Efficiency assays for CD34 + cells
By measuring the amount of VEGF expressed by the CD34+ cell population and/or detecting its specific microRNA, the problem of difficult to quickly verify the efficacy of CD34+ cells in the prior art is solved, and an efficient evaluation of the biological activity of CD34+ cells is achieved to ensure its effectiveness in the treatment of myocardial infarction.
Patent Information
- Application Number
- CN202380079320.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2022-11-18
- Filing Date
- 2023-11-17
- Publication Date
- 2025-06-24
Smart Images

Figure CN120202409A_ABST
Abstract
Description
Technical Field
[0001] The present disclosure relates to methods for selecting CD34+ cells, cells selected by said methods, and therapeutic uses of those cells. More specifically, the present disclosure relates to CD34+ cells selected based on VEGF expression levels and / or cell and / or exosome microRNA expression levels. Background Art
[0002] CD34 is a cell surface marker used to identify and isolate hematopoietic stem / progenitor cells (HSPC). CD34+ cells are typically isolated from blood samples using immunomagnetic techniques. CD34+ cells can differentiate into all types of blood cells as well as endothelial cells.
[0003] It has been shown that the intracardiac delivery of autologous peripheral blood-derived CD34+ stem cells (CD34+ cells) mobilized by granulocyte colony-stimulating factor (G-CSF) after myocardial infarction and collected by leukapheresis structurally and functionally repairs the damaged myocardial area (Pasquet S, Sovalat H, Henon P et al.). An automated device has been developed which allows for stem cell expansion after G-CSF mobilization and has been shown to provide at least an equivalent number of CD34+ cells as those collected during leukapheresis (Saucourt, Vogt, Merlin et al.). The characteristics (number of CD34+-cells, purity / impurity profile, and viability) and safety (sterility, pyrogen, and mycoplasma content) of the expanded cells have been evaluated, and the functionality of the expanded cells (eCD34+) has been confirmed in preclinical studies in rats.
[0004] Advanced therapy medicinal products (ATMP) are gene-, tissue-, or cell-based medicinal products for human use. These products must be evaluated batch by batch for efficacy according to the legislative requirements in the United States and Europe. Efficacy determination should involve the mechanism of action and be related to the desired clinical outcome.
[0005] Therefore, there is a need for a simple in vitro efficacy assay for CD34+ cells that can confirm the therapeutic efficacy of said cells in clinical applications. Summary of the Invention
[0007] The present invention provides an in vitro method for selecting CD34+ cells, which comprises:
[0008] (i) determining the amount of VEGF expressed by a population of CD34+ cells, and
[0009] (ii) selecting CD34+ cells based on the amount of VEGF expressed by said population.
[0010] The CD34+ cells can be selected if the amount of VEGF expressed by the cells is at least about 1 fg / cell.
[0011] The present invention also provides an in vitro method for selecting CD34+ cells, comprising:
[0012] (i) detecting one or more microRNAs expressed by a CD34+ cell population and / or contained in its exosomes, and
[0013] (ii) selecting CD34+ cells based on the one or more microRNAs expressed by the population and / or contained in its exosomes.
[0014] The present invention also provides an in vitro method for selecting CD34+ cells, comprising:
[0015] (i) detecting one or more microRNAs expressed by a CD34+ cell population and / or contained in its exosomes and determining the amount of VEGF expressed by the CD34+ cell population, and
[0016] (ii) selecting CD34+ cells based on the detected one or more microRNAs and the amount of VEGF expressed.
[0017] The CD34+ cells can be selected if the expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, and miR133a is detected.
[0018] The CD34+ cells can be selected if the expression of one or more or each of miR126, miR130a, miR21, miR26a, and miR378a is detected.
[0019] The CD34+ cells can be selected if the expression of one or more or each of miR21, miR26a, and miR378a is detected.
[0020] The CD34+ cells can be selected if the expression of miR146a and / or miR21 is detected.
[0021] The CD34+ cells can be selected if the expression of miR199a and / or miR590 is detected.
[0022] The CD34+ cells can be human CD34+ cells.
[0023] The CD34+ cells can be autologous or allogeneic CD34+ cells.
[0024] The method of the present invention may further comprise amplifying the CD34+ cell population before and / or after step (i) or (ii).
[0025] The cells may be amplified for 9 days.
[0026] The amplification may comprise one or more of the following:
[0027] · Amplifying at 37 °C,
[0028] · Amplifying in a 5% CO2 controlled atmosphere, and / or
[0029] · Amplifying in a medium containing cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin and / or Fms-like tyrosine kinase 3 ligand.
[0030] The amount of VEGF can be determined by ELISA or automated ELISA (ELLA).
[0031] The amount of VEGF can be determined by mass spectrometry.
[0032] The amount of VEGF can be determined by radioimmunoassay.
[0033] The amount of VEGF can be determined by multiplex assay.
[0034] The method of the present invention may further comprise collecting, centrifuging and / or purifying the selected cells, optionally wherein the purification is by immunoselection.
[0035] The cells can be used for treatment.
[0036] The present invention also provides an isolated CD34+ cell population selected by the method of the present invention.
[0037] The present invention also provides an isolated CD34+ cell population selected by the method disclosed herein for use in treatment.
[0038] The present invention also provides an isolated CD34+ cell population selected by the method disclosed herein for use in treating myocardial infarction. Description of the Drawings
[0039] Figure 1 : Plate layout for VEGF concentration determination
[0040] Figure 2 a-c: VEGF standard curve
[0041] Figure 3 : VEGF concentration in the supernatant after 9 days of CD34+ cell amplification (assay 1)
[0042] Figure 4 a: VEGF concentration in the supernatant after 9 days of expansion of the patient's CD34+ cells (Measurement 1)
[0043] Figure 4 b: VEGF concentration in the supernatant after 9 days of expansion of the healthy donor's CD34+ cells (Measurement 1)
[0044] Figure 5 a: VEGF concentration and CD34+ cell count of CD34+ cells of acute myocardial infarction (AMI) patients after 9 days of expansion; VEGF concentration curve obtained from the supernatant (Measurement 1)
[0045] Figure 5 b: VEGF concentration and CD34+ cell count of CD34+ cells of AMI patients after 9 days of expansion; Correlation diagram (Measurement 1)
[0046] Figure 6 : VEGF concentration in the supernatant after 9 days of expansion of CD34+ cells (Measurement 2)
[0047] Figure 7 a: VEGF concentration in the supernatant after 9 days of expansion of the patient's CD34+ cells (Measurement 2)
[0048] Figure 7 b: VEGF concentration in the supernatant after 9 days of expansion of the healthy donor's CD34+ cells (Measurement 2)
[0049] Figure 8 a: VEGF concentration and CD34+ cell count of CD34+ cells of AMI patients after 9 days of expansion; VEGF concentration curve obtained from the supernatant (Measurement 2)
[0050] Figure 8 b: VEGF concentration and CD34+ cell count of CD34+ cells of AMI patients after 9 days of expansion; Correlation diagram (Measurement 2)
[0051] Figure 9 : VEGF concentration in the supernatant after 9 days of expansion of CD34+ cells (Measurement 3)
[0052] Figure 10 a: VEGF concentration in the supernatant after 9 days of expansion of the patient's CD34+ cells (Measurement 3)
[0053] Figure 10 b: VEGF concentration in the supernatant after 9 days of expansion of the healthy donor's CD34+ cells (Measurement 3)
[0054] Figure 11 a: VEGF concentration and CD34+ cell count of CD34+ cells of AMI patients after 9 days of expansion; VEGF concentration curve obtained from the supernatant (Measurement 3)
[0055] Figure 11 b: VEGF concentration and CD34+ cell count after 9 days of CD34+ cell expansion in AMI patients; correlation graph (Measurement 3)
[0056] Figure 12 : VEGF concentration in the supernatant after 9 days of CD34+ cell expansion (average of Measurements 1, 2, and 3)
[0057] Figure 13 a: VEGF concentration in the supernatant after 9 days of CD34+ cell expansion in patients (average of Measurements 1, 2, and 3)
[0058] Figure 13 b: VEGF concentration in the supernatant after 9 days of CD34+ cell expansion in healthy donors (average of Measurements 1, 2, and 3)
[0059] Figure 14 a: VEGF concentration and CD34+ cell count after 9 days of CD34+ cell expansion in AMI patients; VEGF concentration curve obtained from the supernatant (average of Measurements 1, 2, and 3)
[0060] Figure 14 b: VEGF concentration and CD34+ cell count after 9 days of CD34+ cell expansion in AMI patients; correlation graph (average of Measurements 1, 2, and 3)
[0061] Figure 15 : VEGF concentration in the supernatant collected after CD34+ cell expansion in AMI patients (curve obtained from Measurements 1, 2, and 3)
[0062] Figure 16 a: From different patients Expression of CD63 / CD81 and CD34 in cell-derived exosomes (positive fraction). From left to right, the columns correspond to FHD_4, FHD_5, FHD_6, FHD_8, and P_081.
[0063] Figure 16 b: Expression of CD63 / CD81 and CD34 in CD45+CD34- cell-derived exosomes (negative fraction) from different patients. From left to right, the columns correspond to FHD_4, FHD_5, FHD_6, FHD_8, and P_081.
