Method for evaluating or predicting milk quality characters of Chinese Holstein cows

Abstract

The invention discloses a method for evaluating or predicting milk quality characters of Chinese Holstein cows. In the NDUFAF4 gene, I2-6501Agt is used as a gene of the NDUFAF4; the milk yield and the urea nitrogen content of a GG genotype individual at the G site are obviously higher than those of an AA or AG genotype individual; i < 2 >-6620 A < gt >; the milk yield and the corrected milk yield of an AG genotype individual at the G site are obviously higher than those of an AA genotype individual; i < 2 >-6502Cgt; t and I < 2-6525 > A < gt >; the lactose content of a CC-AA haplotype combination individual at a G site is obviously lower than that of other haplotype combinations; i < 2 >-6620 A < gt >; g, I < 2 >-6622 A < gt >; t and I < 2-6623 > Agt; the milk amount, lactose and corrected milk amount of an AG-AA-AA haplotype combination individual are significantly higher than those of an AA-AA-AA haplotype combination individual. On the basis, a method for evaluating or predicting the milk quality character of the Chinese Holstein dairy cow is established and can be applied to molecular breeding.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding of dairy cows, and more specifically, to a method for evaluating or predicting milk quality traits of Chinese Holstein cows. Background Art

[0002] Holstein cows originated from the coastal area in the north of the Netherlands and are currently the dairy cow breed with the highest milk production and the largest number of breeding in the world. After being introduced into China, they were crossbred with local yellow cattle and selected for many years, and finally the unique Chinese Holstein cows were formed.

[0003] Dairy cows are single - fetus animals with relatively slow reproductive rates. It takes a long time from birth to sexual maturity, generally 2.5 to 3 years. Therefore, in the field of dairy cow breeding, traditional breeding methods such as selective breeding and cross - breeding face problems of long breeding cycles and low efficiency due to low reproductive efficiency and long generation intervals. On the other hand, during the long breeding cycle, fluctuations in temperature, humidity, and feed quality may interfere with the selection results, making breeding face more uncertainties. In addition, traditional breeding requires a large amount of human and material resources and a large amount of space, which further increases the difficulty of breeding.

[0004] In recent years, molecular breeding technology has emerged suddenly. By means of advanced molecular biology, gene markers closely related to excellent traits are accurately located, so as to achieve efficient selection at the molecular level. It greatly shortens the originally long breeding cycle, significantly speeds up the cultivation process of new varieties, and greatly improves the accuracy and reliability of breeding.

[0005] NADH dehydrogenase [ubiquinone] 1 alpha subcomplex assembly factor 4 (NDUFAF4), also known as NADH: ubiquinone oxidoreductase complex assembly factor 4, HRPAP20, C6orf66, is a protein - coding gene located on chromosome 9 in the bovine genome, with 3 exons and 1 transcript.

[0006] Studies have shown that NDUFAF4 is involved in the assembly process of mitochondrial NADH:ubiquinone oxidoreductase complex (Complex I) and interacts with NDUFAF3. NDUFAF4 can affect the electron transfer process of the mitochondrial respiratory chain and plays an indispensable role in the normal development and energy metabolism regulation of animals. Research has found that NDUFAF4 acts upstream or within the assembly of the NADH dehydrogenase complex in mice, and this gene can be expressed in various tissue structures such as the lungs and chest wall muscles; in terms of tumors, the NDUFAF4 gene is a potential molecular target in colon cancer cases, and there is a significant correlation between the expression level of NDUFAF4 and the survival period of patients. Currently, there is no report on the correlation between the NDUFAF4 gene and the milk quality traits of dairy cows. Summary of the Invention

[0007] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a method for evaluating or predicting the milk quality traits of Chinese Holstein cows.

[0008] The first purpose of the present invention is to provide a haplotype molecular marker related to the milk quality traits of Chinese Holstein cows.

[0009] The second purpose of the present invention is to provide another haplotype molecular marker related to the milk quality traits of Chinese Holstein cows.

[0010] The third purpose of the present invention is to provide the application of a reagent or product for detecting the haplotype molecular marker.

[0011] The fourth purpose of the present invention is to provide the application of a reagent or product for detecting SNPs in Chinese Holstein cows.

[0012] The fifth purpose of the present invention is to provide another application of a reagent or product for detecting SNPs in Chinese Holstein cows.

[0013] The sixth purpose of the present invention is to provide a method for evaluating or predicting the milk quality traits of Chinese Holstein cows.

[0014] The seventh purpose of the present invention is to provide a second method for evaluating or predicting the milk quality traits of Chinese Holstein cows.

[0015] The eighth purpose of the present invention is to provide a third method for evaluating or predicting the milk quality traits of Chinese Holstein cows.

[0016] The ninth purpose of the present invention is to provide a fourth method for evaluating or predicting the milk quality traits of Chinese Holstein cows.

[0017] The tenth purpose of the present invention is to provide the application of any of the above methods in molecular breeding of the milk quality traits of Chinese Holstein cows.

