weight of the NR6A1 gene-edited rabbits is significantly higher than that of the normal rabbits, showing a significant difference. Further combining Figure 4 the comparison of the body sizes of normal rabbits and NR6A1 gene-edited rabbits (NR6A1-1 and NR6A1-2) in

[0029] it can be found that the body sizes of the NR6A1 gene-edited rabbits are also significantly larger than those of the normal rabbits, fully indicating that the NR6A1 gene-edited rabbits are superior to the normal rabbits in terms of growth traits.

[0030] The above is only the preferred implementation mode of the present invention. It should be pointed out that for those skilled in the art, without departing from the concept of the present invention, several deformations and improvements can still be made, and these should also be regarded as the protection scope of the present invention, and these will not affect the implementation effect of the present invention and the practicality of the patent.

Claims

1. A method for increasing the body weight of rabbits based on gene editing technology, characterized in that, It includes the following steps: Step S1: Transcriptional synthesis of SpRY-CBE mRNA; The SpRY-CBE expression plasmid is digested overnight by enzymes to form linear DNA, which is recovered by electrophoresis and then purified for transcriptional synthesis of SpRY-CBE mRNA; the nucleotide sequence of the SpRY-CBE expression plasmid is shown in SEQ ID NO.1; Step S2: Design and synthesis of sgRNA for the rabbit NR6A1 p.P192S site; On the rabbit NR6A1 gene, a targeting sgRNA is designed for the NR6A1 p.P192S site; the nucleotide sequence of the NR6A1 gene is shown in SEQ ID NO.2; the sgRNA oligonucleotide chain sequence is as follows: sgRNA-F: TTCACCAGGTTCCACACTGT, specifically shown in SEQ ID NO.3; sgRNA-R: ACAGTGTGGAACCTGGTGAA, specifically shown in SEQ ID NO.4; Step S3: Preparation of NR6A1 gene-edited rabbits by embryo microinjection technology; The synthesized sgRNA and SpRY-CBE mRNA are mixed and then injected into fertilized eggs, which are transplanted into the oviduct of recipient female rabbits and the recipient female rabbits are raised until they give birth; DNA is extracted from the ear tissues of the newborn rabbits, PCR is performed and sequenced. If the C at the 5th position in the NR6A1 gene target site mutates to T, it proves that a single-base mutation is obtained, that is, NR6A1 gene-edited rabbits are obtained.

2. The method for increasing the body weight of rabbits based on gene editing technology according to claim 1, characterized in that The specific process of the above step S1 is as follows: The SpRY-CBE expression plasmid is digested overnight at 37°C by enzymes to form linear DNA, which is recovered by agarose gel electrophoresis. The recovered product is purified by chloroform extraction, and then transcriptional synthesis of SpRY-CBE mRNA is carried out using the purified linear DNA as a template; The digestion system is: AgeI 1μL; xBaI 1μL; SpRY-CBE plasmid 20μL; rCut Smart Buffer 10μL; ddH2O 18μL; The transcriptional synthesis system is: linear SpRY-CBE 1.5μg; NTP Buffer 10μL; T7 RNA polymerase 2μL; ddH2O 6μL; The specific operation of transcriptional synthesis is: after mixing, incubate at 37°C for 1h; after transcription is completed, add 1μL DNaseI to digest the transcription template, react at 37°C for 15min, and then add a polyA tail.

3. The method for increasing the body weight of rabbits based on gene editing technology according to claim 1, wherein, In the above step S3, the PCR primers are as follows: Forward primer: CCACTCCTCAAACTGGACATT, specifically shown in SEQ ID NO.5; Reverse primer: GCTCAGAATTCCTTAGGTCCTTTA, specifically shown in SEQ ID NO.6; The PCR reaction system is: template DNA 1μL; forward primer 1.5μL; reverse primer 1.5μL; 2×Taq plus 12.5μL; ddH2O 8.5μL; The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, extension at 72°C for 40 s; 38 cycles; extension at 72°C for 5 min.

Images