[0064] Figure 17 : Stability analysis of housekeeping genes (miR-103a, let7a-5p, and U6)
[0065] Figure 18 : From AMI patient (P081) Angiogenic miRNAs in exosomes (miRNA126; miRNA130a; miRNA378a). Pt F+ cells = positive fraction cells; Pt F+ exosomes = patient positive fraction exosomes; Pt F- cells = patient negative fraction cells; Pt F- exosomes = patient negative fraction exosomes
[0066] Figure 19 A: From FHD (C4.1; microRNA study 4; Essai_cytokine comparison - 1 - K0321 - 12120) Angiogenic miRNAs in exosomes (miRNA126; miRNA130a; miRNA378a). Pt F+ cells = positive fraction cells; Pt F+ exosomes = patient positive fraction exosomes; Pt F- cells = patient negative fraction cells; Pt F- exosomes = patient negative fraction exosomes
[0067] Figure 19 B: From FHD (C5.1; microRNA study 5; Essai_cytokine comparison - 2 - K0321 - 12120) Angiogenic miRNAs in exosomes (miRNA126; miRNA130a; miRNA378a). Pt F+ cells = positive fraction cells; Pt F+ exosomes = patient positive fraction exosomes; Pt F- cells = patient negative fraction cells; Pt F- exosomes = patient negative fraction exosomes
[0068] Figure 19 C: From FHD (C6.1; microRNA study 6; Essai_cytokine comparison - 3 - K0321 - 12120) Angiogenic miRNAs in exosomes (miRNA126; miRNA130a; miRNA378a). Pt F+ cells = positive fraction cells; Pt F+ exosomes = patient positive fraction exosomes; Pt F- cells = patient negative fraction cells; Pt F- exosomes = patient negative fraction exosomes
[0069] Figure 19 D: From FHD (C8.1; microRNA study 8; Essai_Stab_SF 279511T0M) Angiogenic miRNAs in exosomes (miRNA126; miRNA130a; miRNA378a). Pt F+ cells = positive fraction cells; Pt F+ exosomes = patient positive fraction exosomes; Pt F- cells = patient negative fraction cells; Pt F- exosomes = patient negative fraction exosomes
[0070] Figure 20 : Pro-angiogenic miRNAs (miRNA126-3p; miRNA130a-3p; miRNA378a-3p) in exosomes. From FHD (n = 5) and AMI patients (n = 1) RTqPCR_exosomes. Pt F+ cells = positive fraction_cells; Pt F+ cells = patient_positive fraction_exosomes; Pt F- cells = patient_negative fraction_cells; Pt F- cells = patient_negative fraction_exosomes
[0071] Figure 21 : CD34+ cells cultured for 9 days from 7 patients (062, 065, 066, 068, 072, 079, 081) in and from exosomes (exosomes; nanovesicles produced) of the analyzed miRNA expression. Pro-angiogenic miRNAs: miR126, miR130a, miR21, miR26a, miR378a; anti-apoptotic effects of miRNAs: miR146a, miR21; miRNAs increasing cardiomyocyte proliferation: miR199a, miR590; anti-fibrotic miRNA: MIR133a
[0072] Figure 22 : Comparison of the average miRNA expression obtained from the exosomes produced and analyzed in the 7 patients (062, 065, 066, 068, 072, 079, 081).
[0073] Figure 23a : VEGF (fg / cell) secreted by CD34+ cells isolated from patients selected in the EXCELLENT clinical trial.
[0074] Figure 23b : In 13 patients, the absolute change of the N-terminal prohormone of brain natriuretic peptide (NT-proBNP) (pg / mL) at 6 months after administration of CD34+ cells relative to baseline and the level of VEGF secretion / cell (fg / cell). The figure shows a negative correlation between VEGF secretion / cell (fg / cell) and the N-terminal prohormone of brain natriuretic peptide (NT-proBNP) (pg / mL). DETAILED DESCRIPTION OF THE INVENTION
[0076] The present inventors have shown that CD34+ cells secrete vascular endothelial growth factor (VEGF) and that the level of VEGF present in the cell culture supernatant after amplification is closely related to the total number of CD34+ cells. The present inventors have also shown that CD34+ cells and exosomes derived from CD34+ contain pro-angiogenic miRNAs (miR126, miR130a, miR378a, miR26a), anti-apoptotic miRNAs (miR21 and miR146a), miRNAs that promote myocardial regeneration (miR199a and miR590), and anti-fibrotic miRNAs (miRNA133a).
[0077] Accordingly, determination of the amount of VEGF expressed by a CD34+ cell population and / or the miRNAs expressed by a CD34+ cell population can be used as part of an assay for selecting the potency of CD34+ cells. Such an assay for potency can form part of the approval process for advanced therapy medicinal products, such as the isolated CD34+ cells of the present invention.
[0078] An assay for potency is a key quality control measure required to determine whether the expanded cells possess the characteristics to produce the desired effect. For example, the desired characteristics can be the ability to promote cardiac regeneration and angiogenesis. An assay for potency allows for rapid measurement of potency prior to batch release for clinical injection.
[0079] Definitions
[0080] "CD34+ cells" are progenitor cells that can differentiate into all types of blood cells as well as endothelial cells. CD34+ cells are mobilized from the bone marrow into the peripheral blood by administration of hematopoietic growth factors. Total CD34+ cells account for approximately 0.5 - 1% of total bone marrow-derived mononuclear cells. CD34+ cells include hematopoietic stem / progenitor cells (HSPCs) as well as endothelial progenitor cells (EPCs). HSPCs can differentiate into all blood cell types and EPCs can differentiate into endothelial cells. CD34+ cells grow in suspension cultures. CD34+ cells can also be obtained from umbilical cord blood.
[0081] "VEGF" (vascular endothelial growth factor) is a potent pro-angiogenic growth factor known to stimulate the formation of new blood vessels.
[0082] is the trade name for the purified CD34+ cells of the applicant for therapeutic applications. are human autologous CD34+ cells amplified according to a GMP automated manufacturing process designed for large-scale clinical production. The European Medicines Agency classifies as an ATMP - advanced therapy medicinal product in the tissue-engineered product classification.
[0083] It is the trade name of a culture system for the automatic expansion of cells (e.g., CD34+). The system is described in US10676705B2.
[0084] (Eurobio, France) is the trade name of a proprietary medium for the expansion of CD34+ cells, which contains a mixture of basal IMDM medium, human plasma, and cytokines.
[0085] MicroRNA (miRNA) is a small non-coding RNA that affects gene expression.
[0086] Isolation of CD34+ cells
[0087] CD34+ cells can be obtained from whole blood samples. Whole blood samples can be obtained from donor subjects. Donor subjects can be human. Donor subjects can be humans in need of treatment. Donor subjects can be humans in need of treatment for myocardial infarction. CD34+ cells can also be obtained from umbilical cord blood. CD34+ cells can be autologous or allogeneic CD34+ cells.
[0088] Whole blood samples can be obtained after mobilization with granulocyte colony-stimulating factor (G-CSF). Whole blood samples can be subjected to erythrocyte sedimentation. Whole blood samples can be subjected to total nucleated cell separation. Total nucleated cell separation can be carried out according to the gelatin method, in which the whole blood sample is mixed with a gelatin solution and suspended for a period of time to promote erythrocyte sedimentation. The erythrocytes remaining in the sediment can be mixed with gelatin and suspended for a second period of time. After sedimentation, the supernatant can be centrifuged to pellet the total nucleated cells. After centrifugation, CD34+ cells can be purified by immunoselection. Immunoselection can be carried out by any known method, such as with the CliniMACS system (magnetic-activated cell sorting).
[0089] Culture or expansion of CD34+ cells
[0090] Purified CD34+ cells are cultured or expanded before and / or after the steps of determining the amount of VEGF expressed by the CD34+ cell population, detecting the miRNA expressed by the CD34+ cell population, and selecting the CD34+ cell population. CD34+ cells can be cultured or expanded for 5 - 12 days. CD34+ cells can be cultured or expanded for 5, 6, 7, 8, 9, 10, 11, or 12 days. CD34+ cells can be cultured or expanded for 9 days. CD34+ cells can be cultured or expanded at 37 °C. CD34+ cells can be cultured or expanded in a 5% CO2 controlled atmosphere. CD34+ cells can be cultured or expanded in a medium containing various concentrations of cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin, and / or Fms-like tyrosine kinase 3 ligand. Cells can be cultured at any suitable concentration, such as 2.5×105 cells / mL.
[0091] The method of the present invention can be carried out on human autologous CD34+ cells amplified according to a GMP automated production process designed for large-scale clinical production, such as above.
[0092] Determination of VEGF expression
[0093] The amount of VEGF expressed by the CD34+ cell population can be determined by any known method, such as by Western blot, enzyme-linked immunosorbent assay (ELISA), ELLA system (an automated immunoassay platform from Bio-Techne), fluorescence-linked immunosorbent assay (FLISA), competitive assay, radioimmunoassay, lateral flow immunoassay, flow-through immunoassay, electrochemiluminescence assay, turbidimetry-based assay, nephelometry-based assay, or fluorescence-activated cell sorting (FACS)-based assay. The amount of VEGF can be determined by mass spectrometry. The amount of VEGF can be determined by radioimmunoassay. Preferably, the amount of VEGF is determined by ELISA. For example, determining the amount of VEGF expressed by the CD34+ cell population may involve one or more of the following:
[0094] · Collecting the supernatant from the CD34+ cell culture;
[0095] · Storing the supernatant;
[0096] · Measuring VEGF using an ELISA kit (such as the QuantiGlo ELISA kit (R&D Systems, MN, USA)) according to the manufacturer's instructions, for example, in combination with a SpectraMax L (Molecular Devices, San Jose, CA, USA) or a Simple Plex Cartridge kit for human cell supernatants containing VEGF-A, together with an ELLA ProteinSimple system (Bio-Techne).
[0097] A negative control can be used, such as a medium such as medium. A positive control can be used, such as the immunoassay control group 732 for human VEGF (R&D Systems).
[0098] The amount of VEGF expressed by the CD34+ cell population can be determined by measuring the concentration of VEGF released by the cells into the cell culture medium. The amount of VEGF expressed by the CD34+ cell population can be determined by measuring the concentration of VEGF contained in exosomes derived from the CD34+ cells. The CD34+ cell culture or a portion thereof can be centrifuged and the concentration of VEGF present in the supernatant can be determined. For example, approximately 50 ml of supernatant can be obtained and frozen as smaller aliquots. Typically, 50 μL of sample can be used per well in an ELISA assay.
