SNP (Single Nucleotide Polymorphism) molecular marker related to litchi fruit weight and application of SNP molecular marker

Abstract

The invention relates to an SNP molecular marker related to litchi fruit weight and application thereof, and belongs to the technical field of molecular biology. The SNP molecular marker related to the litchi fruit weight is based on a seedless litchi reference genome, the SNP molecular marker is located in a litchi SL05G0138630 gene coding region, and is located at the 27564818th basic group of a litchi chromosome 5, and the basic group is A or G. The application finds that a non-synonymous SNP site in a coding region of the litchi SL05G0138630 gene is closely associated with the litchi fruit weight phenotype, the variety with the weight of the litchi fruit can be efficiently identified by detecting the polymorphic site, the invention further discloses an identification method for the molecular level of the variety with the weight of the litchi fruit, and the molecular level of the variety with the weight of the litchi fruit can be identified by an SNP-based typing method. And cheap and accurate gene SNP typing can be achieved, so that the purpose of efficiently and accurately identifying the weight variety of the litchi fruit is achieved.

Description

Technical Field

[0001] This application relates to the technical field of molecular biology, and particularly relates to an SNP molecular marker related to litchi fruit weight and its application. Background Art

[0002] Litchi (Litchi chinensis sonn., Sapindaceae) is an important tropical fruit tree species in the world and a precious fruit with aril as the edible part. Litchi is planted in more than 20 countries and is an inalienable part of the local economy. Its excellent nutritional characteristics, unique flavor and attractive fruit color make it one of the most attractive tropical or subtropical fruits in the international market. Litchi can not only be sold as fresh fruit, but is also very suitable for processing. Dried litchi, canned litchi pulp, litchi juice and litchi wine are the main processing types of litchi. At present, litchi wine is the most advantageous processing product form in the litchi industry, canned litchi pulp is the second largest litchi processing product, and dried litchi is a processing type with more investment value and a wider market.

[0003] Litchi belongs to evergreen arbors, which can reach about 10 m in height. When the pericarp is mature, it mostly shows bright red color, with scaly small protrusions and slightly prickly to the touch. The fruit stone is close to spherical and is wrapped by aril (pulp). The flowering period of litchi is about from March to April, and the fruiting period is about from May to August. Litchi pulp is rich in various bioactive components, such as polysaccharides, polyphenols and γ-aminobutyric acid (GABA), etc. It is reported that these components have functions such as antioxidant, anti-obesity, hepatoprotective effect and immunomodulatory activity. "Compendium of Materia Medica" records that litchi has the effects of enriching blood, tonifying the liver and spleen, relieving pain and calming the nerves, and can also prevent diarrhea.

[0004] In the late 1970s of the last century, the technology for studying the differences in DNA among different individuals was proposed and applied. The differences in DNA molecules can directly reflect the differences among individuals and are not affected by the external environment. Therefore, it gradually replaced the previous method of people using the naked eye to observe the external phenotypic differences to distinguish individuals. At the same time, with the development of molecular biology, various DNA molecular marker technologies have been widely studied and applied. From RFLP, AFLP to the later developed SNP, these molecular markers have played a very important role in the analysis and research of constructing fingerprint maps.

[0005] However, the previous molecular markers have more or less some shortcomings. RFLP technology is relatively cumbersome to operate, has low polymorphic information content, and has great limitations in individual identification; RAPD technology has poor repeatability and unstable results, and the reaction conditions must be repeatedly optimized to obtain reliable results; AFLP technology has high requirements for genome purity and reaction conditions; although SSR technology has advantages such as high polymorphism detection rate, large information content, simple experimental operation, and stable and reliable results compared to the previous ones, it also has the disadvantages of low detection efficiency and low repeatability. As the third-generation molecular marker, SNP has unique advantages. It solves the non-repeatability of SSR markers and has the following advantages: first, it has abundant sites and is almost distributed throughout the entire genome; second, it has abundant polymorphisms and has higher genetic stability than SSR. In addition, the detection method of SNP is becoming simpler and more efficient, and has excellent application prospects.

