Siniperca chuatsi pyloric blind sac number character related SNP molecular marker, primer and application
By screening and breeding individuals with specific SNP molecular markers in Mandarin, the problem of limited molecular markers in the existing technology is solved, and the number of pyloric blind sacs of Mandarin is effectively improved, and the breeding efficiency and economic value of Mandarin is promoted.
Patent Information
- Application Number
- CN202510470901.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-15
- Publication Date
- 2025-06-24
AI Technical Summary
The molecular markers used in the prior art for mandarin breeding are limited, and it is difficult to effectively screen and breed Mandarin populations with high pyloric blind sacs, which affects breeding efficiency and economic value.
SNP molecular markers and corresponding primers related to the number and traits of the pyloric blind sac of Mandarin were provided, and the genotype of the SNP molecular markers were determined through PCR amplification and sequencing, and individuals with CC, CT or GA genotypes were screened to increase the number of pyloric blind sacs of Mandarin.
The early breeding of mandarin is achieved, which significantly promotes the breeding process of mandarin, provides an accurate and reliable basis for judging the extreme number of traits of mandarin pyloric blind sacs, and improves breeding efficiency and economic value.
Smart Images

Figure BDA0005359933270000051
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biotechnology, and particularly relates to an SNP molecular marker, primer and application related to the number trait of pyloric caeca in mandarin fish (Siniperca chuatsi). Background Art
[0002] Pyloric caeca (PC) is a unique structure in the digestive tract of fish, which consists of many blind sacs. Its development begins in the post-embryonic stage and continues to the juvenile stage. The number remains unchanged in the adult stage, and the number of blind sacs generally ranges from several to hundreds. Its histological structure is basically the same as that of the intestine, and it has the function of increasing the digestive and absorption area of the intestine. The epithelial cells in the lumen of each blind sac have dense secretory cells, which can secrete a variety of digestive enzymes to promote the absorption of proteins, lipids and other nutrients.
[0003] Mandarin fish (Siniperca chuatsi), also known as topmouth culter, belongs to the genus Siniperca of the family Serranidae in the order Perciformes. It is an important freshwater economic fish in China, and its annual output has exceeded 400,000 tons. The Yangtze River Basin is the main distribution area of Siniperca fish, with excellent original germplasm resources. Therefore, exploring excellent traits and genetic analysis of mandarin fish are important ways to develop new varieties of mandarin fish. Many researchers have conducted extensive research on the economic traits of mandarin fish, including the feeding training, growth and resistance of mandarin fish. However, the molecular markers available for mandarin fish breeding are still very limited. Among Siniperca fish, S. chuatsi has the fastest growth rate, and the number of pyloric caeca is also the largest among Siniperca fish. Therefore, screening mandarin fish populations with more pyloric caeca can improve the breeding efficiency of mandarin fish, thus generating higher economic value. Summary of the Invention
[0004] In view of the above deficiencies of the prior art, the present invention provides an SNP molecular marker, primer and application related to the number trait of pyloric caeca in mandarin fish.
[0005] To achieve the above invention object, the technical solution adopted by the present invention is as follows:
[0006] The present invention provides an SNP molecular marker related to the number trait of pyloric caeca in mandarin fish. The SNP molecular marker is located at the 301st position of SEQ ID NO:1, and the polymorphism included in the SNP molecular marker is of the T / C type.
[0007] Furthermore, the mutation site of the SNP molecular marker has TT, CT and CC genotypes; the number of pyloric caeca in individuals with CC genotype and CT genotype is more than that in individuals with TT genotype.
[0008] The present invention also provides a primer pair for amplifying the above SNP molecular marker, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 3-4.
[0009] The present invention also provides another SNP molecular marker related to the number trait of the pyloric caeca of mandarin fish. The SNP molecular marker is located at the 301st position of SEQ ID NO: 2, and the polymorphism included in the SNP molecular marker is of the G / A type.
[0010] Furthermore, there are GG and GA genotypes at the mutation site of the SNP molecular marker; the number of pyloric caeca in individuals with the GA genotype is more than that in individuals with the GG genotype.
[0011] The present invention also provides a primer pair for amplifying the second SNP molecular marker above, and the nucleotide sequences of the primer pair are shown in SEQ ID NO: 5-6.
[0012] The present invention also provides a detection kit for detecting the number trait of the pyloric caeca of mandarin fish, including any one of the above primer pairs.