[0099] If the amount of VEGF expressed by the cells in the medium is an amount indicative of biological and / or therapeutic activity or efficacy, the CD34+ cells can be selected according to the method described. For example, if the amount of VEGF expressed by the cells in the medium is at least about 1, 5, 10, 20, 25, 50, 75, 100, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195 or 200 pg / ml, the CD34+ cells can be selected according to the method described. If the amount of VEGF present in the cell culture medium or supernatant of the CD34+ cell culture is at least 25 pg / ml, the CD34+ cells can be selected according to the method described. If the amount of VEGF present in the cell culture medium or supernatant of the CD34+ cell culture is at least 50 pg / ml, the CD34+ cells can be selected according to the method described. If the amount of VEGF present in the cell culture medium or supernatant of the CD34+ cell culture is at least 150 pg / ml, the CD34+ cells can be selected according to the method described. If the concentration of VEGF contained in exosomes derived from the CD34+ cells is measured, selection can be based on any of the thresholds disclosed herein.
[0100] The amount of VEGF expressed by the CD34+ cell population can be determined by measuring the amount of VEGF expressed per cell. The CD34+ cell culture or a portion thereof can be centrifuged and the amount of VEGF present in the supernatant can be determined. The number of CD34+ cells can be counted by any known method, such as flow cytometry, and the amount of VEGF can be expressed as the amount per cell. If the amount of VEGF expressed per cell is at least about 0.5 fg, at least about 1 fg, at least about 1.5 fg, at least about 2 fg, at least about 2.5 fg or at least about 3 fg, the CD34+ cells can be selected.
[0101] CD34+ cells can be selected for treatment.
[0102] Detection of miRNA expression
[0103] After the above culturing or expansion, a sample of CD34+ cells can be taken for miRNA analysis.
[0104] The expression of miRNA in a CD34+ cell population can be detected by measuring the miRNA expression in CD34+ cells and / or CD34+-cell-derived exosomes. miRNA can be isolated and measured from exosomes and / or cells.
[0105] Exosomes can be purified by centrifuging CD34+ cells to remove cells and cell debris. The resulting supernatant can then be centrifuged again to precipitate the exosomes. For example, 50 mL of culture supernatant can be collected and frozen into smaller aliquots. Smaller volumes (e.g., 200 μL samples) can be used for miRNA extraction from exosomes. miRNA can then be extracted from exosomes by any known method, such as using a commercially available miRNA extraction kit. miRNA can be extracted from CD34+ cells by any known method, such as using a commercially available miRNA extraction kit. An example of a commercially available miRNA extraction kit is kit.
[0106] miRNA can be detected and / or quantified by any known method. For example, miRNA can be detected and quantified by quantitative real-time PCR (RT-qPCR), digital PCR, microarray, luminescence with (Affymetrix, Life-Technologies) and / or high-throughput small RNA sequencing. An example of a commercially available kit for miRNA detection and quantification is LNA miRNA PCR Kit. Suitable primers available from include YP00204230 (miR-21-5p), YP00206023 (miR-26a-5p), YP00204227 (miR-126-3p), YP002046658 (miR-130a-3p), YP00204788 (miR-133a-3p), YP00204688 (miR146a-5p), YP00204536 (miR-199a-3p), YP00205946 (miR-378a-3p), and YP00205448 (miR-590-3p). qPCR data can be normalized to miR-let7a-5p (YP00205727) values. Relative miRNA expression can be calculated using the 2 -ΔΔCt method.
[0107] The miRNA disclosed herein can be detected by, for example, detecting 3p and / or 5p miRNA strands. For example, the miRNA disclosed herein can be detected by any of the following strands:
[0108] miR126-3p UCGUACCGUGAGUAAUAAUGCG(SEQ ID NO:1)
[0109] miR126-5p CAUUAUUACUUUUGGUACGCG(SEQ ID NO:10)
[0110] miR130a-3p CAGUGCAAUGUUAAAAGGGCAU(SEQ ID NO:2)
[0111] miR130a-5p GCUCUUUUCACAUUGUGCUACU(SEQ ID NO:11)
[0112] miR21-3p CAACACCAGUCGAUGGGCUGU(SEQ ID NO:16)
[0113] miR21-5p UAGCUUAUCAGACUGAUGUUGA(SEQ ID NO:3)
[0114] miR26a-3p CCUAUUCUUGGUUACUUGCACG(SEQ ID NO:17)
[0115] miR26a-5p UUCAAGUAAUCCAGGAUAGGCU(SEQ ID NO:4)
[0116] miR378a-3p ACUGGACUUGGAGUCAGAAGGC(SEQ ID NO:5)
[0117] miR378a-5p CCUCCUGACUCCAGGUCCUGUGU(SEQ ID NO:12)
[0118] miR146a-3p CCUCUGAAAUUCAGUUCUUCAG(SEQ ID NO:18)
[0119] miR146a-5p UGAGAACUGAAUUCCAUGGGUU(SEQ ID NO:6)
[0120] miR199a-3p ACAGUAGUCUGCACAUUGGUUA(SEQ ID NO:7)
[0121] miR199a-5p CCCAGUGUUCAGACUACCUGUUC(SEQ ID NO:13)
[0122] miR590-3p UAAUUUUAUGUAUAAGCUAGU(SEQ ID NO:8)
[0123] miR590-5p GAGCUUAUUCAUAAAAGUGCAG(SEQ ID NO:14)
[0124] miR133a-3p UUUGGUCCCCUUCAACCAGCUG(SEQ ID NO:9)
[0125] miR133a-5p AGCUGGUAAAAUGGAACCAAAU(SEQ ID NO:15)
[0126] Selection of CD34+ cells based on miRNA expression
[0127] If miRNAs indicative of biological and / or therapeutic activity or efficacy are detected, CD34+ cells can be selected. For example, if the expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590, and miR133a is detected, CD34+ cells can be selected.
[0128] If the expression of one or more or each of miR126, miR130a, miR21, miR26a, and miR378a is detected, CD34+ cells can be selected.
[0129] If the expression of one or more or each of miR21, miR26a, and miR378a is detected, CD34+ cells can be selected.
[0130] If the expression of miR146a and / or miR21 is detected, CD34+ cells can be selected.
[0131] If the expression of miR199a and / or miR590 is detected, CD34+ cells can be selected.
[0132] If the expression of miR133a is detected, CD34+ cells can be selected.
[0133] CD34+ cells can be selected for treatment.
[0134] Determination of VEGF expression and detection of miRNA expression
[0135] The method of the present invention may include (a) detecting one or more microRNAs expressed by and / or contained in the exosomes of a CD34+ cell population and (b) determining the amount of VEGF expressed by the CD34+ cell population. In this embodiment, the cells are selected based on one or more microRNAs and the amount of VEGF expressed by the population. Steps (a) and (b) may be carried out sequentially in any order or concurrently. In this embodiment, the amount of VEGF expressed may be determined as described elsewhere herein. In this embodiment, the microRNAs may be detected as described elsewhere herein.
[0136] The CD34+ cells may be selected if (i) miRNAs indicative of biological and / or therapeutic activity or efficacy are detected and (ii) the VEGF expressed by the cells is an amount indicative of biological and / or therapeutic activity or efficacy.
[0137] The CD34+ cells may be selected if the VEGF threshold disclosed herein is met and if the presence of one or more microRNAs (or any combination of microRNAs) disclosed herein is detected. The CD34+ cells may be selected for therapy.
[0138] Additional processing steps
[0139] After the CD34+ cells are selected as described above, the CD34+ cells may undergo further processing steps such as purification and / or immunoselection.
[0140] The CD34+ cells may be immunoselected, for example, using magnetic-activated cell sorting. The immunoselected CD34+ cells are then resuspended in a buffer. The buffer may be saline with 4% albumin. The buffer may be phosphate-buffered saline (PBS) / 2% human serum albumin (HSA).
[0141] The processing may be to form a product suitable for a method of treatment. For example, are CD34+ cells that have been processed to form a product suitable for a method of treatment. The European Medicines Agency will register as an ATMP (Advanced Therapy Medicinal Product) in the tissue-engineered product classification.
[0142] Isolated cell population
[0143] The present invention also provides an isolated population of CD34+ cells selected by any method disclosed herein. The selected cells may have any of the properties of CD34+ cells disclosed herein. For example, the cells may express the amount of VEGF disclosed herein. The cells may express one or more microRNAs disclosed herein. The cell population may be provided as a composition containing a suitable excipient. The composition may contain, for example, PBS and / or human serum albumin.
[0144] Method of treatment
[0145] The cells obtained by the method of the present invention can be used for treatment. For example, the cells can be used for treating myocardial infarction. The cells can be administered by intracardiac injection. The cells can promote functional and structural cardiac regeneration of ischemic lesions after myocardial infarction. Administration of the cells of the present invention can cause a decrease in NT-proBNP in the treated subject.
[0146] Incorporation by reference
[0147] All documents cited herein are incorporated herein by reference to the fullest extent permitted by law. Examples
[0148] Example 1: Obtaining CD34+ cells
[0149] Patient samples, healthy donors, and cell production centers
[0150] AMI patients and healthy male volunteers were recruited into this study after approval by the French regulatory agency Agence Nationale de Securite du Medicament et des produits de sante and the regional ethics committee. All participants provided signed informed consent. Each participant first underwent daily subcutaneous (s.c.) administration of 10 μg / kg / day of G-CSF (lenograstim) for 4 days. On the morning of day 5, 440 ml ± 10 ml of whole blood (WB) samples were drawn by simple venipuncture and collected in blood bags, and immediately transported to the cell production center at ambient temperature. Using the StemXpand automated integration system and StemPack disposable kit developed by CellProthera, the preparation process was started on day 6 after the WB samples were stored overnight at 4°C - 8°C.