[0006] Fruit weight is one of the most important agronomic traits in litchi breeding, which directly determines the yield of litchi. At present, litchi breeding mainly adopts traditional breeding methods, which have disadvantages such as long cycle and low efficiency. Molecular marker breeding based on SNP can be quickly screened at the DNA level, significantly improving the efficiency and accuracy of identification of litchi fruit weight, and can identify individuals with excellent traits at the litchi seedling stage, thereby shortening the breeding cycle and accelerating the breeding process. Therefore, finding a SNP molecular marker related to litchi fruit weight can provide an important technical basis for reducing the tediousness and cost of detecting important agronomic traits of litchi and improving the efficiency of molecular marker-assisted breeding of litchi. Summary of the invention

[0007] In view of this, the present application provides a SNP molecular marker related to litchi fruit weight and its application, which can effectively overcome the defects of the above-mentioned prior art.

[0008] The first aspect of the present application provides a SNP molecular marker associated with litchi fruit weight, based on the seedless litchi reference genome, the SNP molecular marker is located in the litchi SL05G0138630 gene coding region, which is located at the 27564818th base of litchi chromosome 5, and the base is A or G. Specifically, the polymorphism of this site is significantly associated with fruit weight, and the fruit weight of the genotype with the base type A at this site is significantly greater than the genotype with the base type G. The AA genotype is determined as the fruit weight haplotype Hap1, and the GG genotype is determined as the fruit light haplotype Hap2. That is, its genotype AA is a very significant molecular marker for a larger litchi fruit weight, and its genotype GG is a very significant molecular marker for a smaller fruit weight.

[0009] The sequence of the gene where the SNP molecular marker is located is as shown in SEQ ID NO.3 (the bold part is the SNP locus): ATGGCGAGAAACGGAGAGCAAGGTGAGGAGGAGCCACTTCCGGCGAGAACGACATCGTCGAGCTCCAGACCGCAAAGACGGAACGACCCGCTCCTCATAATCTGCAGATGCTTCAGCGTCTTGACTTCTCTCGCTGCCATGCTCTGCATTGCCGTCAACGTTCTCTCTGCTGTTCGTTCCTTCAAACACGGATCTGATATATTTGATGGCGTGTTTCGATGTTACGCGGTTATTATTGCCTTCTTCGTGGTAATTGCTGAGACCGAATGGGTGTTTGTTATGAAGTTCTGGAAGGTATTGCAGTATTGGGCTGGCAGGGTAATGACAAGGGCTTTCCCTGCCTATTCTGCGGAGCAAACAAACCTTGTTCTTCTTCGAAATGTAGCAAGCTACCTGCTCCTTGCTTGTGGTCTAGTTTATGTCATATCGGGAATTCTATGCATTGGCTGTCTCAAACGATCTCGTCAACAGAAAGAAATTACTAGGGATCAAGCAATCAAGAGCCTGGAGGAACTGGAGCAGCGTAGGGAAGAACTTGAACAATTGCTGATGGCAAACAGGGTTTGA。

[0010] The second aspect of the present application also provides a primer pair for detecting the above SNP molecular marker, and the nucleotide sequence of the primer pair is as follows: Forward primer 5’-3’: TGGTGTTGTTCCCAAGGCTA; Reverse primer 3’-5’: GGAACTGGAGCAGCGTAGG.

[0011] Specifically, extract the genomic DNA of the litchi to be identified. Using the extracted genomic DNA as a template, design a forward primer and a reverse primer based on the fragment containing the SNP molecular marker to perform PCR amplification of the target fragment, and use the sequencing sequence to achieve SNP genotyping. When the genotype at the 27564818th position on chromosome 5 is AA, it is a fruit weight variety, and when the genotype is GG, it is a fruit light litchi variety.

