A method for increasing rabbit weight based on gene editing technology

Abstract

The present invention is applicable to the field of rabbit breeding technology and provides a method for increasing rabbit weight based on gene editing technology, comprising: designing a target sgRNA for the NR6A1 p.P192S site on the rabbit NR6A1 gene; mixing the synthesized sgRNA and SpRY‑CBE, injecting the resultant sgRNA into a fertilized egg, transplanting the mixture into the oviduct of a recipient female rabbit, and raising the recipient female rabbit until birth; extracting DNA from the ear tissue of the resulting young rabbit, performing PCR and sequencing, and if the C at position 5 in the NR6A1 gene target site mutates to T, a single base mutation is obtained, i.e., an NR6A1 gene-edited rabbit is obtained. The present invention successfully breeds a rabbit breed with increased weight; utilizing gene editing technology to develop new ideas for animal genetic breeding, has application value in promoting the improvement of rabbit genetic traits, enhancing rabbit production performance and economic value, and provides strong support for the high-quality development of my country's animal seed industry.

Description

Technical Field

[0001] The present invention belongs to the technical field of rabbit breeding, and in particular relates to a method for increasing the weight of rabbits based on gene editing technology. Background Art

[0002] Domestic rabbits are a common and important economic livestock in my country. As herbivores, they consume a wide range of feed sources, including grass, hay, and wild vegetables, as well as unconventional feeds such as crop by-products, reducing grain consumption. They also offer flexible breeding options, such as sloping and hilly land, and even vacant garden space. Rabbits require minimal arable land, conserving grain and land, and contributing significantly to my country's food security. Furthermore, rabbits provide high-quality meat, hide, and fur products, which are closely linked to human health and quality of life, and hold a crucial position in the modern agricultural industry and technology system.

[0003] However, in the pursuit of maximizing rabbit farming profitability, traditional breeding methods face numerous bottlenecks. With the rapid development of modern biotechnology, animal breeding is entering the era of molecular breeding, striving for rapid genotype modification. However, existing technologies still have shortcomings. Although new gene-editing technologies, such as the SpRY-CRISPR / Cas9 gene-editing system, enable unlimited PAM mutations, broaden the scope of precise editing, and provide relatively advanced tools for rabbit gene editing, there are still no mature and effective methods for precisely and efficiently editing key growth and development genes to significantly improve important economic traits such as body weight. For example, the gene encoding the protein nuclear receptor subfamily 6 group A member 1 (NR6A1) is known to be closely associated with vertebral number and carcass growth and development, and has been considered a candidate gene for vertebra number in pig breeding research. However, the potential of this gene has not yet been fully explored, and the relevant key information has not yet been effectively translated into practical methods to increase rabbit weight and improve rabbit genetic traits. To this end, the present invention proposes a method for increasing rabbit weight using gene-editing technology. Summary of the Invention

[0004] The purpose of the present invention is to provide a method for increasing the weight of rabbits based on gene editing technology, aiming to solve the problems raised in the above background technology.

[0005] The purpose of the present invention is achieved through the following technical solutions:

[0006] A method for increasing the weight of rabbits based on gene editing technology, comprising the following steps:

[0007] Step S1: transcription and synthesis of SpRY-CBE mRNA;

[0008] The SpRY-CBE expression plasmid was digested overnight to form linear DNA, which was recovered by electrophoresis and purified, and then transcribed and synthesized into SpRY-CBE mRNA; the nucleotide sequence of the SpRY-CBE expression plasmid is shown in SEQ ID NO.1;

[0009] Step S2: Design and synthesis of rabbit NR6A1 p.P192S site sgRNA;

[0010] A sgRNA targeting the rabbit NR6A1 gene p.P192S site was designed. The nucleotide sequence of the NR6A1 gene is shown in SEQ ID NO. 2. The sgRNA oligonucleotide sequence is as follows:

[0011] sgRNA-F: TTCACCAGGTTCCACACTGT, as shown in SEQ ID NO. 3;

[0012] sgRNA-R: ACAGTGTGGAACCTGGTGAA, as shown in SEQ ID NO. 4;

[0013] Step S3: Preparation of NR6A1 gene-edited rabbits using embryo microinjection technology;

[0014] The synthesized sgRNA and SpRY-CBE mRNA were mixed and injected into fertilized eggs, which were then transplanted into the oviducts of recipient rabbits. The recipient rabbits were raised until they gave birth. DNA was extracted from the ear tissues of the resulting pups, and PCR and sequencing were performed. If the C at position 5 in the NR6A1 gene target site mutated to T, it indicated a single-base mutation, indicating that an NR6A1 gene-edited rabbit was obtained.

[0015] Furthermore, the specific process of step S1 is as follows:

[0016] The SpRY-CBE expression plasmid was digested overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction, and then the purified linear DNA was used as a template for transcription and synthesis of SpRY-CBE mRNA.