[0151] ProtheraCytes preparation
[0152] Starting from the initial WB sample, red blood cell (RBC) sedimentation was performed using the gelatin method to isolate total nucleated cells (TNC). Briefly, 440 ml of WB / phosphate-buffered saline 1:1 solution (PBS; Macopharma, Mouvaux, France) was mixed with 440 ml of 4% gelatin (Gelofusine, BBraun, Melsungen, Germany) in two 600 ml transfer bags, and they were hung for 20 minutes to facilitate RBC sedimentation. The RBCs remaining in the precipitate were mixed with 4% gelatin again for a second 20-minute sedimentation period. The two supernatants were pooled and centrifuged at 400 g for 10 minutes at room temperature to pellet the TNC, and the basal (b)-CD34+ stem cells (SC) were purified from the TNC using the CliniMACS system (magnetic-activated cell sorting, Miltenyi Biotec, Bergisch Gladbach, Germany). The bag containing the purified b-CD34+ SC suspension or thawed cryopreserved healthy donor (FHD) CD34+ cells (Lonza) was immediately connected to the machine kit, and a 9-day culture period was carried out in our proprietary StemFeed medium for entering the StemXpand incubator, where the amplification steps were automatically programmed and controlled: First, a predetermined volume of StemFeed medium, cytokine mixture (composed of interleukin [IL] 6, IL3, stem cell factor, thrombopoietin, and Fms-like tyrosine kinase 3 ligand at various concentrations), and CD34+ SC were sequentially dispensed into a dedicated culture bag, which was placed on a stirrer contained in the device incubator. Then the bag was gently stirred for 30 seconds to disperse the cell mixture, and then it was incubated for a 9-day cell amplification period in a controlled atmosphere of 5% CO2 at 37 °C without any further intervention. At the end of the incubation, the cell suspension was dispersed by gentle stirring, and then the stirrer plate was adjusted to an 80° inclination angle to facilitate the equal-volume distribution of the cell suspension into two collection bags. Samples were collected on day 0 and day 7 to analyze sterility after dispersing the cell suspension and tilting the stirrer plate at 50°.
[0153] At the end of the 9-day period, the culture product was collected, centrifuged, and immunoselected using the CliniMACS system to purify the expanded (e)CD34+ SC, which, once resuspended in 15 ml of PBS / 2% human serum albumin (HSA) and adjusted to 5 ml per of three syringes, constituted the final product
[0154] Example 2: VEGF Quantification
[0155] The concentration of vascular endothelial growth factor (VEGF) secreted by CD34+ cells from patients with myocardial infarction (EXCELLENT study) in the cell culture supernatant was measured 9 days after cell amplification.
[0156] In this assay, the following were tested:
[0157] - 16 parts of the CD34+ cell culture supernatant from AMI patients in the EXCELLENT study
[0158] - 4 parts of the CD34+ FHD (frozen healthy donor) cell culture supernatant
[0159] - 3 parts Medium as a negative control
[0160] - 1 part of "Control Group 732 of Human VEGF" as a positive control
[0161] Materials and Methods
[0162] The assay was performed three times according to MOP_PRD - 047. The VEGF concentration was quantified using the Human VEGF QuantiGlo ELISA kit from Bio - Techne.
[0163] Table 1: Assays performed
[0164]
[0165] The plate layout was as follows:
[0166] · Standard range samples, prepared from human VEGF standards diluted to 0, 6.4, 32, 160, 800, 4000, 20000 pg / mL,
[0167] · "0 standard" value: with RD5L calibration diluent,
[0168] · Blank: with the RD1 - 8 dilution solution of the test sample,
[0169] · Negative control Sample: Batch:
[0170] o166304
[0171] o824938
[0172] o230438
[0173] · Patient samples: Supernatant samples were collected immediately after amplifying CD34+ cells from patients 049, 052, 055, 056, 065, 066, 068, 072, 076, 078, 079 and 081,
[0174] · Healthy donor samples: Supernatant samples were recovered immediately after amplifying frozen healthy donor CD34+ cells (FHD_Lonza):
[0175] o Stability control determination of batch 24938 at T12M Stability control determination of batch 24938
[0176] o Stability control determination of batch 952451 at T14M Stability control determination of batch 952451
[0177] o Comparative determination of cytokine mixtures for 3 batches of K0321 and I2120_amplified I2120
[0178] o Stability control determination of batch 230438 at T0M with 3 - plate layout as shown Figure 1
[0179] Results
[0180] Measurement 1
[0181] The following table shows the values obtained for each analyzed sample in triplicate.
[0182] Table 2: Values obtained from standard curve samples
[0183]
[0184]
[0185] * The criterion for excluding outliers when calculating the average of three replicates is: CV < 25%.
[0186] ** Due to the sensitivity of the method (the sensitivity threshold range of the kit is 1.61 - 5.99 pg / mL, with an average of 3.30 pg / mL), for the values calculated at the 0 point of the standard curve, the CV is not considered according to the above exclusion criterion, and the obtained values are lower than this threshold.
[0187] The standard curve obtained from these values is shown in Figure 2 a. For the coefficient R 2 (0.994), the obtained value validates the standard curve obtained, with a value > 0.98.
[0188] Table 3: Values obtained from negative and positive controls
[0189]
[0190] * When, due to the sensitivity of the method (the sensitivity threshold range of the kit is 1.61 - 5.99 pg / mL, with an average of 3.30 pg / mL), when there is no detectable VEGF in the sample, the photometer shows "Range?". Therefore, for statistical analysis purposes, in this case, the value will be arbitrarily considered as the average of the sensitivity threshold, i.e., 3.30 pg / mL.
[0191] Table 4: Values obtained from negative and positive controls including the sensitivity threshold
[0192]
[0193] *NA: Not applicable because the values obtained were below the kit's sensitivity threshold of 3.30 pg / mL.
[0194] Table 5: Values obtained from each healthy donor sample.
[0195]
[0196]
[0197] *The criterion for excluding outliers when calculating the mean of three replicates was: CV < 25%. In this table, all CVs were below 25% and no outliers were excluded.
[0198] Table 6a-b: Values obtained from each patient sample
[0199] Table 6a
[0200]
[0201] *The criterion for excluding outliers in the calculation of the mean of values repeated three times was: CV < 25%. In this table, only the CV of patient 045 was greater than 25%, and the outlier for the three replicates was 1316.6 pg / mL and was excluded. The recalculated CVs are in the table below.
[0202] Table 6b
[0203]
[0204] *The criterion for excluding outliers when calculating the mean of three replicates was: CV < 25%. In this table, all CVs were below 25% and no outliers were excluded.
[0205] Measurement 2
[0206] The following table shows the values obtained for each analyzed sample in triplicate.
[0207] Table 7: Values obtained from standard curve samples
[0208]
[0209] *The criterion for excluding outliers when calculating the mean of three replicates was: CV < 25%.
[0210] **Due to the sensitivity of the method (the sensitivity threshold range of the kit is 1.61 - 5.99 pg / mL, with an average value of 3.30 pg / mL), the CV calculated for the value obtained at the 0 point of the standard curve does not consider the above exclusion criteria, and the obtained value is lower than this threshold.
[0211] The standard curve obtained from these values is shown in Figure 2 b. For the coefficient R 2 (0.998), the obtained value validates the obtained standard curve, with a value > 0.98.
[0212] Table 8: Values obtained from negative and positive controls.
[0213]
[0214] *When due to the sensitivity of the method (the sensitivity threshold range of the kit is 1.61 - 5.99 pg / mL, with an average value of 3.30 pg / mL), when there is no detectable VEGF in the sample, the photometer shows "Range?". Therefore, for the purpose of statistical analysis, in this case, the value will be arbitrarily regarded as the average value of the sensitivity threshold, i.e., 3.30 pg / mL.
[0215] **The values obtained in the positive control repeated three times exceeded the range of this control provided by the supplier (1551 to 2838 pg / mL), so they were not retained for calculating the average value of this control.
[0216] Table 9: Values obtained from negative and positive controls including the sensitivity threshold
[0217]
[0218]
[0219] *NA: Not applicable because the obtained value is lower than the sensitivity threshold of the kit, 3.30 pg / mL.
[0220] Table 10: Values obtained from samples of each healthy donor.
[0221]
[0222] *The criterion for excluding outliers when calculating the average value obtained from three repetitions is: CV < 25%. In this table, all CVs are lower than 25%, and no outliers are excluded.
[0223] Table 11: Values obtained from samples of each patient
[0224]
[0225] *The criterion for excluding outliers when calculating the average value obtained from three repetitions is: CV < 25%. In this table, all CVs are lower than 25%, and no outliers are excluded.
[0226] Measurement 3
[0227] The following table shows the values obtained from three repetitions for each analyzed sample.
[0228] Table 12: Values Obtained from Standard Curve Samples
[0229]
[0230]
[0231] *The criterion for excluding outliers when calculating the average value obtained from three repetitions is: CV < 25%.
[0232] **Due to the sensitivity of the method (the sensitivity threshold range of the kit is 1.61 - 5.99 pg / mL, with an average of 3.30 pg / mL), the CV calculated for the value obtained at the 0 point of the standard curve does not consider the above exclusion criterion, and the obtained value is lower than this threshold.
[0233] ***Only for a CV of 6.4 which is greater than 25%, the outlier for three repetitions is 5462.2 pg / mL and should be excluded.
[0234] The recalculated CVs are shown in Table 13 below.
[0235] Table 13: Recalculated Values Obtained from Standard Curve Samples
[0236]
[0237] *NA: Not applicable because the obtained value is lower than the sensitivity threshold of the kit, 3.30 pg / mL.
[0238] The standard curve obtained from these values is shown in Figure 2 c. For the coefficient R 2 (0.996), the obtained value validates the obtained standard curve, with a value > 0.98.
[0239] Table 14: Values Obtained from Negative and Positive Controls
[0240]
[0241] *When there is no detectable VEGF in the sample due to the sensitivity of the method (the sensitivity threshold range of the kit is 1.61 - 5.99 pg / mL, with an average of 3.30 pg / mL), the photometer displays "Range?". Therefore, for the purpose of statistical analysis, in this case, the value will be arbitrarily considered as the average of the sensitivity threshold, i.e., 3.30 pg / mL.
[0242] **The values obtained in the positive control repeated three times exceeded the range of this control provided by the supplier (1551 to 2838 pg / mL), so they were not retained for calculating the average of this control.
[0243] Table 15: Values obtained from negative and positive controls including the sensitivity threshold
[0244]
[0245] *NA: Not applicable because the values obtained were below the sensitivity threshold of the kit, 3.30 pg / mL.