[0018] To achieve the above object, the present invention is realized by the following technical solutions:

[0019] The present invention claims protection for the following two haplotype molecular markers:

[0020] A haplotype molecular marker related to the milk quality traits of Chinese Holstein cows, composed of SNP2 and SNP3; the milk quality traits are any one or two of lactose content or somatic cell count;

[0021] Among them, SNP2 is located at NC_037336.1:52890396, that is, the 52,890,396th position on chromosome 9 of the ARS-UCD 1.3 version of the bovine genome; there are CC and CT genotypes. SNP3 is located at NC_037336.1:52890409, that is, the 52,890,409th position on chromosome 9 of the ARS-UCD 1.3 version of the bovine genome; there are AA and AG genotypes;

[0022] Individuals with SNP2 having the CC genotype and SNP3 having the AA genotype have significantly lower lactose content than individuals with the following genotypes:

[0023] SNP2 having the CT genotype and SNP3 having the AG genotype, SNP2 having the CT genotype and SNP3 having the AA genotype, and SNP2 having the CC genotype and SNP3 having the AG genotype;

[0024] Individuals with SNP2 having the CC genotype and SNP3 having the AA genotype have significantly higher somatic cell counts than individuals with the following genotypes:

[0025] SNP2 having the CT genotype and SNP3 having the AG genotype, SNP2 having the CT genotype and SNP3 having the AA genotype, and SNP2 having the CC genotype and SNP3 having the AG genotype.

[0026] Another haplotype molecular marker related to the milk quality traits of Chinese Holstein cows, composed of SNP6, SNP7, and SNP8; the milk quality traits are any one or several of milk yield, lactose content, or corrected milk yield;

[0027] Among them, SNP6 is located at NC_037336.1:52890514, i.e., the 52,890,514th position on chromosome 9 of the ARS-UCD 1.3 bovine genome, with AA and AG genotypes; SNP7 is located at NC_037336.1:52890516, i.e., the 52,890,516th position on chromosome 9 of the ARS-UCD 1.3 bovine genome, with AA and AT genotypes; SNP8 is located at NC_037336.1:52890517, i.e., the 52,890,517th position on chromosome 9 of the ARS-UCD 1.3 bovine genome, with AA and AG genotypes.

[0028] Individuals with SNP6 having the AG genotype, SNP7 having the AA genotype, and SNP8 having the AA genotype have significantly higher milk production, lactose content, or corrected milk volume than individuals with SNP6 having the AA genotype, SNP7 having the AA genotype, and SNP8 having the AA genotype.

[0029] The following applications are also protected:

[0030] Use of a reagent or product for detecting the haplotype molecular marker, and the use is one or more of the following:

[0031] Evaluating or predicting milk quality traits,

[0032] Preparing a kit or product for evaluating or predicting milk quality traits,

[0033] Molecular breeding of milk quality traits in Chinese Holstein cows;

[0034] The milk quality traits are any one or two of lactose content or somatic cell count; or the milk quality traits are any one or several of milk production, lactose content, or corrected milk volume.

[0035] Preferably, the reagent or product is a primer with nucleotide sequences shown in SEQ ID NO:1 and 2.

[0036] Use of a reagent or product for detecting SNPs in Chinese Holstein cows, and the use is one or more of the following:

[0037] Evaluating or predicting milk protein content or urea nitrogen content in milk quality traits,

[0038] Preparing a kit or product for evaluating or predicting milk protein content or urea nitrogen content in milk quality traits,

[0039] Molecular breeding of milk protein content or urea nitrogen content in milk quality traits of Chinese Holstein cows;

[0040] The SNP of Chinese Holstein cows is located at NC_037336.1:52890395, which is the 52,890,395th position on chromosome 9 of the ARS-UCD 1.3 bovine genome. There are AA, GG, and AG genotypes;

[0041] The protein content or urea nitrogen content of individuals with the AA or AG genotype is significantly lower than that of individuals with the GG genotype.

[0042] Preferably, the reagent or product is a primer with a nucleotide sequence as shown in SEQ ID NO:1 and 2.

[0043] Use of a reagent or product for detecting the SNP of Chinese Holstein cows, and the use is one or more of the following:

[0044] Evaluating or predicting milk yield or corrected milk volume in milk quality traits,

[0045] Preparing a kit or product for evaluating or predicting milk yield or corrected milk volume in milk quality traits,

[0046] Molecular breeding of milk yield or corrected milk volume in milk quality traits of Chinese Holstein cows;

[0047] The SNP of Chinese Holstein cows is located at NC_037336.1:52890514, which is the 52,890,514th position on chromosome 9 of the ARS-UCD 1.3 bovine genome. There are AA and AG genotypes;

[0048] For individuals with the AG genotype, the milk yield or corrected milk volume is significantly higher than that of individuals with the AA genotype.

[0049] Preferably, the reagent or product is a primer with a nucleotide sequence as shown in SEQ ID NO:1 and 2.

[0050] Further claim protection for the following method:

[0051] A method for evaluating or predicting milk quality traits of Chinese Holstein cows, detecting the genotypes of SNP2 and SNP3; the milk quality traits are any one or two of lactose content or somatic cell count;

[0052] Among them, SNP2 is located at NC_037336.1:52890396, which is the 52,890,396th position on chromosome 9 of the ARS-UCD 1.3 bovine genome; there are CC and CT genotypes, and SNP3 is located at NC_037336.1:52890409, which is the 52,890,409th position on chromosome 9 of the ARS-UCD 1.3 bovine genome; there are AA and AG genotypes;

[0053] Individuals with the CC genotype of SNP2 and the AA genotype of SNP3 have significantly lower lactose content than individuals with the following genotypes:

[0054] Individuals with the CT genotype of SNP2 and the AG genotype of SNP3, individuals with the CT genotype of SNP2 and the AA genotype of SNP3, and individuals with the CC genotype of SNP2 and the AG genotype of SNP3;

[0055] Individuals with the CC genotype of SNP2 and the AA genotype of SNP3 have significantly higher somatic cell counts than individuals with the following genotypes:

[0056] Individuals with the CT genotype of SNP2 and the AG genotype of SNP3, individuals with the CT genotype of SNP2 and the AA genotype of SNP3, and individuals with the CC genotype of SNP2 and the AG genotype of SNP3.