[0017] The enzyme digestion system is: AgeI 1μL; xBaI 1μL; SpRY-CBE plasmid 20μL; rCut Smart Buffer 10μL; ddH2O 18μL;

[0018] The transcription synthesis system is: linear SpRY-CBE 1.5μg; NTP Buffer 10μL; T7 RNA polymerase 2μL; ddH2O 6μL;

[0019] The specific operation of transcription synthesis is as follows: after mixing, incubate at 37°C for 1 hour; after transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 minutes, and then add the polyA tail.

[0020] Furthermore, in step S3, the PCR primers are as follows:

[0021] Upstream primer: CCACTCCTCAAACTGGACATT, specifically as shown in SEQ ID NO.5;

[0022] Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA, specifically as shown in SEQ ID NO.6;

[0023] The PCR reaction system was as follows: template DNA 1 μL; upstream primer 1.5 μL; downstream primer 1.5 μL; 2× Taq plus 12.5 μL; ddH2O 8.5 μL;

[0024] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 40 s; 38 cycles; and extension at 72°C for 5 min.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention discloses a method for increasing rabbit weight based on gene editing technology. Using SpRY-CBE gene editing technology, a single-base mutation is performed at the p.P192S site of the rabbit NR6A1 gene to obtain a rabbit breed with increased weight. This method utilizes gene editing technology to develop new approaches to animal genetic breeding. It has application value in promoting the improvement of rabbit genetic traits, enhancing rabbit production performance, and improving economic value, providing strong support for the high-quality development of my country's animal seed industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a schematic diagram of sgRNA design.

[0028] Figure 2 This is the Sanger sequencing map of the NR6A1 gene mutation in newborn rabbits.

[0029] Figure 3 These are the statistical analysis results of weight of 5-month-old normal rabbits and gene-edited rabbits.

[0030] Figure 4 This is a comparison of the body sizes of 5-month-old normal rabbits and gene-edited rabbits. DETAILED DESCRIPTION

[0031] In order to have a clearer understanding of the technical features, objectives and beneficial effects of the present invention, the technical solution of the present invention is now described in detail below, but it should not be understood as limiting the scope of implementation of the present invention.

[0032] The present invention provides a method for increasing the weight of rabbits based on gene editing technology, the method comprising the following steps:

[0033] Step S1: transcription and synthesis of SpRY-CBE mRNA;

[0034] The SpRY-CBE expression plasmid (stored in this laboratory, with the nucleotide sequence shown in SEQ ID NO. 1) was digested overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction and then transcribed into SpRY-CBE mRNA using the purified linear DNA as a template according to the instructions of the in vitro transcription kit.

[0035] The enzyme digestion system is: AgeI 1μL; xBaI 1μL; SpRY-CBE plasmid 20μL; rCut Smart Buffer 10μL; ddH2O 18μL.

[0036] The transcription synthesis system is: linear SpRY-CBE 1.5μg; NTP Buffer 10μL; T7 RNA polymerase 2μL; ddH2O 6μL.

[0037] The specific operation of transcription synthesis is as follows: after mixing, incubate at 37°C for 1 hour. After transcription is completed, add 1 μL DNase I to digest the transcription template, react at 37°C for 15 minutes, and then add the poly A tail.

[0038] Step S2: Design and synthesis of rabbit NR6A1 p.P192S site sgRNA;

[0039] A target sgRNA was designed for the NR6A1p.P192S (NR6A1p.Pro192Ser) site on the rabbit NR6A1 gene (the nucleotide sequence of the NR6A1 gene is shown in SEQ ID NO. 2). The sequence of the sgRNA oligonucleotide chain is as follows:

[0040] sgRNA-F: TTCACCAGGTTCCACACTGT (as shown in SEQ ID NO. 3);

[0041] sgRNA-R: ACAGTGTGGAACCTGGTGAA (as shown in SEQ ID NO. 4);

[0042] The principle of selecting sgRNA oligonucleotide chain is: select an sgRNA oligonucleotide chain with the mutation base at position 5, such as Figure 1 As shown, sgRNA was rapidly synthesized using a commercial chemical synthesis platform (GenScript Biotech Co., Ltd.).

[0043] SEQ ID NO.1:

[0044]

[0045] SEQ ID NO.2:

[0046] AGGCCAATCACTGGAGCAACCATGGTGACAGTGATCACAGTTCCCTGGAAACAGGGCTTCAGAGAGCAACCAGCTTCACCAGGTTCCACACTGTCCTCCAGGTCTGTGGAACTAAATGGATTCATGGCATTCAGGGAGCAGTATGTGGGGATGTCCGTT.

[0047] Step S3: Preparation of NR6A1 gene-edited rabbits using embryo microinjection technology;

[0048] Using a microinjector, 15 ng / μL of synthesized sgRNA and 80 ng / μL of SpRY-CBE were mixed. 3 μL was aspirated into the needle for injection into the embryonic nucleus. The injected fertilized egg was then transplanted into the oviduct of a recipient female rabbit in estrus at the same time. The recipient rabbit was provided with ample water and food until delivery.

[0049] DNA was extracted from the ear tissue of the young rabbits according to the kit instructions (purchased from Tiangen Company, Beijing, China). PCR was then performed using the designed primers. After PCR was completed, electrophoresis was performed for identification. If PCR amplification was successful, the PCR product was sent to Sangon Biotech Company for DNA sequencing to screen for NR6A1 gene-edited rabbits.