[0246] Table 16: Values obtained from samples of each healthy donor.
[0247]
[0248] *The criterion for excluding outliers when calculating the average of three replicates is: CV < 25%. In this table, all CVs are below 25%, so no outliers are excluded.
[0249] Table 17: Values obtained from samples of each patient
[0250]
[0251] *The criterion for excluding outliers when calculating the average of three replicates is: CV < 25%. In this table, all CVs are below 25%, so no outliers are excluded.
[0252] Analysis and Observation
[0253] Measurement 1
[0254] VEGF Concentration
[0255] The average values of the repeated three - measurement of VEGF concentration in the supernatant of 9 - day cultures of CD34+ cells from cryopreserved healthy donors (FHD) and CD34+ cells from patients with myocardial infarction are given in the following table.
[0256] Table 18: VEGF concentration in the supernatant of 9 - day cultures of CD34+ cells from patients
[0257]
[0258] Table 19: VEGF concentrations in the supernatants of 9-day cultures of CD34+ cells from healthy donors and controls
[0259]
[0260] These results are also shown in Figure 3 .
[0261] · The VEGF concentration measured for the positive control (human VEGF) was 2488.9 ± 208.1 pg / mL. This concentration is within the quality standards provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL.
[0262] · The VEGF concentration measured for the negative control (medium alone ) was:[[]]
[0263] o Lot 166304: 2.8 ± 0.9 pg / mL,
[0264] o Lot 824938: 3.3 ± 0.0 pg / mL,
[0265] o Lot 230438: 3.3 ± 0.0 pg / mL.
[0266] · The VEGF concentration measured in the supernatants after 9 days of expansion of patient CD34+ cells was 190.1 ± 4.8 pg / mL (Patient 061) to 891.1 ± 28.1 pg / mL (Patient 065).
[0267] · The VEGF concentration measured in the supernatants after 9 days of expansion of healthy donor CD34+ cells was 329.6 ± 18.8 pg / mL (FHD_1) to 777.7 ± 35.1 pg / mL (FHD_2).
[0268] The average VEGF concentrations obtained from the expansion of CD34+ cells from 4 healthy donors, 16 patients, and 3 individual media (cytokine-free ) used as negative controls are shown in Table 20 below.
[0269] Table 20: Average VEGF concentrations obtained from the expansion of CD34+ cells from 4 healthy donors, 16 patients, and 3 negative controls (individual cytokine-free media )
[0270]
[0271] · The average VEGF concentration obtained from 4 healthy donors (FHD) was 562.3 ± 216.7 pg / mL, with a minimum value of 329.6 pg / mL (FHD_1) and a maximum value of 777.7 pg / mL (FHD_2).
[0272] · The average VEGF concentration obtained from 16 patients was 588.8 ± 237.5 pg / mL, with a minimum value of 190.1 pg / mL (Patient 052) and a maximum value of 891.1 pg / mL (Patient 065).
[0273] · From 3 culture media (negative controls), the average VEGF concentration was 3.1 ± 0.3 pg / mL, with values: a minimum of 2.8 pg / mL ( Lot 166304) and a maximum of 3.3 pg / mL ( Lot 824938 and Lot 230438), which were assigned when the photometer displayed "Range?".
[0274] Finally, there was a significant difference between the VEGF concentration in the patient supernatants and that in the culture media alone (Mann-Whitney test, p = 0.0021; Figure 4 a), but no significant difference was shown when the VEGF concentration in the patient supernatants was compared with that in the healthy donor supernatants (t-test, p = 0.8420; Figure 4 b).
[0275] Correlation between VEGF concentration and the number of CD34+ cells obtained after amplification
[0276] Table 21 below shows the data prepared from patients in the EXCELLENT study. Data.
[0277] Table 21: Number of CD34+ cells after 9 days of amplification
[0278]
[0279] These results are also shown in Figure 5 .
[0280] Figure 5 A shows that the curve of the VEGF concentration obtained in the supernatant mimics the curve of the number of CD34+ cells obtained 9 days after cell amplification. Figure 5 B shows a positive significant correlation between VEGF concentration and the number of CD34+ cells after amplification (Pearson correlation coefficient = 0.7902; p-value = 0.0003).
[0281] Measurement 2
[0282] VEGF concentration
[0283] The mean of triplicate measurements of VEGF concentration in the supernatant of 9-day cultures of CD34+ cells from myocardial infarction patients and CD34+ cells from cryopreserved healthy donors (FHD) was measured and is shown in Tables 22 and 23 below.
[0284] Table 22: VEGF concentration in the supernatant of 9-day cultures of CD34+ cells from myocardial infarction patients
[0285]
[0286] Table 23: VEGF concentration in the supernatant of 9-day cultures of CD34+ cells from FHD
[0287]
[0288] These results are also shown in Figure 6 .
[0289] · The VEGF concentration measured for the positive control (human VEGF) was 2583.4 ± 51.0 pg / mL. This concentration is within the quality standards provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL.
[0290] · The VEGF concentration measured for the negative control (medium alone ) was:
[0291] o Lot 166304: 2.6 ± 2.4 pg / mL,
[0292] o Lot 824938: 2.2 ± 1.8 pg / mL,
[0293] o Lot 230438: 3.3 ± 0.0 pg / mL.
[0294] · The VEGF concentration measured in the supernatant after 9 days of expansion of patient CD34+ cells was 165.7 ± 13.0 pg / mL (patient 061) to 1156.6 ± 151.9 pg / mL (patient 045).
[0295] · The range of VEGF concentration measured in the supernatant after 9 days of expansion of healthy donor CD34+ cells was 279.3 ± 12.1 pg / mL (FHD_1) to 670.4 ± 11.3 pg / mL (FHD_2).
[0296] The average VEGF concentrations obtained from the expansion of CD34+ cells from 4 healthy donors, 16 patients, and 3 individual culture media (cytokine-free ) used as negative controls are shown in Table 24 below.
[0297] Table 24: VEGF Concentrations Obtained from the Expansion of CD34+ Cells from Healthy Donors, Patients, and Negative Controls
[0298]
[0299] · The average VEGF concentration obtained from 4 healthy donors (FHD) was 469.1 ± 213.0 pg / mL, with a minimum of 279.3 pg / mL pg / mL (FHD_1),
[0300] and a maximum of 670.4 pg / mL (FHD_2).
[0301] · The average VEGF concentration obtained from 16 patients was 577.6 ± 257.3 pg / mL, with a minimum of 165.7 pg / mL (Patient 061) and a maximum of 1156.6 pg / mL
[0302] (Patient 045).
[0303] · The average VEGF concentration obtained from 3 culture media (negative controls) was 2.7 ± 0.5 pg / mL, with a minimum of 2.2 pg / mL ( Lot 824938) and a maximum of 330 pg / mL ( Lot 166304,
[0304] assigned when the photometer displayed "Range?").
[0305] Finally, there was a significant difference between the VEGF concentration in the patient supernatants and the VEGF concentration in the individual culture media (t-test, p = 0.0015; see Figure 7 A), but no significant difference was shown when the VEGF concentration in the patient supernatants was compared to the VEGF concentration in the healthy donor supernatants (t-test, p = 0.4484; see Figure 7 B).
[0306] Correlation between VEGF Concentration and the Number of CD34+ Cells Obtained after Expansion
[0307] Table 25 below shows the data prepared from patients in the EXCELLENT study. data.
[0308] Table 25: Number of CD34+ cells after 9 days of amplification
[0309]
[0310]
[0311] These results are also shown in Figure 8 .
[0312] Figure 8 A shows that the curve obtained for the VEGF concentration in the supernatant mimics the curve of the number of CD34+ cells obtained after 9 days of cell amplification. Figure 8 B shows a positive significant correlation between the VEGF concentration and the number of CD34+ cells after amplification (Pearson correlation coefficient r = 0.6645; p-value = 0.0050).
[0313] Measurement 3
[0314] VEGF concentration
[0315] The mean of three repeated measurements of the VEGF concentration in the supernatant from CD34+ cells from myocardial infarction patients and from cryopreserved healthy donors (FHD) and from 9-day cultures of CD34+ cells was measured and is shown in Tables 26 and 27 below.
[0316] Table 26: VEGF concentration in the 9-day culture supernatant of CD34+ cells from myocardial infarction patients
[0317]
[0318] Table 27: VEGF concentration in the supernatant of 9-day cultures of FHD CD34+ cells
[0319]
[0320] These results are also shown in Figure 9 .
[0321] · The VEGF concentration measured for the positive control (human VEGF) was 2557.1 ± 76.1 pg / mL. This concentration is within the quality standards provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL.
[0322] · The VEGF concentration measured for the negative control (media alone ) was:[[]]
[0323] o Lot 166304: 2.5 ± 2.0 pg / mL,
[0324] o Batch 824938: 3.6 ± 1.0 pg / mL,
[0325] o Batch 230438: 1.7 ± 1.3 pg / mL.
[0326] · The VEGF concentrations measured in the supernatants after 9 days of CD34+ cell expansion in patients ranged from 201.1 ± 7.6 pg / mL (Patient 061) to 1127.0 ± 64.8 pg / mL (Patient 045).
[0327] · The VEGF concentration ranges measured in the supernatants after 9 days of CD34+ cell expansion in healthy donors were from 337.1 ± 40.5 pg / mL (FHD_1) to 706.9 ± 43.1 pg / mL (FHD_2).
[0328] The mean VEGF concentrations obtained from CD34+ cell expansion of 4 healthy donors, 16 patients, and 3 individual media (cytokine-free ) used as negative controls are shown in Table 28 below.
[0329] Table 28: VEGF Concentrations Obtained from CD34+ Cell Expansion of Healthy Donors, Patients, and Negative Controls
[0330]
[0331] · The mean VEGF concentration obtained from 4 healthy donors (FHD) was 517.4 ± 196.4 pg / mL, with a minimum of 337.1 pg / mL (FHD_1) and a maximum of 706.9 pg / mL (FHD_2).