[0012] The third aspect of the present application also provides the application of the above SNP molecular marker or the above primer pair in regulating the fruit weight of litchi.

[0013] Preferably, the application of the SNP molecular marker in the assisted selection of litchi fruit weight traits.

[0014] The fourth aspect of the present application also provides a method for identifying the above SNP molecular marker, including the following steps: (1) Construct a GWAS population from 160 litchi materials from six major litchi production areas in China. Take the fresh young leaves of litchi as samples for DNA extraction, and investigate the fruit weight after litchi maturation as the phenotypic data for GWAS analysis; (2) Digest the genomic DNA and ligate it with adapters to construct a genomic sequencing library, and perform paired-end sequencing on the sequencing library using the Hiseq2500 sequencing platform; (3) Perform quality control and filtering on the generated sequencing data, align the qualified data to the reference genome sequence to obtain SNP information in the population; (4) Perform a genome-wide association analysis on the obtained SNP information to obtain SNP molecular markers significantly associated with litchi fruit weight.

[0015] The fifth aspect of the present application also provides a method for identifying high- and low-fruit-weight varieties at the molecular level, including the following steps: Extract litchi genomic DNA, use the extracted DNA as a template, design forward and reverse primers based on the fragment containing the above SNP molecular marker to amplify the target fragment by PCR, and use the sequencing sequence to achieve SNP genotyping, so as to achieve the purpose of efficiently and accurately identifying high- and low-fruit-weight varieties.

[0016] Compared with the prior art, the present application has the following beneficial effects: 1. The present application discovers that a non-synonymous SNP site in the coding region of the litchi SL05G0138630 gene is closely associated with the litchi fruit weight phenotype. By detecting this polymorphic site, high- and low-fruit-weight varieties of litchi can be efficiently identified. The present application also discloses a method for identifying high- and low-fruit-weight varieties of litchi at the molecular level. Through the SNP-based genotyping method, inexpensive and accurate gene SNP genotyping can be achieved, so as to achieve the purpose of efficiently and accurately identifying high- and low-fruit-weight varieties of litchi.

[0017] 2. The present application discloses an SNP molecular marker related to litchi fruit weight and its application. By using the method of genome-wide association analysis, an SNP molecular marker related to the litchi fruit weight trait is obtained. The SNP molecular marker is located in litchi SL05G0138630The non-synonymous mutation site in the coding region of chromosome 5 of the gene, located at position Chr5:27564818, with the base being A or G. This SNP molecular marker can be used as an auxiliary selection marker for fruit weight during litchi breeding, which can effectively improve the accuracy of litchi variety selection and accelerate the variety cultivation process; this application also discloses an identification method for high and low fruit weight varieties at the molecular level. By extracting litchi genomic DNA, using the extracted DNA as a template, designing forward and reverse primers based on the fragment containing the SNP molecular marker to perform PCR amplification of the target fragment, and using the sequencing sequence to achieve SNP genotyping, so as to achieve the purpose of efficiently and accurately identifying high and low fruit weight varieties. Brief Description of the Drawings

[0018] In order to more clearly illustrate the technical solutions in this application or the prior art, the following will briefly introduce the drawings required for the description of this application or the prior art. Obviously, the drawings in the following description are some embodiments of this application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1 Litchi fruits with different fruit weights, among which the weights of two wild species are both less than 10 grams (g), and the weights of two cultivated species are both greater than 15 grams (g); Figure 2 Statistical data of the fruit weight trait of the litchi population, where the abscissa represents the weight of the litchi fruit, the unit is gram (g), and the ordinate represents the number of samples in this weight range. It is statistically found that the fruit weight shows a normal distribution in the litchi population and has a genetic effect; Figure 3 Manhattan plot of the association analysis of the litchi population fruit weight trait based on the MLM model. Among them, the abscissa in the Manhattan plot represents the genomic position where each SNP is located, and the ordinate represents the negative logarithm to the base 10 of the P value of each SNP locus under the MLM model; Figure 4 Comparison analysis chart of the fruit weights of two genotypes in the litchi of this application example; Figure 5 Candidate gene SL05G0138630 Expression levels in the pericarp and pulp of fruits with different weights. Detailed Embodiments

[0020] In order to make the purpose, technical solutions and advantages of this application clearer, the technical solutions in this application will be clearly and completely described below in conjunction with the drawings in this application. Obviously, the described embodiments are part of the embodiments of this application, not all of them. Based on the embodiments in this application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of this application.