[0057] Preferably, the detection is performed by PCR amplification using nucleotide sequences as primers shown in SEQ ID NO: 1 and 2 and sequencing the PCR amplification products.

[0058] The second method for evaluating or predicting the milk quality traits of Chinese Holstein cows is to detect the genotypes of SNP6, SNP7, and SNP8; the milk quality traits are any one or more of milk yield, lactose content, or corrected milk yield;

[0059] Among them, SNP6 is located at NC_037336.1: 52890514, which is the 52,890,514th position on chromosome 9 of the ARS-UCD 1.3 bovine genome, and has AA and AG genotypes. SNP7 is located at NC_037336.1: 52890516, which is the 52,890,516th position on chromosome 9 of the ARS-UCD 1.3 bovine genome, and has AA and AT genotypes. SNP8 is located at NC_037336.1: 52890517, which is the 52,890,517th position on chromosome 9 of the ARS-UCD 1.3 bovine genome, and has AA and AG genotypes;

[0060] Individuals with the AG genotype of SNP6, the AA genotype of SNP7, and the AA genotype of SNP8 have significantly higher milk yield, lactose content, or corrected milk yield than individuals with the AA genotype of SNP6, the AA genotype of SNP7, and the AA genotype of SNP8.

[0061] Preferably, the detection is performed by PCR amplification using nucleotide sequences as primers shown in SEQ ID NO: 1 and 2 and sequencing the PCR amplification products.

[0062] The third method for evaluating or predicting the milk quality traits of Chinese Holstein cows, which detects the genotypes of SNPs in Chinese Holstein cows. The SNP in Chinese Holstein cows is located at NC_037336.1:52890395, that is, at the 52,890,395th position of chromosome 9 in the ARS-UCD 1.3 bovine genome, and there are AA, GG, and AG genotypes. The milk quality traits are any one or two of milk protein content or urea nitrogen content. Individuals with AA or AG genotypes have significantly lower milk protein content or urea nitrogen content than those with GG genotype.

[0063] Preferably, the detection is performed by PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO:1 and 2 and sequencing the PCR amplification products.

[0064] The fourth method for evaluating or predicting the milk quality traits of Chinese Holstein cows, which detects the genotypes of SNPs in Chinese Holstein cows. The SNP in Chinese Holstein cows is located at NC_037336.1:52890514, that is, at the 52,890,514th position of chromosome 9 in the ARS-UCD 1.3 bovine genome, and there are AA and AG genotypes. The milk quality traits are any one or two of milk yield or corrected milk yield. Individuals with AG genotype have significantly higher milk yield or corrected milk yield than those with AA genotype.

[0065] Preferably, the detection is performed by PCR amplification using primers with nucleotide sequences as shown in SEQ ID NO:1 and 2 and sequencing the PCR amplification products.

[0066] The present invention also claims the application of any of the above methods in the molecular breeding of milk quality traits of Chinese Holstein cows. The milk quality traits are one of the following:

[0067] Any one or two of lactose content or somatic cell count;

[0068] Any one or several of milk yield, lactose content, or corrected milk yield;

[0069] Any one or two of milk protein content or urea nitrogen content;

[0070] Any one or two of milk yield or corrected milk yield.

[0071] Compared with the prior art, the present invention has the following beneficial effects:

[0072] Eight SNPs were found in the NDUFAF4 gene in the present invention. Among them, for the I2-6501A>G locus, the milk production and urea nitrogen content of individuals with the GG genotype were significantly higher than those of individuals with the AA or AG genotype; for the I2-6620A>G locus, the milk production and corrected milk yield of individuals with the AG genotype were significantly higher than those of individuals with the AA genotype; the I2-6502C>T and I2-6525A formed a haplotype domain. For the haplotype combination of individuals with the locus genotypes of CC and AA in sequence, the lactose content was significantly lower than that of other haplotype combinations, while the somatic cell count was significantly higher than that of other haplotype combinations; the I2-6620A>G, I2-6622A>T, and I2-6623A>G loci also formed a haplotype domain. For the haplotype combination of individuals with the genotypes of AG, AA, and AA in sequence, the milk yield, lactose content, or corrected milk yield was significantly higher than that of individuals with the haplotype combination of AA, AA, and AA in sequence. Based on this, a method for evaluating or predicting the milk quality traits of Chinese Holstein cows was established and could be applied to molecular breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] Figure 1 PCR amplification results of the NDUFAF4 gene using the pooled DNA of Chinese Holstein cows as a template; DL2000: Marker; 1 and 2: Blood samples of some individuals.

[0074] Figure 2 Sequencing results of the PCR amplification products of the NDUFAF4 gene using the pooled DNA of Chinese Holstein cows as a template.

[0075] Figure 3 PCR amplification results (partial) of the NDUFAF4 gene using the individual DNA of Chinese Holstein cows as a template; DL2000: Marker; 1 - 6: Blood samples of some individuals.