[0332] · The mean VEGF concentration obtained from 16 patients was 622.3 ± 248.9 pg / mL, with a minimum of 201.1 pg / mL (Patient 061) and a maximum of 1127.0 pg / mL
[0333] (Patient 045).
[0334] · The mean VEGF concentration obtained from 3 was 2.6 ± 1.0 pg / mL, with a minimum of 1.7 pg / mL ( Batch 230438), and a maximum of 3.6 pg / mL ( Batch 824938).
[0335] Finally, there was a significant difference between the VEGF concentrations in the patient supernatants and those in the individual media (t-test, p = 0.0006; seeFigure 10 A), but no significant difference was shown when the VEGF concentration in the patient's supernatant was compared with that in the healthy donor's supernatant (t-test, p = 0.4458; see Figure 10 B).
[0336] Correlation between VEGF concentration and the number of CD34+ cells obtained after amplification
[0337] Table 29 below shows the data prepared from patients in the EXCELLENT study .
[0338] Table 29: Number of CD34+ cells after 9 days of amplification
[0339]
[0340] This data is also shown in Figure 11 .
[0341] Figure 11 A shows that the curve of the VEGF concentration obtained in the supernatant mimics the curve of the number of CD34+ cells obtained after 9 days of cell amplification. Figure 11 B shows a positive significant correlation between VEGF concentration and the number of CD34+ cells after amplification (Pearson correlation coefficient r = 0.7448; p-value = 0.0009).
[0342] Average results of 3 measurements (1, 2, and 3)
[0343] VEGF concentration
[0344] Table 30: VEGF concentration in the 9-day culture supernatant of CD34+ cells from myocardial infarction patients
[0345]
[0346] Table 31: VEGF concentration in the supernatant of 9-day cultures of FHD CD34+ cells
[0347]
[0348] These results are also shown in Figure 12 .
[0349] · The VEGF concentration measured for the positive control (human VEGF) was 2543.0 ± 48.5 pg / mL. This concentration is within the quality standards provided by Bio&Techne for this control. The value should be between 1551 and 2838 pg / mL.
[0350] · The VEGF concentration measured for the negative control (medium alone ) was:
[0351] o Batch 166304: 2.6 ± 0.1 pg / mL,
[0352] o Batch 824938: 3.1 ± 07 pg / mL,
[0353] o Lot number 230438: 2.8 ± 0.9 pg / mL.
[0354] · The VEGF concentration measured in the supernatant after 9 days of CD34+ cell expansion in patients ranged from 185.6 ± 18.1 pg / mL (Patient 061) to 1032.4 ± 190.4 pg / mL (Patient 045).
[0355] · The VEGF concentration range measured in the supernatant after 9 days of CD34+ cell expansion in healthy donors was from 315.3 ± 31.4 pg / mL (FHD_1) to 718.3 ± 54.6 pg / mL (FHD_2).
[0356] The average VEGF concentrations obtained from CD34+ cell expansion of 4 healthy donors, 16 patients, and 3 individual culture media (cytokine-free ) used as negative controls are shown in Table 32 below.
[0357] Table 32: VEGF Concentrations Obtained from CD34+ Cell Expansion of Healthy Donors, Patients, and Negative Controls
[0358]
[0359] · The average VEGF concentration obtained from 4 healthy donors (FHD) in 3 trials was 516.2 ± 208.1 pg / mL, with a minimum value of 315.3 pg / mL (FHD_1),
[0360] and a maximum value of 718.3 pg / mL (FHD_2).
[0361] · The average VEGF concentration obtained from 16 patients was 596.2 ± 242.3 pg / mL, with a minimum value of 185.6 pg / mL (Patient 061) and a maximum value of 1032.4 pg / mL
[0362] (Patient 045).
[0363] · The average VEGF concentration obtained from 3 was 2.8 ± 0.2 pg / mL,
[0364] The minimum value is 2.7 pg / mL and the maximum value is 3.1 pg / mL.
[0365] Finally, there was a significant difference between the VEGF concentration in the patient's supernatant and that in the medium alone (t-test, p = 0.0007; Figure 13 A), but no significant difference was shown when the VEGF concentration in the patient's supernatant was compared with that in the healthy donor supernatant (t-test, p = 0.5534; Figure 13 B).
[0366] The correlation between the VEGF concentration and the number of CD34+ cells obtained after amplification
[0367] Table 33 below shows the data prepared from patients in the EXCELLENT study. data.
[0368] Table 33: Number of CD34+ cells after 9 days of amplification
[0369]
[0370] This data is also shown in Figure 14 shown.
[0371] Figure 14 A shows that the curve of the VEGF concentration obtained in the supernatant mimics the curve of the number of CD34+ cells obtained after 9 days of cell amplification. Figure 14 B shows a positive significant correlation between the VEGF concentration and the number of CD34+ cells after amplification (Pearson correlation coefficient = 0.784; p-value = 0.0009).
[0372] Finally, when comparing the 3 assays, the statistical analysis showed no significant difference (p = 0.8686, ANOVA test), see Table 34. Shapiro-Wilk / test results: The data shown in bold in Table 34 below represent p-values < 0.05, and these data do not follow a normal distribution.
[0373] After the Shapiro-Wilk test, the following comparison data was used:
[0374] · t-test when the Shapiro-Wilk data follows a normal distribution
[0375] · Mann-Whitney test when the data does not follow a normal distribution.
[0376] Table 34: Shapiro-Wilk test results
[0377]
[0378]
[0379] The data curves obtained from three measurements are shown in Figure 15 .
[0380] Conclusion
[0381] Three trials were conducted under the same conditions with the same operator and coordinator to quantify the concentration of VEGF secreted by CD34+ cells in the cell culture supernatant 9 days after cell expansion. For each sample analyzed, the mean of these concentrations was calculated.
[0382] Quantify this VEGF concentration:
[0383] · Secreted by the following CD34+ cells:
[0384] o 16 patients with myocardial infarction (EXCELLENT study),
[0385] o 4 healthy donors,
[0386] · Before expansion In the culture medium (as a negative control), it was shown that:
[0387] o The concentration of VEGF secreted in the culture supernatant of CD34+ cells from patients was from 185.6 pg / mL to 1032.4 pg / mL, with a weighted mean of 596.2 ± 242.3 pg / mL,
[0388] o The concentration of VEGF secreted in the culture supernatant of healthy donor cells was from 315.3 pg / mL to 718.3 pg / mL, with an average value of 526.2 ± 208.1 pg / mL, o Before expansion The VEGF concentration observed in the culture medium (negative control) varied from 2.7 pg / mL to 3.0 pg / mL, with an average value of 2.8 ± 0.2 pg / mL.
[0389] These results indicate that the VEGF concentration observed in the supernatant after expanding CD34+ cells from patients (average value of 596.2 ± 242.3 pg / mL) is high:
[0390] · When comparing this concentration with the VEGF concentration in the supernatant of CD34+ cells from healthy donors (average value of 526.2 ± 208.1 pg / mL), no significant difference was observed,
[0391] · When comparing this concentration with the concentration quantified in the culture medium alone (2.8 ± 0.2 pg / mL), a significant difference was observed (t-test, p = 0.0007).
[0392] In addition, the concentration of VEGF in the supernatant of CD34+ cells from patients was significantly correlated with the number of CD34+ cells obtained after amplification (Pearson correlation coefficient r = 0.7484; p-value = 0.0009), thus supporting the secretion of VEGF by these CD34+ cells.
[0393] Finally, when comparing the 3 assays, statistical analysis showed no significant differences (ANOVA test p = 0.8686).
[0394] Correlation between the amount of VEGF secreted per cell and clinical endpoints
[0395] Methods
[0396] The ongoing EXCELLENT trial (EUDRACT 2014-001476-63) investigated the use of autologous peripheral blood (PB)-CD34+ cells isolated from patients with acute myocardial infarction (AMI), which were amplified by an automated device and product kit developed by CellProthera and were injected endocardially.
[0397] The amount of VEGF secreted by CD34+ cells isolated from 13 patients in the trial was measured (see Figure 23a ). For the same 13 patients, the change in NT-proBNP relative to baseline at 6 months after administration of CD34+ cells was measured.
[0398] Spearman rank correlation was performed between the amount of VEGF secreted per cell (fg / cell) and the interim analysis of different clinical endpoints from the EXCELLENT clinical study.
[0399] Results
[0400] A significant negative correlation was observed between VEGF secretion / cell (fg / cell) and N-terminal prohormone of brain natriuretic peptide (NT-proBNP) (pg / mL), which is a predictor of death, cardiovascular events, and heart failure. Spearman correlation (95% CI) = -0.69 (-0.90; -0.22); P-value = 0.0057 (see Figure 23b)。These results indicate that in AMI patients, higher VEGF secretion by CD34+ cells (ProtheraCytes) is associated with lower NT-proBNP and improvement. This suggests that VEGF can be used as an indicator of CD34+ cell efficacy and as a marker for selecting CD34+ cells for treatment. Additionally, all patients receiving autologous expanded CD34+ cells that secrete at least 1.3 fg / cell of VEGF showed improvement in NT-proBNP levels. For example, even patients with the lowest VEGF secretion (1.3 fg / cell) had a 1066 pg / ml decrease in NT-proBNP at 6 months compared to baseline. This indicates that CD34+ cells secreting VEGF at a level of approximately 1 fg / cell are therapeutically beneficial.
[0401] Example 3: microRNA Study
[0402] The objective of this technical example is to analyze CD34+ cells after 9 days of culture with the following miRNA expression in exosomes (exosomes; nanovesicles produced by from 7 patients (062, 065, 066, 068, 072, 079, 081) from the EXCELLENT clinical study ):
[0403] · Angiogenic miRNAs such as miR126, miR130a, miR21, miR26a, miR378a
[0404] · Anti-apoptotic miRNAs such as miR146a, miR21
[0405] · miRNAs that increase cardiomyocyte proliferation: miR199a, miR590
[0406] · Anti-fibrotic miRNAs such as miR133a
[0407] Materials and Methods
[0408] Exosome Production Protocol
[0409] Cells were cultured in a cytokine mixture and StemSpan-AOF (StemCell Technologies, BC Canada, ref: 100-0130).