[0021] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified. The following examples define the present application and describe the present application using GWAS positioning of the new agronomic trait fruit weight to screen for the trait that determines litchi fruit weight. SL05G0138630 Gene, it was found that the non-synonymous SNP in its coding region was highly correlated with the litchi fruit weight phenotype, and can be used as a molecular marker for the identification of high and low varieties of litchi fruit weight. According to the following description and these embodiments, those skilled in the art can determine the basic characteristics of the present application, and without departing from the spirit and scope of the present application, various changes and modifications can be made to the present application to make it suitable for different uses and conditions. In order to better understand the technical content of the present application, the present application is further described below in conjunction with specific embodiments.

[0022] Example 1 - Population Construction and Data Acquisition

[0023] (1) A GWAS population was constructed for 160 litchi materials from different regions. Fresh young leaves of litchi were used as samples for DNA extraction. The fruit weight was investigated after the litchi matured as phenotypic data for GWAS analysis. Figure 1 This indicates that there are large differences in the morphology of litchi fruits in this litchi population.

[0024] (2) The genomic DNA was connected to the DNA fragments by Bacrode, PCR amplified, purified, and the Hyper-seq genome sequencing library was constructed. The genome sequencing library was sequenced with double ends using the HiSeq2500 sequencing platform; (3) Perform quality control and filtering on the generated sequencing data, compare the qualified data with the reference genome sequence of the seedless litchi genome, and obtain SNP information in the population.

[0025] Example 2 - Phenotypic data investigation and DNA extraction

[0026] Take fresh leaves of litchi and extract litchi DNA using the CTAB method; when litchi is ripe, take fruits of equal size and measure the weight of three litchi fruits with a vernier caliper and take the average value. Figure 2 This indicates that the weight of litchi fruit in this population conforms to the normal distribution and can be used for subsequent analysis.

[0027] 1. Extraction and Detection of Litchi DNA Select 1 to 2 plants from each material, and take 5 - 8 grams of fresh leaves to extract DNA.

[0028] (1) Weigh 5 - 8 g of the material and grind it in liquid nitrogen three to four times; (2) Put the powder into a 2 ml centrifuge tube containing 800 μl of 2×CTAB extraction buffer; (3) Add 60 μl of mercaptoethanol, mix well, and preheat at 60°C for 30 min; (4) Mix well two to three times during this period, take out the sample and let it stand at room temperature; (5) After the sample cools to a constant temperature, add 800 μl of chloroform:isoamyl alcohol (24:1); (6) Vortex to mix well and centrifuge at 12000 rpm for 15 min; (7) Transfer the supernatant to a new 2 ml Ep tube and add 1.5 times the volume of 1×CTAB precipitation solution; (8) Let it stand for 20 - 30 min and centrifuge at 12000 rpm for 15 min; (9) Air-dry the precipitate and dissolve it in 200 μl of TE-buffer (dissolve); (10) Add 400 μl of 95% ethanol solution and 20 μl of 3M NaAC, and precipitate at -20°C for 1 h; (11) Centrifuge at 12000 rpm for 15 min; (12) Wash with 500 μl of 75% ethanol, centrifuge at 12000 rpm for 10 min; open the lid at room temperature and wait for the residual ethanol to evaporate.

[0029] (13) Add 30 - 50 μl of TE-buffer; the extracted DNA can be immediately used for the next experiment or stored at -40°C.