[0076] Figure 4 Sequencing maps of three genotypes of I2-6501A>G in the NDUFAF4 gene; Ⅰ - Ⅲ: Individuals with genotypes of AA, AG, and GG respectively.

[0077] Figure 5 Sequencing maps of two genotypes of I2-6502C>T in the NDUFAF4 gene; Ⅰ - Ⅱ: Individuals with genotypes of CC and CT respectively.

[0078] Figure 6 Sequencing maps of two genotypes of I2-6525A>G in the NDUFAF4 gene; Ⅰ - Ⅱ: Individuals with genotypes of AA and AG respectively.

[0079] Figure 7Sequencing maps of three genotypes of the NDUFAF4 gene I2-6596G>T; I-III: individuals with genotypes GG, GT, and TT, respectively.

[0080] Figure 8 Sequencing maps of two genotypes of the NDUFAF4 gene I2-6613T>G; I-II: individuals with genotypes TT and GT, respectively.

[0081] Figure 9 Sequencing maps of two genotypes of the NDUFAF4 gene I2-6620A>G; I-II: individuals with genotypes AA and AG, respectively.

[0082] Figure 10 Sequencing maps of two genotypes of the NDUFAF4 gene I2-6622A>T; I-II: individuals with genotypes AA and AT, respectively

[0083] Figure 11 Sequencing maps of two genotypes of the NDUFAF4 gene I2-6623A>G; I-II: individuals with genotypes AA and AG, respectively

[0084] Figure 12 Linkage reaction map of SNPs loci in the dairy cattle population of the NDUFAF4 gene. Detailed implementation mode

[0085] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not used to limit the scope of the present invention. The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are, unless otherwise specified, reagents and materials that can be obtained from commercial channels.

[0086] Main reagents:

[0087] DL2000 Marker (Guangzhou Dongsheng Biotechnology Co., Ltd.); Blood genomic DNA extraction kit (Tiangen Biochemical Technology Co., Ltd.); Agarose (Beijing TransGen Biotech Co., Ltd.); Taq PCR Mix, 1×TAE electrophoresis buffer (Novoprotein Co., Ltd.), etc.

[0088] Main instruments:

[0089] PCR amplification equipment (Hangzhou Baiheng Technology Co., Ltd.); Electrophoresis instrument (Beijing Liuyi Biotechnology Co., Ltd.); The gel imaging system selects the Tannon brand and is matched with the Lenovo computer host; The high-speed centrifuge selects the Kylin-bel1 and SCILOGEX brands; Micro-spectrophotometer (Shandong Youyunpu Optoelectronic Technology Co., Ltd.), etc.

[0090] Example 1 Amplification of NDUFAF4 gene

[0091] I. Experimental samples

[0092] Blood sample DNA, stored by the research group of the Molecular Genetics Laboratory of Guangdong Ocean University, was extracted from the blood samples of 101 Chinese Holstein cows in the same environment and at the same time period, and stored in a -80°C refrigerator.

[0093] II. Experimental methods

[0094] According to the bovine NDUFAF4 gene sequence (ENSBTAG00000003174) released by Ensembl, primer design was carried out. The forward primer was: 5’-CAGATGATAACCACCACTATG-3’ (SEQ ID NO:1); the reverse primer was: 3’-GAACCTGATGCTGCTCTAA-5’ (SEQ ID NO:2), and then it was synthesized by Guangzhou Tsingke Biotechnology Co., Ltd.

[0095] Using the pooled DNA of 101 Chinese Holstein cows as a template, PCR amplification was carried out.

[0096] PCR reaction system: 1.0 μL of DNA template, 0.7 μL of each forward and reverse primer, 12.5 μL of Green Taq Mix, 10.1 μL of ddH2O.

[0097] PCR amplification program: pre-denaturation at 95°C for 30 s; after denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 1 min; run 35 cycles, extension at 72°C for 10 min.

[0098] After the PCR products were detected by 1.5% agarose gel electrophoresis, they were sent to Guangzhou Tsingke Biotechnology Co., Ltd. for sequencing.

[0099] III. Experimental results

[0100] Using the pooled DNA as a template, the PCR amplification products of the Holstein cow NDUFAF4 gene were detected by 1.5% agarose gel electrophoresis. The results are as Figure 1 shown. The specificity of the primer amplification was good. The electrophoresis bands were uniform and clear, and no dimers, trailing, or non-specific amplification bands appeared. Therefore, it could be used for subsequent sequencing. Its size was 803 bp. The results showed that the size of the PCR product was consistent with the expected fragment size and could be directly used for sequencing identification. The product sequence was SEQ ID NO:3, that is:

[0101] CAGATGATAACCACCACTATGGCAGAAAGTGAAGAAAAACTAAAGAGCCTCTTGATGAAAGTAAAAGTAGAGAGTGAAAAAGTTGGCTTAAGGCTCAATATTCAGAAAACTAAGATCATGGCATCTGGTCCCATCAGTTCAGTTCAGTTCCTGAGTCATGTCCGACTCTTTGCGACCCCATGAATTGCAGCATGCCAGGCCTCCCTGTCCATCACCAACTCCCAGATTTCACCCAAATCCACATCCATTGAGTCGGTGATGCCATCCAGCTATCTCATCCTGTGTCGTCCCCTTTTCTTCCTGCCCTCAATCCCTCCCAGCATCAGTCTTTTCCAGTGAGTCAGCTCTGCATGAGGTGGCCAAAGTACTGGAGTTTCAGCTTTAGCATCATTCCTTCCAAAGAACACCCAGGACTGATCTCCTTAGAATGGACTGGTTGGATCTCCTTACACTCCTGAATACTCATTGGAAAGACTGATGTTGAAGCTGAAGCTCCAGTACTTTGGACACCTGATGCTGAGAGTTGACTCACTGGAAAAGACCCTGATGCTGGGAAAGATTGAAGGCAGGGGGAGATGGGGATGACTGAGGATGAGATGGTTGGATGGCATCACTGACTCAATGGACATGAATTTGAGTAAACTCTGGGAGTTGGTGATGGACAGGGAGGCTTGGCGTGCTGCAGTCCATGGGGTTGCAAAGAGTTGGACATGACTGAGCGATTGAACTGAACTGAATATGAATACAAAACTAGGGAAAAGAATGAAGATTGTCAGGTAAGCTG TTAGAGCAGCATCAGGTTC Among them, the underlined sequences are the upstream and downstream primer sequences.

[0102] The sequencing peak map results of the PCR products are shown in Figure 2 . The results showed that 8 SNP mutation sites were found in intron 2 of the NDUFAF4 gene, namely I2-6501A>G, I2-6502C>T, I2-6525A>G, I2-6596G>T, I2-6613T>G, I2-6620A>G, I2-6622A>T, and I2-6623A>G.

[0103] Among them: I2-6501A>G (SNP1) is located at 626 bp of the amplification product, that is, at NC_037336.1:52890395, which is the 52,890,395th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are three genotypes: AA, AG, and GG.

[0104] I2-6502C>T (SNP2) is located at 627 bp of the amplification product, that is, at NC_037336.1:52890396, which is the 52,890,396th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are two genotypes: CC and CT.

[0105] I2-6525A>G (SNP3) is located at 640 bp of the amplification product, that is, at NC_037336.1:52890409, which is the 52,890,409th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are two genotypes: AA and AG.

[0106] I2-6596G>T (SNP4) is located at 721 bp of the amplification product, that is, at NC_037336.1:52890490, which is the 52,890,490th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are three genotypes: GG, GT, and TT.

[0107] I2-6613T>G (SNP5) is located at 738 bp of the amplification product, that is, at NC_037336.1:52890507, which is the 52,890,507th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are two genotypes: TT and GT.

[0108] I2-6620A>G (SNP6) is located at 745 bp of the amplification product, that is, at NC_037336.1:52890514, which is the 52,890,514th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are two genotypes: AA and AG.

[0109] I2-6622A>T (SNP7) is located at 747 bp of the amplification product, that is, at NC_037336.1:52890516, which is the 52,890,516th position on chromosome 9 of the ARS-UCD 1.3 version bovine genome; there are two genotypes: AA and AT.

[0110] I2-6623A>G (SNP8) is located at 748 bp of the amplified product, i.e., at NC_037336.1:52890517, which is the 52,890,517th position on chromosome 9 of the ARS-UCD 1.3 bovine genome; there are two genotypes: AA and AG.

[0111] Example 2 Polymorphism of the NDUFAF4 Gene

[0112] I. Experimental Samples

[0113] Blood DNA of 101 Chinese Holstein cows in Example 1. The blood DNA of each sample was subjected to PCR amplification according to the method obtained in Example 1.

[0114] The PCR products were electrophoresed on a 1.5% agarose gel, and after detection, they were sent to Guangzhou Qingke Biotechnology Co., Ltd. for sequencing. Analysis was performed using SeqMan software to identify the genotypes of each individual.

[0115] Polymorphism analysis was also performed on 8 SNP mutation sites: gene frequency, genotype frequency, gene heterozygosity (H), effective number of alleles (NE), and polymorphism information content (PIC). All were calculated using Popgene software, and the (χ 2 ) value was calculated.

[0116] II. Experimental Results

[0117] The sequencing peak maps of 8 SNP mutation sites are shown in Figures 3 to 11 , and the polymorphism and population genetic effects of 8 SNPs are shown in Table 1.

[0118] Table 1

[0119]

[0120] Note: The X 2 value of the SNP locus is within the range of X 2 < X 2 0.05 (df = 1 or 2), P > 0.05. This indicates that these three SNPs loci are in Hardy-Weinberg equilibrium in the Chinese Holstein cattle population. χ 2 0.05 (df = 1) = 3.81, applicable to two-genotype loci; χ 2 0.05 (df = 2) = 5.99, applicable to three-genotype loci.