[0410] Cell Culture from Cryopreserved Cells
[0411] Under the laminar flow hood, prepare 50 mL tubes with 20 mL of StemSpan-AOF medium. Remove the cells from liquid nitrogen and place them on ice, then thaw them in a 37 °C water bath. Once the cells are thawed, disinfect the cell vials with 70% ethanol and transfer the cells to a 50 mL tube containing 20 mL of StemSpan-AOF medium. Centrifuge the tube at 300 g for 10 minutes.
[0412] Under the laminar flow hood, remove the supernatant and resuspend the cell pellet in 1 mL of conditioned medium. Culture 2.5×10 6 cells in a T25 flask in 10 mL of conditioned medium and incubate at 37 °C, 5% CO2 for 40 - 48 h.
[0413] Cell culture from fresh cells
[0414] Centrifuge the tube containing fresh cells at 400 g for 10 minutes. Under the laminar flow hood, remove the supernatant and resuspend the cell pellet in 1 mL of conditioned medium. Culture 2.5×10 6 cells in a T25 flask in 10 mL of conditioned medium and incubate at 37 °C, 5% CO2 for 40 - 48 h.
[0415] Protocol for purifying exosomes by precipitation
[0416] Purify exosomes by precipitation from ExoQuick-TC TM (System Biosciences, CA, USA, ref: EXOTC50A-1).
[0417] 1. Centrifuge at 3000 g for 15 minutes, 10 mL of cell suspension (cells and debris removed)
[0418] 2. Transfer the supernatant to a new 15 mL tube and add 2 mL of ExoQuick-Tc solution.
[0419] 3. Keep the pellet for microRNA extraction: Resuspend the pellet in 260 μL of RTL buffer from the miRNeasy Tissue / Cells Advanced Mini kit (Qiagen, ref: 217604).
[0420] 4. Mix the tube by inverting
[0421] 5. Incubate overnight (at least 12 hours) at +2 - 8 °C (do not stir / mix the tube during incubation, the tube should remain upright)
[0422] 6. The next day, centrifuge the tube at 1500 g for 30 minutes at room temperature (15 - 25 °C).
[0423] 7. After centrifugation, the exosomes appear as a white / cream precipitate.
[0424] 8. Remove the supernatant (aspirate all traces of the solution)
[0425] 9. Extract microRNA from exosomes: Resuspend the precipitate in 200 μL of resuspension buffer from the Qiagen protocol miRNeasy Serum / Plasma or miRNeasy (Qiagen, ref: 217204).
[0426] 10. For flow cytometry analysis, resuspend the cell pellet in an appropriate volume of sterile PBS (300 - 500 μL).
[0427] Protocol for Labeling Exosomes in Flow Cytometry
[0428] I. Preparation of control: "Standard_Exosomes" sample
[0429] Reconstitution of exosomes: It is recommended to reconstitute the standard with sterile water to a final concentration of 1 pg / μL.
[0430] · For 100 μg of the standard, add 100 μL of sterile water
[0431] · Vortex briefly and centrifuge
[0432] · Prepare 5 - 7 μL aliquots
[0433] · Store at -80 °C
[0434] II. CD63+ / CD81+ / CD34+ Exosome Labeling - Day 1
[0435] 1. Prepare the starting suspension of the standard exosome control:
[0436] a) 5 μL of standard exosomes + 95 μL of water for injection, final concentration 0.05 μg / μL
[0437] 2. Resuspend the CD63 capture beads by vortexing for approximately 20 seconds
[0438] 3. Add 50 μL of the CD63 capture beads to:
[0439] a) Tube 1 《Background Noise> CD63 Capture Beads》
[0440] b) Tube 2 《Control - Exo Standard》 CD81 FITC (indirect labeling)
[0441] c) Tube 3 - 1: 《Exo ProtheraCytes》 CD81 FITC (indirect labeling)
[0442] d) Tube 3-2: 《Exo ProtheraCytes》CD34PE (Direct Labeling)
[0443] e) Tube 3-3: 《Exo ProtheraCytes》CD81FITC (Indirect Labeling) CD34PE (Direct Labeling)
[0444] f) Tube 4-1: 《Exo Fraction neg》CD81FITC (Indirect Labeling)
[0445] g) Tube 4-2: 《Exo Fraction neg》CD34PE (Direct Labeling)
[0446] h) Tube 4-3: 《Exo Fraction neg》CD81FITC (Indirect Labeling) CD34 PE (Direct Labeling)
[0447] 4. Resuspend IgG1 Capture Beads: Vortex for approximately 20 seconds and add 50 μL of "IgG1 Capture Beads" to 2 FACS tubes:
[0448] a) Tube 5 => Exo (Direct Labeling)
[0449] b) Tube 6 => Exo (Indirect Labeling)
[0450] 5. Prepare Tube Compensation: Add 50 μL of CD63 Capture Beads to:
[0451] a) Tube 7 => (CD63 Beads + Exo )
[0452] b) Tube 8 => (CD63 Beads + Exo )
[0453] c) Tube 9 => (CD63 Beads + Exo )
[0454] 6. Add 100 μL of exosome suspension to:
[0455] a) Tube 2 => Exo Standard
[0456] b) Tube 3 => Exo
[0457] c) Tube 4 => Exo Fraction neg
[0458] d) Tubes 5 and 6 => Exo
[0459] e) Tube 7 => Exo
[0460] f) Tube 8 => Add 100 μL Exo
[0461] g) Tube 9 => Add 100 μL Exo
[0462] 7. Mix the suspension by gently pipetting several times and vortexing for a few seconds.
[0463] 8. Incubate overnight at room temperature (RT) in the dark
[0464] III. CD63+ / CD81+ / CD34+ Exosome Labeling - Day 2
[0465] 9. Add antibodies for identification as follows:
[0466] a) Tube 2: Add 5 μL CD81-biotin (exo standard) (indirect labeling)
[0467] b) Tube 3-1: Add 5 μL CD81-biotin (exo )(indirect labeling)
[0468] c) Tube 3-2: Add 5 μL CD34-PE (exo )(direct labeling)
[0469] d) Tube 3-3: Add 5 μL CD81-biotin and 5 μL CD34-PE (exo )(indirect and direct labeling)
[0470] e) Tube 4-1: Add 5 μL CD81-biotin (exo fraction neg) (indirect labeling)
[0471] f) Tube 4-2: Add 5 μL CD34-PE (exo fraction neg) (direct labeling)
[0472] g) Tube 4-3: Add 5 μL CD81-biotin and 5 μL CD34-PE (exo fraction neg) (indirect and direct labeling)
[0473] h) Tube 5: Add 5 μL IgG1-PE (direct labeling)
[0474] i) Tube 6: Wait for secondary labeling (indirect IgG FITC labeling)
[0475] j) Tube 8: Add 5 μL CD81-biotin (exo )(indirect labeling)
[0476] k) Test tube 9: Add 5 μL of CD34-PE (exo )(Direct labeling)
[0477] 10. Gently tap the test tube to mix
[0478] 11. Incubate for 1 hour at +2 - 8 °C in the dark
[0479] 12. Wash with 1 mL of 1X assay buffer
[0480] 13. Centrifuge the test tube at 2500 g for 5 minutes at +4 °C
[0481] 14. Gently remove the supernatant, leaving approximately 100 μL at the bottom of the test tube (gently remove 1 mL using a p1000 pipette).
[0482] 15. Resuspend the exosomes and beads by adding the following:
[0483] i. For direct labeling test tubes: 150 μL of 1X assay buffer (ImmunoStep, Spain).
[0484] ii. For 2 dary Labeling:
[0485] 1. Add 5 μL of streptavidin-FITC to the following test tubes:
[0486] a. 2
[0487] b. 3-1
[0488] c. 3-3
[0489] d. 4-1
[0490] e. 4-3
[0491] f. 6
[0492] g. 8
[0493] 16. Incubate for 30 minutes at +2 - 8 °C in the dark
[0494] 17. Wash by adding 1 mL of 1X assay buffer
[0495] 18. Centrifuge the test tube at 2500 g for 5 minutes at +4 °C
[0496] 19. Gently remove the supernatant, leaving approximately 100 μL at the bottom of the test tube (gently remove 1 mL using a p1000 pipette).
[0497] 20. Resuspend the exosomes and beads by adding 150 μL of 1X assay buffer
[0498] 21. Collection is carried out in the culture medium on a flow cytometer (it can wait for up to 2 hours at +2 - 8 °C before collection).
[0499] Protocol for microRNA analysis in RT-qPCR
[0500] Exosomes produced:
[0501] a) MicroRNA extraction (RNeasy )
[0502] 1. Transfer 200 μL of serum or plasma to a 2 mL tube
[0503] 2. Add 60 μL of Buffer RPL. Close the tube cap and vortex for > 5 s. Incubate at room temperature for 3 minutes.
[0504] 3. Add 20 μL of Buffer RPP. Close the tube cap and mix vigorously by vortexing for > 20 s. Incubate at room temperature for 3 minutes.
[0505] 4. Centrifuge at 12000 x g for 3 minutes at room temperature to precipitate the pellet. Note: The supernatant should be clear and colorless.
[0506] 5. Transfer the supernatant (~230 μL) to a new reaction tube. Add 1 volume of isopropanol. Mix well by vortexing. Transfer the whole sample to the RNeasy UCP MinElute column. Close the lid and centrifuge at ≥8000 x g for 15 seconds. Discard the flow-through.
[0507] 6. Pipette 700 μL of Buffer RWT onto the RNeasy UCP MinElute spin column. Close the lid and centrifuge at ≥8000 x g for 15 s. Discard the flow-through.
[0508] 7. Pipette 500 μL of Buffer RPE onto the RNeasy UCP MinElute spin column. Close the lid and centrifuge at ≥8000 x g for 15 s. Discard the flow-through.
[0509] 8. Add 500 μL of 80% ethanol to the RNeasy UCP MinElute spin column. Close the lid and centrifuge at ≥8000 x g for 2 minutes. Discard the flow-through and the collection tube.