[0030] (14) Detect by agarose gel electrophoresis; use a 2%wt agarose gel (electrophoresis at 60V for 35 min) to detect the integrity of DNA.

[0031] Example 3 - GWAS Mapping of Genes Related to Litchi Fruit Weight Phenotype

[0032] Quality control and filtering of the generated sequencing data: For the original Illumina sequencing data, a Perl script (http: / / afsmseq.sourceforge.net / ) was used to optimize the data and reduce human data errors. The quality control criteria were MAF < 0.05, missing rate > 0.9, and HW (Hardy-Weinberg index) > 0.0001. The optimized sequencing reads were aligned to the litchi reference genome without nucleus using the BWA software, and the identification of SNPs was completed using the GATK software. After obtaining the SNP site information of each sample, population-level integration was performed.

[0033] The annotation of SNPs was based on the gene structure annotation file of the litchi reference genome without nucleus. The snpEff software was used to classify the positions of SNPs into intergenic regions, untranslated regions (including 3'-untranslated region and 5'-untranslated region), intronic regions, and coding regions. SNPs in the coding region could be further divided into synonymous codons and non-synonymous codons according to whether they caused amino acid changes. Insertions and deletions in the exon region could be divided into frameshift mutations and non-frameshift mutations according to whether they produced frameshift mutations.

[0034] Genome-wide association analysis of the litchi fruit weight trait was performed on the data of high-quality SNPs and indels obtained. The mixed linear model (MLM) of the TASSEL 5.0 software was used for association analysis. The Plink software was used to adjust the data format and convert the VCF file into the tfam and tped formats recognizable by the emmax software. The kinship matrix generated by TASSEL was used to correct the population structure and random polygenic effects. The significance threshold was set to P ≤ 1×10 −6 , and significant GWAS signals were identified.

[0035] Result analysis: The results of the GWAS analysis of the litchi fruit weight trait are shown in Figure 3 . Figure 3 It is the Manhattan plot of the association analysis results. Among them, the X-axis is the position on the genome where each SNP is located, and the Y-axis is the negative logarithm to the base 10 of the P value of each SNP site.

[0036] The statistical association significance threshold was set to P ≤ 1×10 −6, successfully located 5 significantly associated SNPs, located on chromosomes 5 and 13, respectively, including a total of 128 candidate genes. LD-block analysis was performed on the most significant SNP site SL05_27520767 among the 5 sites, and there were 49 genes in the linkage interval. Combined with the functional annotation information of litchi genes, a gene with functional annotation as coatmer protein Ⅰ (COPI) was identified SL05G0138630 It is reported that COPI protein is involved in plant growth and development, and studies in Arabidopsis have shown that it is related to plant growth and development as well as stress resistance. SL05G0138630 A non-synonymous SNP site SL05_27564818 (A / G) was identified in the coding region of the gene. Based on this SNP, we determined that the fruit weight of the genotype with base type A was significantly greater than that of the genotype with base type G. The AA genotype was determined as the fruit weight haplotype Hap1, and the GG genotype was determined as the fruit light haplotype Hap2. Among them, the fruit weight haplotype Hap1 had 127 litchi samples, and the average fruit weight was 18.8g, and the fruit light haplotype Hap2 had 27 litchi samples, and the average fruit weight was 10.1g. The fruit weight of varieties containing Hap1 is significantly higher than that of varieties containing Hap2.

[0037] The amplification primers of the SNP molecular markers related to litchi fruit weight include: forward primer 5'-3': TGGTGTTGTTCCCAAGGCTA and reverse primer 3'-5': GGAACTGGAGCAGCGTAGG. The litchi fruit weight and DNA extraction were performed on more than one hundred litchi populations for verification. The genotypes of each tested plant and the litchi fruit weight results are shown in the following table. Among the litchi fruits of 160 litchi varieties, the one with the largest fruit weight is the cultivated variety GD-10 from Guangdong, with a genotype of AA and a fruit weight of 53.3g. The one with the smallest fruit weight is the wild variety BWLQSX03S from the Bawangling area of ​​Hainan, with a genotype of GG and a fruit weight of 2.524g. Figure 4 This is an analysis of the effect of different genotypes of the SNP site on regulating litchi fruit weight. Figure 4 It can be seen that the fruit weight of litchi samples with genotype AA is significantly higher than that of samples with genotype GG. The genotypes and fruit weights of 166 litchi samples are shown in Table 1.