[0013] The present invention also provides a method for screening mandarin fish with a large number of pyloric caeca. Using any one of the above primer pairs to perform PCR amplification on mandarin fish, and determining the genotype of the SNP molecular marker by direct sequencing of the PCR amplification product, retaining individuals with the CC genotype, CT genotype or GA genotype, and gradually increasing the number of pyloric caeca of mandarin fish generation by generation.
[0014] The beneficial effects of the present invention are as follows:
[0015] The SNP molecular marker of the present invention can be used for molecular marker-assisted breeding, can be used for the early selection of mandarin fish, and significantly promotes the breeding process of mandarin fish; both of the provided two SNP molecular marker sites can be used as judgment bases, and the extreme number traits of the pyloric caeca of mandarin fish can be judged respectively through the corresponding primer pairs, and the results are accurate and reliable. Specific Embodiments
[0016] The following describes the specific embodiments of the present invention to facilitate those skilled in the art of the present technology to understand the present invention. However, it should be clear that the present invention is not limited to the scope of the specific embodiments. For those of ordinary skill in the art of the present technology, as long as various changes are within the spirit and scope of the present invention defined and determined by the appended claims, these changes are obvious, and all inventions created using the concept of the present invention are within the scope of protection.
[0017] Example 1
[0018] The mandarin fish used in this experiment were all from a mandarin fish farm in Chongqing. The sample population was the first-generation offspring of 20 groups of original parents of Yangtze River mandarin fish reproduced in the same year. After anesthesia and euthanasia, the pyloric caeca tissue was dissected and separated, the surrounding connective tissue was removed, and the pyloric caeca were cut into small pieces with surgical scissors, and then each piece was placed under a dissecting microscope for counting (any small protrusions with a length less than the diameter were not counted). The mandarin fish in the experiment were divided into a group with a larger number of pyloric caeca (≥280) and a group with a smaller number of pyloric caeca (≤230). Finally, fish muscle tissue was cut and stored at -80°C.
[0019] Example 2
[0020] The samples obtained in Example 1 were respectively subjected to DNA extraction, and the specific steps were as follows:
[0021] S1: Take 200 mg of muscle, add 400 μL of PBS, cut and grind it, centrifuge at 10000 rpm for 1 min, aspirate the supernatant, add 200 μL of GA Buffer, and shake.
[0022] S2: Then add 200 μL of GB Buffer and 20 μL of Proteinase K in sequence, shake well, place at 70°C for 10 min until the solution becomes clear, and briefly centrifuge to remove the water droplets on the inner wall of the tube cap.
[0023] S3: Add 200 μL of absolute ethanol, shake well for 15 sec, and briefly centrifuge to remove the water droplets on the inner wall of the tube cap.
[0024] S4: Add the solution and flocculent precipitate obtained in the previous step into an adsorption column GenClean, centrifuge at 12000 rpm for 1 min, remove the GenClean column, and pour out the waste liquid in the collection tube.
[0025] S5: Put the GenClean column back into the collection tube, add 500 μL of GD Buffer, centrifuge at 12000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column GenClean into the collection tube.
[0026] S6: Add 600 μL of wash buffer PW to the adsorption column GenClean, centrifuge at 12000 rpm for 30 sec, pour out the waste liquid in the collection tube, and put the adsorption column GenClean into the collection tube.
[0027] S7: Repeat step S6 once.
[0028] S8: Remove the GenClean column, discard the waste liquid in the collection tube. Put the column back into the collection tube, centrifuge at 12000 rpm for 2 min to remove the residual wash buffer PW.
[0029] S9: Place the column into a new clean 1.5 mL centrifuge tube. Add 60 μL of elution buffer TE to the center of the column, let it stand at room temperature for 2 min, and then centrifuge at 12,000 rpm for 2 min at room temperature. The liquid in the centrifuge tube is the extracted DNA, which is stored at -20 °C. Detect the DNA sample by 1% agarose gel electrophoresis and detect the concentration and purity by ultraviolet spectrophotometer.
[0030] All of the above reagents are from the DP304 Animal Tissue DNA Extraction Kit of Beijing Tiangen Biochemical Technology Co., Ltd.
[0031] Use the primer pairs SEQ ID NO:1-F / R respectively:
[0032] SEQ ID NO:1-F: GCGCCATTTTATGACGGG; (SEQ ID NO:3)
[0033] SEQ ID NO:1-R: GGATCGAGTTTGCTCAGTTGTC; (SEQ ID NO:4)
[0034] And the primer pair SEQ ID NO:2-F / R shown in SEQ ID NO:5-6:
[0035] SEQ ID NO:2-F: TGAGGGATGCTGGGTATGG; (SEQ ID NO:5)
[0036] SEQ ID NO:2-R: AGATGAATGCTAACGGGTGAAG; (SEQ ID NO:6)
[0037] Perform PCR amplification.