[0050] The designed PCR primers are as follows:

[0051] Upstream primer: CCACTCCTCAAACTGGACATT (as shown in SEQ ID NO. 5);

[0052] Downstream primer: GCTCAGAATTCCTTAGGTCCTTTA (as shown in SEQ ID NO. 6);

[0053] The PCR reaction system was as follows: template DNA 1 μL; upstream primer 1.5 μL; downstream primer 1.5 μL; 2×Taq plus 12.5 μL; ddH2O 8.5 μL.

[0054] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 40 s; 38 cycles; and extension at 72°C for 5 min.

[0055] The specific operation of screening NR6A1 gene-edited rabbits is as follows: check the sequencing results. If the C at position 5 in the NR6A1 gene target site mutates to T, it proves that a single base mutation has been obtained. Figure 2 As shown, the C at position 5 in the NR6A1 gene target site was mutated to T, and the NR6A1 gene-edited rabbit was obtained.

[0056] The specific implementation of the present invention is described in detail below with reference to specific embodiments.

[0057] Example 1: Verification of weight gain in NR6A1 gene-edited rabbits;

[0058] To investigate the effects of NR6A1 gene editing on the growth of rabbits, this example selected 5-month-old normal rabbits (WT) and NR6A1 gene-edited rabbits, and performed a comparative statistical analysis of their weight and body shape.

[0059] from Figure 3 The weight data showed that the weight of NR6A1 gene-edited rabbits was significantly higher than that of normal rabbits, showing a significant difference. Figure 4 Comparing the body sizes of normal rabbits and NR6A1 gene-edited rabbits (NR6A1-1 and NR6A1-2), it can be found that the NR6A1 gene-edited rabbits are also significantly larger than normal rabbits, which fully demonstrates that the NR6A1 gene-edited rabbits are superior to normal rabbits in growth traits.

[0060] In summary, the new breed of NR6A1 gene-edited rabbits successfully bred by this invention exhibits significantly increased weight gain and superior growth traits to those of normal rabbits. This achievement has great application value in improving rabbit breeds and enhancing growth performance, providing strong support for the high-quality development of my country's animal breeding industry and is expected to boost the economic benefits of the rabbit breeding industry.

[0061] The above are only preferred embodiments of the present invention. It should be pointed out that for those skilled in the art, several variations and improvements can be made without departing from the concept of the present invention. These should also be regarded as the scope of protection of the present invention. These will not affect the effect of the implementation of the present invention and the practicality of the patent.

Claims

1. A method for increasing the weight of rabbits based on gene editing technology, characterized in that: The following steps are involved: Step S1: transcription and synthesis of SpRY-CBE mRNA; The SpRY-CBE expression plasmid was digested overnight to form linear DNA, which was recovered by electrophoresis and purified, and then transcribed and synthesized into SpRY-CBE mRNA; the nucleotide sequence of the SpRY-CBE expression plasmid is shown in SEQ ID NO.1; Step S2: Design and synthesis of rabbit NR6A1 p.P192S site sgRNA; A sgRNA targeting the rabbit NR6A1 gene p.P192S site was designed. The partial nucleotide sequence of the NR6A1 gene is shown in SEQ ID NO.

2. The sgRNA oligonucleotide sequence is as follows: sgRNA-F: TTCACCAGGTTCCACACTGT, as shown in SEQ ID NO. 3; sgRNA-R: ACAGTGTGGAACCTGGTGAA, as shown in SEQ ID NO. 4; Step S3: Preparation of NR6A1 gene-edited rabbits using embryo microinjection technology; The synthesized sgRNA and SpRY-CBE mRNA were mixed and injected into fertilized eggs, which were then transplanted into the oviducts of recipient rabbits. The recipient rabbits were then raised until they gave birth. DNA was extracted from the ear tissue of the resulting pups, and PCR and sequencing were performed. If the C at position 5 in the NR6A1 gene target site mutated to a T, this indicated a single-base mutation, indicating that the NR6A1 gene-edited rabbit had been obtained. The sequence of the NR6A1 gene target site is TTCACCAGGTTCCACACTGTCCT.

2. The method for increasing rabbit weight based on gene editing technology according to claim 1, characterized in that: The specific process of step S1 is as follows: The SpRY-CBE expression plasmid was digested overnight at 37°C to form linear DNA, which was recovered by agarose gel electrophoresis. The recovered product was purified by chloroform extraction, and then the purified linear DNA was used as a template for transcription and synthesis of SpRY-CBE mRNA. The enzyme digestion system is: AgeI 1μL; xBaI 1μL; SpRY-CBE plasmid 20μL; rCut Smart Buffer 10μL; ddH2O 18μL; The transcription synthesis system is: linear SpRY-CBE 1.5μg; NTP Buffer 10μL; T7 RNA polymerase 2μL; ddH2O 6μL; The specific operation of transcription synthesis is as follows: after mixing, incubate at 37°C for 1 hour; after transcription is completed, add 1 μL DNaseI to digest the transcription template, react at 37°C for 15 minutes, and then add the polyA tail.

Images