[0121] The results showed that there were three genotypes at the I2-6501A>G locus. There were 34 individuals with the AA genotype, 57 with the AG genotype, and 10 with the GG genotype. The genotype frequency of AA was 0.3366, that of AG was 0.5644, and that of GG was 0.0990. The gene frequencies of A and G were 0.6188 and 0.3812 respectively. The gene frequency of allele A was higher than that of allele G, and it was the dominant gene in the population;

[0122] There were two genotypes at the I2-6502C>T locus. There were 8 individuals with the CC genotype and 93 with the CT genotype. The genotype frequency of CC was 0.0792, and that of CT was 0.9208. The gene frequencies of C and T were 0.5396 and 0.4604 respectively. The gene frequency of allele C was higher than that of allele T, and it was the dominant gene in the population;

[0123] There were two genotypes at the I2-6525A>G locus. There were 44 individuals with the AA genotype and 57 with the AG genotype. The genotype frequency of AA was 0.4356, and that of AG was 0.5644. The gene frequencies of A and G were 0.7178 and 0.2822 respectively. The gene frequency of allele A was higher than that of allele G, and it was the dominant gene in the population;

[0124] There were three genotypes at the I2-6595G>T locus. There were 73 individuals with the GG genotype, 26 with the GT genotype, and 2 with the TT genotype. The genotype frequency of GG was 0.7338, that of GT was 0.2574, and that of TT was 0.0198. The gene frequencies of alleles G and T were 0.8515 and 0.1485 respectively. The gene frequency of allele G was higher than that of allele T, and it was the dominant gene in the population;

[0125] There were two genotypes at the I2-6613T>G locus. There were 49 individuals with the TT genotype and 52 with the GT genotype. The genotype frequency of TT was 0.5149, and that of GT was 0.4851. The gene frequencies of alleles T and G were 0.7426 and 0.2574 respectively. The gene frequency of allele T was higher than that of allele G, and it was the dominant gene in the population;

[0126] There were two genotypes at the I2-6620A>G locus. There were 30 individuals with the AA genotype and 71 with the AG genotype. The genotype frequency of AA was 0.2970, and that of AG was 0.7030. The gene frequencies of A and G were 0.6485 and 0.3515 respectively. The gene frequency of allele A was higher than that of allele G, and it was the dominant gene in the population;

[0127] There are two genotypes at the I2-6622A>T locus. There are 83 heads with the AA genotype and 18 heads with the AT genotype; the genotype frequency of AA is 0.8212, and the genotype frequency of AT is 0.1782; the gene frequencies of A and T are 0.9109 and 0.0891 respectively. The gene frequency of allele A is higher than that of allele T, which is a dominant gene in the population;

[0128] There are two genotypes at the I2-6623A>G locus. There are 57 heads with the AA genotype and 44 heads with the AG genotype; the genotype frequency of AA is 0.2178, and the genotype frequency of AG is 0.5644; the gene frequencies of alleles A and G are 0.7822 and 0.2178 respectively. The gene frequency of allele A is higher than that of allele G, which is a dominant gene in the population.

[0129] The polymorphism information content (PIC) of the I2-6501A>G, I2-6502C>T, I2-6525A>G, I2-6613T>G, I2-6620A>G, and I2-6623A>G loci ranges from 0.25 to 0.5, showing moderate polymorphism; the polymorphism information content of the I2-6596G>T and I2-6622A>T loci is less than 0.25, showing low polymorphism; chi-square test (X 2 test) analysis shows that the X 2 values of the I2-6501A>G, I2-6596G>T, I2-6622A>T, and I2-6623A>G loci are in the range of X 2 <X 2 0.05 (df = 1 or 2), P > 0.05, indicating that these four SNPs loci are in Hardy-Weinberg equilibrium in the Chinese Holstein cattle population.

[0130] Example 3 Correlation between 8 SNPs of NDUFAF4 gene and milk quality traits of Chinese Holstein cattle

[0131] I. Experimental methods

[0132] Dairy Herd Improvement (DHI) is the measurement of the lactation performance and milk composition of dairy cows. Based on making full use of various information of individual and group dairy cows, by measuring milk yield, milk fat percentage, milk protein percentage, lactose percentage, dry matter, urea nitrogen, somatic cell count, and corrected milk, the relationships and changing rules among these components are analyzed, so as to achieve the purpose of improving the milk production performance.

[0133] Detect the production performance data of 101 individual Chinese Holstein cows in Example 1. There are a total of 8 indicators. The specific detection method is as follows: Use a milk composition analyzer to detect the milk quality traits of dairy cows, including: milk fat content (%), milk protein content (%), lactose content (%), urea nitrogen content (mg / L), dry matter content (%), somatic cell count (10 4 cells / mL).

[0134] The individual milk yield, that is, the milk yield of each lactation period of each dairy cow, is the basis for milk yield statistical calculation. The individual milk yield and corrected milk yield are often expressed as the 305-day milk yield and the 305-day corrected milk yield.

[0135] 305-day milk yield: The milk yield from the first day after calving until the 305th day.

[0136] 305-day corrected milk yield: For lactation periods that are less than 305 days, or those that exceed 305 days without daily milk production records, multiply the actual milk yield of these records by the relative coefficient to correct it to the approximate 305-day yield.

[0137] Use the one-way ANOVA function of SPSS 27.0 software to perform a significance test of differences through multiple comparisons, and analyze the correlation between 8 SNPs of the NDUFAF4 gene and milk yield (kg), milk fat content (%), milk protein content (%), lactose content (%), dry matter content (%), somatic cell count (10 4 cells / mL), urea nitrogen content (mg / L), and corrected milk yield (kg) in the milk quality traits of Chinese Holstein cows. When the P value is less than 0.05, it indicates a significant difference. The results are presented in the form of mean ± standard deviation.

[0138] II. Experimental Results

[0139] The results are shown in Table 2.