[0038] The PCR reaction system is: 25 μL, including 22 μL of 1.1×T3 Super PCR Mix, 1 μL of each upstream and downstream primer, and 1 μL of DNA template.
[0039] The PCR program is: 32 cycles. Before cycling, pre-denature at 95 °C for 5 min. Each cycle includes denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, and extension at 72 °C for 30 s; after cycling, extend at 72 °C for 5 min. Detect the amplified product by 1% agarose gel electrophoresis. After passing the detection, the qualified PCR product is stored at -20 °C for subsequent sequencing reaction.
[0040] Sequence the amplified product obtained in the above steps. Based on the sequencing results, determine the genotypes of SNPs on the Hiseq2000 high-throughput sequencing platform. Perform bidirectional sequencing on the PCR amplification products of 86 individuals of the above mandarin fish on a PE150 sequencer. Based on the sequencing results, genotype the SNP loci of the mandarin fish.
[0041] The multivariate analysis of variance and independent-sample t-test in the general linear model of SPSS 26.0 were used to test the correlation analysis between the genotypes of SNP loci, the alleles of loci and quantitative traits. For the SNP loci with significant expression, the Duncan method was used for multiple comparison analysis. The analysis results are shown in Table 1.
[0042] Table 1
[0043]
[0044] As can be seen from Table 1, there are three genotypes at the SEQ ID NO:1 locus. Comparing two populations with a large number of pyloric caeca (≥280) and a small number of pyloric caeca (≤230), the mandarin fish with the heterozygous CT genotype has a significantly higher number of individuals with a large number of pyloric caeca than those with a small number of pyloric caeca, and the CC genotype was not detected in the population with a small number of pyloric caeca (≤230); there are two genotypes at the SEQ ID NO:2 locus, and the GA genotype was not detected in the population with a small number of pyloric caeca (≤230).
[0045] Therefore, after the mandarin fish is amplified and detected by the above method, it is more likely to judge that the probability of the number of pyloric caeca with CT genotype, CC genotype and GA genotype is ≥280, which can assist in breeding high-quality aquaculture varieties with high food digestion and absorption rate and fast growth rate.
[0046] During the process of screening mandarin fish with a large number of pyloric caeca, the 301st base of the nucleotide sequence shown in SEQ ID NO:1 and the 301st base of the nucleotide sequence shown in SEQ ID NO:2 are significantly correlated with the trait of the number of pyloric caeca. The two markers of the present invention can be used for the breeding of the trait of the number of pyloric caeca in mandarin fish.
Claims
1. A SNP molecular marker related to the number of pyloric caeca in Siniperca chuatsi, characterized in that: The SNP molecular marker is located at position 301 of the sequence SEQ ID NO: 1, and the polymorphism contained in the SNP molecular marker is of T / C type.
2. The SNP molecular marker according to claim 1, characterized in that: The mutation site of the SNP molecular marker has TT, CT and CC genotypes; the number of pyloric caeca in individuals with CC genotype and CT genotype is greater than that in individuals with TT genotype.
3. A SNP molecular marker related to the number of pyloric caeca in Siniperca chuatsi, characterized in that: The SNP molecular marker is located at position 301 of the sequence SEQ ID NO: 2, and the polymorphism contained in the SNP molecular marker is of G / A type.
4. The SNP molecular marker according to claim 3, characterized in that: The mutation site of the SNP molecular marker has GG and GA genotypes; the number of pyloric caeca in individuals with the GA genotype is greater than that in individuals with the GG genotype.
5. A primer pair for amplifying the SNP molecular marker according to claim 1, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NOs: 3-4.
6. A primer pair for amplifying the SNP molecular marker according to claim 3, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NOs: 5-6.
7. A detection kit for detecting the number of pyloric caeca in Siniperca chuatsi, characterized in that: Comprising the primer pair described in claim 5 or claim 6.
8. A method for screening mandarin fish with a large number of pyloric caeca, characterized in that: The primer pair described in claim 5 or claim 6 is used to perform PCR amplification on mandarin fish, and the genotype of the SNP molecular marker described in claim 1 or claim 3 is determined by direct sequencing of the PCR amplification product, and individuals with CC genotype, CT genotype or GA genotype are retained, thereby increasing the number of pyloric caeca of mandarin fish generation by generation.