[0038] Table 1 Genotypes and fruit weight of 166 litchi samples

[0039] Example 4 - Measurement of Litchi Fruit Weight and Analysis of the Expression Level of SL05G0138630 Gene in Varieties with Different Fruit Weights and Different Tissues Six litchi strains with different fruit weights were selected for transcriptome sequencing. These six strains also differed in terms of pericarp color, pericarp roughness, and fruit shape. The sequencing sites were pulp, seed, and pericarp. Among the selected varieties, the fruit weights of Feizixiao, Seedless Litchi, and Litchi King were greater than 15 g, which were called large fruits. The remaining three materials were wild litchi with fruit weights less than 10 g, which were called small fruits. As Figure 5 shown, the expression level of this gene in the pulp was significantly higher than that in the seed and pericarp, and the expression level in the pulp of large fruits was significantly higher than that in the pulp of small fruits.

[0040] Through the above method for identifying SNP molecular markers related to litchi fruit weight, this application obtained SNP molecular markers related to litchi fruit weight, which can be used as molecular markers significantly related to litchi fruit weight and applied in the assisted selection of litchi fruit weight traits, facilitating the improvement of the accuracy of litchi variety selection and accelerating the variety breeding process.

[0041] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application, rather than to limit them; although this application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of this application.

Claims

1. An SNP molecular marker related to the weight of litchi fruits, characterized in that, Based on the litchi reference genome without nucleus, the SNP molecular marker is located in the litchi SL05G0138630 gene coding region, which is located at the 27,564,818th base of chromosome 5 of litchi, and the base is A or G; The sequence of the gene where the SNP molecular marker is located is shown in SEQ ID NO.

3.

2. A primer pair for detecting the SNP molecular marker according to claim 1, characterized in that, The nucleotide sequences of the primer pair are as follows: Forward primer 5'-3': TGGTGTTGTTCCCAAGGCTA; Reverse primer 3'-5': GGAACTGGAGCAGCGTAGG.

3. Use of the SNP molecular marker according to claim 1 or the primer pair according to claim 2 in regulating the weight of litchi fruits.

4. The application according to claim 3, wherein Use of the SNP molecular marker in the assistant selection of litchi fruit weight traits.

5. A method for identifying the SNP molecular marker described in claim 1, characterized in that, Comprising the following steps: (1) Construct a GWAS population from 160 litchi materials from six main litchi production areas in China. Take fresh young leaves of litchi as samples for DNA extraction, and investigate the fruit weight after litchi maturation as the phenotypic data for GWAS analysis; (2) Digest the genomic DNA and ligate it with adapters to construct a genomic sequencing library, and perform paired-end sequencing on the sequencing library using the Hiseq2500 sequencing platform; (3) Perform quality control and filtration on the generated sequencing data, align the qualified data to the reference genome sequence, and obtain SNP information in the population; (4) Perform a genome-wide association analysis on the obtained SNP information to obtain SNP molecular markers significantly associated with litchi fruit weight.

6. A method for identifying fruit weight high and low varieties at the molecular level, characterized in that, Comprising the following steps: Extract litchi genomic DNA, use the extracted DNA as a template, design forward and reverse primers based on the fragment containing the SNP molecular marker described in claim 1 to perform PCR amplification of the target fragment, and use the sequencing sequence to achieve SNP genotyping, so as to achieve the purpose of efficiently and accurately identifying high- and low-fruit-weight varieties.

Images