[0140] Table 2 Correlation between 8 SNPs and milk quality traits:

[0141]

[0142]

[0143] The results showed that different genotypes at the I2-6501A>G locus were significantly correlated with milk protein and urea nitrogen contents in Chinese Holstein cows (P<0.05). Among them, the milk protein and urea nitrogen contents of the GG genotype were significantly higher than those of the AG and AA genotype individuals. However, no significant differences were found between this locus and milk yield, milk fat content, lactose content, dry matter content, somatic cell count, and corrected milk yield (P>0.05).

[0144] The milk yield of individuals with the AG genotype at the I2-6620A>G locus was significantly higher than that of individuals with the AA genotype (P<0.01), and the corrected milk yield was also significantly higher than that of individuals with the AA genotype (P<0.05). However, no significant correlation was found between this locus and milk fat content, milk protein content, lactose content, dry matter content, somatic cell count, and urea nitrogen content (P>0.05).

[0145] Example 4 Linkage analysis of 8 SNPs loci and their correlation with milk quality traits

[0146] I. Experimental method

[0147] Use HaploView 4.2 software to perform linkage analysis on 8 SNPs loci of the NDUFAF4 gene to obtain haplotype combinations, and use SPSS 27.0 software to perform one-way ANOVA to analyze the correlation between haplotype combinations and traits.

[0148] II. Experimental results

[0149] The results are as Figure 12 . The results showed strong linkage between the I2-6502C>T and I2-6525A>G loci, and strong linkage between the I2-6620A>G, I2-6622A>T, and I2-6623A>G loci.

[0150] The I2-6502C>T and I2-6525A>G loci formed a haplotype domain, from which 4 different haplotype data could be obtained, namely CA, TG, TA, and CG, with haplotype frequencies of 0.505, 0.248, 0.212, and 0.034, respectively.

[0151] The I2-6620A>G, I2-6622A>T, and I2-6623A>G loci formed a haplotype domain, from which 4 different haplotypes could be obtained, namely AAA, GAG, GAA, and GTG, with haplotype frequencies of 0.642, 0.127, 0.135, and 0.084, respectively.

[0152] Use SPSS 27.0 software to perform one-way ANOVA. Only 8 haplotypes had biological significance (the number of haplotype individuals was greater than or equal to 3). The genotypes of the 8 haplotypes are shown in Table 3.

[0153] Table 3 Genotype combinations of each haplotype

[0154]

[0155] The correlations between haplotype combinations and milk quality traits are shown in Table 4. In block1, the lactose contents of the H1H2, H1H3, and H1H4 haplotypes were significantly higher than those of the H1H1 haplotype (P < 0.05); the somatic cell count of the H1H1 haplotype was significantly higher than those of the H1H2, H1H3, and H1H4 haplotypes (P < 0.05). There were no significant differences between the remaining haplotypes and the milk quality traits of Chinese Holstein cows (P > 0.05). In block2, the milk yield, lactose content, and corrected milk yield of the H5H7 haplotype were significantly higher than those of the H5H5 haplotype. There were no significant differences between the remaining haplotypes and the milk quality traits of Chinese Holstein cows (P > 0.05).

[0156] Table 4 Correlations between gene haplotypes and milk quality traits of Chinese Holstein cows

[0157]

Claims

1. A haplotype molecular marker associated with milk quality traits of Chinese Holstein cows, characterized in that: It is composed of SNP2 and SNP3; the milk quality trait is any one or two of lactose content and somatic cell count; Among them, SNP2 is located at NC_037336.1:52890396, i.e., position 52890396 of chromosome 9 of ARS-UCD version 1.3 cattle genome; there are CC and CT genotypes, SNP3 is located at NC_037336.1:52890409, i.e., position 52890409 of chromosome 9 of ARS-UCD version 1.3 cattle genome; there are AA and AG genotypes; Individuals with CC genotype at SNP2 and AA genotype at SNP3 had significantly lower lactose content than individuals with the following genotypes: SNP2 is CT genotype and SNP3 is AG genotype, SNP2 is CT genotype and SNP3 is AA, and SNP2 is CC genotype and SNP3 is AG; Individuals with CC genotype for SNP2 and AA genotype for SNP3 had significantly higher somatic cell counts than individuals with the following genotypes: SNP2 is CT genotype and SNP3 is AG genotype, SNP2 is CT genotype and SNP3 is AA, and SNP2 is CC genotype and SNP3 is AG.

2. A haplotype molecular marker associated with milk quality traits of Chinese Holstein cows, characterized in that: It is composed of SNP6, SNP7 and SNP8; the milk quality trait is any one or more of milk yield, lactose content or corrected milk yield; Among them, SNP6 is located at NC_037336.1:52890514, which is the 52890514th position of chromosome 9 in the ARS-UCD 1.3 version of the bovine genome, and has AA and AG genotypes. SNP7 is located at NC_037336.1:52890516, i.e., position 52890516 of chromosome 9 in the ARS-UCD 1.3 version of the bovine genome, and has both AA and AT genotypes. SNP8 is located at NC_037336.1:52890517, i.e., position 52890517 of chromosome 9 in the ARS-UCD version 1.3 bovine genome, and has both AA and AG genotypes; The milk yield, lactose content or corrected milk yield of individuals with SNP6 AG genotype, SNP7 AA genotype and SNP8 AA genotype were significantly higher than those of individuals with SNP6 AA genotype, SNP7 AA genotype and SNP8 AA genotype.

3. Use of a reagent or product for detecting the haplotype molecular marker according to claim 1 or 2, characterized in that: The application is one or more of the following: Evaluate or predict milk quality traits, Preparation of kits or products for evaluating or predicting milk quality traits, Molecular breeding for milk quality traits in Chinese Holstein cows; The milk quality trait is any one or two of lactose content and somatic cell count; or the milk quality trait is any one or more of milk yield, lactose content and corrected milk yield.

4. Application of a reagent or product for detecting SNP in Chinese Holstein cows, characterized in that: The application is one or more of the following: Evaluate or predict milk protein content or urea nitrogen content in milk quality traits, Prepare a kit or product for evaluating or predicting milk protein content or urea nitrogen content in milk quality traits, Molecular breeding for milk protein content or urea nitrogen content in Chinese Holstein cows’ milk quality traits; The Chinese Holstein cow SNP is located at NC_037336.1:52890395, i.e., position 52890395 of chromosome 9 of the ARS-UCD 1.3 version of the bovine genome; there are AA, GG and AG genotypes; The milk protein content or urea nitrogen content of individuals with AA or AG genotype was significantly lower than that of individuals with GG genotype.

5. Application of a reagent or product for detecting SNP in Chinese Holstein cows, characterized in that: The application is one or more of the following: Evaluate or predict milk yield or corrected milk yield in milk quality traits, Preparation of a kit or product for evaluating or predicting milk yield or corrected milk yield in milk quality traits, Molecular breeding for milk yield or corrected milk yield in milk quality traits of Chinese Holstein cows; The Chinese Holstein dairy cow SNP is located at NC_037336.1:52890514, i.e., position 52890514 of chromosome 9 of the ARS-UCD 1.3 version of the cattle genome, and has AA and AG genotypes; The milk yield or corrected milk yield of individuals with AG genotype was significantly higher than that of individuals with AA genotype.

6. A method for evaluating or predicting milk quality traits of Chinese Holstein cows, characterized in that: Detecting the genotypes of SNP2 and SNP3; the milk quality trait is any one or both of lactose content and somatic cell count; Among them, SNP2 is located at NC_037336.1:52890396, i.e., position 52890396 of chromosome 9 of the ARS-UCD 1.3 version of the bovine genome, with CC and CT genotypes, and SNP3 is located at NC_037336.1:52890409, i.e., position 52890409 of chromosome 9 of the ARS-UCD 1.3 version of the bovine genome, with AA and AG genotypes; Individuals with CC genotype at SNP2 and AA genotype at SNP3 had significantly lower lactose content than individuals with the following genotypes: SNP2 was CT genotype and SNP3 was AG, SNP2 was CT genotype and SNP3 was AA, and SNP2 was CC genotype and SNP3 was AG; Individuals with CC genotype at SNP2 and AA genotype at SNP3 had significantly higher somatic cell counts than individuals with the following genotypes: SNP2 is CT genotype and SNP3 is AG, SNP2 is CT genotype and SNP3 is AA, and SNP2 is CC genotype and SNP3 is AG.

7. A method for evaluating or predicting milk quality traits of Chinese Holstein cows, characterized in that: Detecting the genotypes of SNP6, SNP7 and SNP8; the milk quality trait is any one or more of milk volume, lactose content or corrected milk volume; Among them, SNP6 is located at NC_037336.1:52890514, i.e., position 52890514 of chromosome 9 of ARS-UCD version 1.3 cattle genome, with AA and AG genotypes, SNP7 is located at NC_037336.1:52890516, i.e., position 52890516 of chromosome 9 of ARS-UCD version 1.3 cattle genome, with AA and AT genotypes, and SNP8 is located at NC_037336.1:52890517, i.e., position 52890517 of chromosome 9 of ARS-UCD version 1.3 cattle genome, with AA and AG genotypes; The individuals with AG genotype for SNP6, AA genotype for SNP7 and AA genotype for SNP8 had significantly higher milk production, lactose content or corrected milk yield than those with AA genotype for SNP6, AA genotype for SNP7 and AA genotype for SNP8.

8. A method for evaluating or predicting milk quality traits of Chinese Holstein cows, characterized in that: The genotype of the SNP of Chinese Holstein cows is detected. The SNP of Chinese Holstein cows is located at NC_037336.1:52890395, i.e., position 52890395 of chromosome 9 of the ARS-UCD 1.3 version of the bovine genome, and there are AA, GG and AG genotypes; the milk quality trait is any one or both of milk protein content or urea nitrogen content; the milk protein content or urea nitrogen content of individuals with AA or AG genotype is significantly lower than that of individuals with GG genotype.

9. A method for evaluating or predicting milk quality traits of Chinese Holstein cows, characterized in that: The genotype of a Chinese Holstein cow SNP is detected. The Chinese Holstein cow SNP is located at NC_037336.1:52890514, i.e., position 52890514 of chromosome 9 of the ARS-UCD 1.3 version of the bovine genome, and there are AA and AG genotypes; the milk quality trait is any one or both of milk yield or corrected milk yield; the milk yield or corrected milk yield of individuals with AG genotype is significantly higher than that of individuals with AA genotype.

10. Application of the method according to any one of claims 6 to 9 in molecular breeding of milk quality traits of Chinese Holstein cows, characterized in that: The milk quality trait is one of the following: Either or both of lactose content or somatic cell count; Any one or more of milk yield, lactose content or corrected milk volume; Either or both of milk protein content or urea nitrogen content; Either or both of milk production or corrected milk production.

Images