[0510] 9. Place the RNeasy UCP MinElute spin column in a new 2 mL collection tube. Open the lid of the spin column and centrifuge at full speed for 5 minutes to dry the membrane. Discard the flow-through and the collection tube.
[0511] 10. Place the RNeasy UCP MinElute spin column in a new 1.5 mL collection tube. Add 20 μL of RNase-free water directly to the center of the spin column membrane and incubate for 1 minute. Close the lid and centrifuge at full speed for 1 minute to elute the RNA.
[0512] 11. Store the RNA at -80 °C.
[0513] b) First-strand cDNA synthesis
[0514] Rq: The RNA spike-in tube for RT is an internal extraction and amplification control.
[0515] Before starting:
[0516] - Thaw on ice
[0517] o RNA samples
[0518] o 5x miRCURY RT SYBR Green reaction buffer
[0519] - Place in suspension
[0520] o RNA spike-in: Suspend UnuSp6 in 80 μL of RNase-free water
[0521] o Vortex briefly and centrifuge, incubate on ice for 20 - 30 min
[0522] o Vortex briefly and centrifuge, aliquot and store at -20 °C
[0523] - Take out the 10x miR CURY Rt enzyme tube from the refrigerator
[0524] o Mix gently, place on ice, centrifuge briefly, keep on ice
[0525] 1) Calculate the volume of the RNA sample
[0526] RNA sample [μl] = elution Vol [μl] / starting sample Vol * 16 [μl]
[0527] (1.6 = 20 / 200 * 16)
[0528] 2) Prepare the reverse transcription according to Table 35 below.
[0529] Table 35: Reverse transcription reaction reagents
[0530]
[0531] RT program:
[0532] - 60 min @ 42 °C
[0533] -5 min at 95 °C
[0534] - Infinity at 4 °C
[0535] Frozen at -20 °C
[0536] c) Quantitative real-time PCR
[0537] - Resuspend the following miRCURY LNA PCR assay tubes for the first time:
[0538] o UniSp6 spike-in control PCR assay
[0539] o hsa-mi-103a-3p,
[0540] o miR-130a-3p,
[0541] o miR126-3p
[0542] o Centrifuge before opening, add 220 μL of RNase-free water, vortex at room temperature and centrifuge for 20 minutes
[0543] - Thaw the following tubes
[0544] o 2X miRCURY SYBR Green Master Mix,
[0545] o cDNA,
[0546] o LNA PCR assay tubes (spike-in primer Sp6, mi 103a-3p, miR130a-3p, miR126-3p, RNase-free H2O)
[0547] 1. Dilute the cDNA 1:30 (add 290 μL of RNase-free water to 10 μL of reverse transcription reaction)
[0548] 2. Prepare the reaction mixture according to Table 36 below.
[0549] Table 36: Reaction mixture for quantitative real-time PCR
[0550]
[0551] 3. Add:
[0552] · 3 μL of RT product (1:30 dilution) to each well of 1 PCR plate,
[0553] · 7 μL of mixture / well
[0554] 4. Briefly centrifuge the tubes or plates at room temperature
[0555] 5. Set up the CFX96 program according to Table 37 below.
[0556] Table 37: PCR cycling conditions for the PCTmiCURY LNA miRNA assay
[0557]
[0558] 6. Place the PCR plate in the CFX96 and start the program
[0559] 7. Perform a preliminary analysis using the CFX96 software to obtain the raw Cq value (Cq or CT, depending on the PCR device)
[0560]
[0561] a) MicroRNA extraction
[0562] miRNA cells
[0563] RLT buffer
[0564] 260 μL precipitate < 5 × 10 6 cells
[0565] 450 μL precipitate ≥ 5 × 10 6 cells
[0566] Homogenize by vortexing and pipetting several times, store at -80 °C
[0567] If necessary, thaw the sample,
[0568] Homogenize by vortexing and pipetting several times
[0569] QIAshredder column
[0570] Deposit the lysate
[0571] Centrifuge at 12,000 g for 2 minutes at room temperature
[0572] Add AL buffer
[0573] 80 μL precipitate < 5 × 10 6 cells
[0574] 140 μL precipitate ≥ 5 × 10 6 cells
[0575] Mix vigorously by vortexing and incubate at 20 °C for 3 minutes
[0576] Place the eluate on a gDNA Eliminator column with a 2 mL collection tube
[0577] Centrifuge at 8000g for 30 seconds
[0578] Add 1 volume of isopropanol (340 μL or 590 μL)
[0579] Mix by pipetting, without vortexing
[0580] Apply up to 700 μL of filtrate + ethanol onto the RNeasy column
[0581] Centrifuge at 8000g for 15 seconds at 20 °C
[0582] Discard the eluate
[0583] Repeat the operation if necessary
[0584] Apply 700 μL RWT Buffer
[0585] Centrifuge at 8000g for 15 seconds at 20 °C
[0586] Place the column on a new tube
[0587] Add 500 μL RPE Buffer
[0588] Centrifuge at 8000g for 15 seconds at 20 °C
[0589] Place the column on a new tube
[0590] Add 500 μL of 80% ethanol
[0591] Centrifuge at 8000g for 2 minutes at 20 °C
[0592] Place the column on a new tube
[0593] Centrifuge at 12000g for 1 minute to elute the RNA
[0594] Place the column in a new sterile 1.5 mL microtube
[0595] Add 35 μL of RNase-free water
[0596] Incubate at room temperature for 1 min
[0597] Centrifuge at 12000g for 1 minute to elute the RNA
[0598] Pass the eluate through the RNeasy column again
[0599] Centrifuge at 8000g for 1 minute at 80 °C
[0600] Store the RNA at -80 °C
[0601] b) First-strand cDNA synthesis
[0602] Optimized protocol for using 20 ng RNA in reverse transcription
[0603] For highly expressed miRNAs: Use up to 10 pg of total RNA
[0604] For lowly expressed miRNAs: Use up to 200 ng of total RNA
[0605] Before starting:
[0606] · Thaw on ice
[0607] o RNA sample
[0608] o 5X miRCURY RT SYBR Green reaction buffer
[0609] · Thaw RNAse-free water on ice at room temperature
[0610] o Mix each solution by scraping the tube
[0611] o Vortex briefly and centrifuge; incubate on ice for 20 - 30 min
[0612] · Place in suspension
[0613] · RNA spiking: Spike UniSp6 RNA into 80 μL of RNAse-free water
[0614] o Vortex briefly and centrifuge, incubate on ice for 20 - 30 minutes
[0615] o Vortex briefly and centrifuge, aliquot and store at -20 °C.
[0616] · Take out the 10X miR CURY RT enzyme tube from the refrigerator
[0617] o Mix gently, place on ice, centrifuge briefly, keep on ice
[0618] 1) Dilute the RNA sample to 5 ng / μL in RNAse-free water
[0619] 2) Prepare the RT according to Table 38 below.
[0620] Table 38: Reverse transcription reaction reagents
[0621]
[0622]
[0623] RT program:
[0624] -60 min @ 42 °C
[0625] -5 min at 95 °C
[0626] -infinity at 4 °C
[0627] c) Quantitative real-time PCR
[0628] · Resuspend the following miRCURY LNA PCR assay tubes for the first time:
[0629] o UniSp6 spike-in control PCR assay
[0630] o hsa-mi-103a-3p,
[0631] o miR-130a-3p,
[0632] o miR126-3p
[0633] · Centrifuge before opening, add 220 μL of RNase-free water, and incubate at room temperature for 20 minutes
[0634] · Vortex briefly and centrifuge
[0635] · Thaw the following tubes
[0636] o 2X miRCURY SYBR Green Master Mix,
[0637] o cDNA,
[0638] o LNA PCR assay
[0639] o RNase-free H2O
[0640] 1) Dilute the cDNA 1:60 (add 590 μL of RNase-free water to 10 μL of the RT reaction)
[0641] 2) Prepare the reaction mixture according to Table 39 below.
[0642] Table 39: Reverse transcription reaction reagents
[0643]
[0644] 3) Add:
[0645] · 3 μL of the RT product (1:60 dilution) to each well of 1 PCR plate
[0646] · 7 μL of the mixture per well
[0647] 4) Centrifuge the tubes or plates briefly at room temperature
[0648] 5) Set the CFX96 program according to Table 40 below
[0649] Table 40: PCR cycling conditions for PCTmiCURY LNA miRNA assays
[0650]
[0651] 6) Place the PCR plate in the CFX96 and start the program
[0652] 7) Perform a preliminary analysis using the CFX96 software to obtain the raw Cq value (Cq or CT, depending on the PCR device)
[0653] Summary of the experiments conducted
[0654] Table 41A: Summary table of the experiments conducted
[0655]
[0656] Table 41B: Summary table of the experiments conducted
[0657]
[0658] Results
[0659] Flow cytometry analysis - exosomes from experimental studies 4, 5, 6, 7, and 8
[0660] Table 42: Flow cytometry analysis - exosomes from experimental studies 4, 5, 6, 7, and 8
[0661]
[0662]
[0663] From (positive fraction) exosomes express exosome-specific membrane markers (CD63, CD81), as well as the CD34 marker of the cells from which they are derived ( Figure 16 A). As expected, exosomes from the negative fraction express low levels of the CD34 marker ( Figure 16 B).
[0664] Angiogenic miRNA expression in exosomes derived from CD34+ cells and cells
[0665] Housekeeping gene expression:
[0666] Three housekeeping genes (miR-103a, let7a-5p, and U6) were analyzed to determine which one is the best for analyzing the target miRNA. The results are as Figure 17 shown, demonstrating that U6 is unstable, and thus this housekeeping gene is not retained for this analysis.
[0667] Angiogenic miRNA expression
[0668] I. Results from patient 081 of the EXCELLENT study - Experimental study 7:
[0669] Analysis of three pro - angiogenic miRNAs:
[0670] · miRNA126
[0671] · miRNA130a
[0672] · miRNA378a
[0673] Results of pro - angiogenic miRNAs in exosomes from AMI patient 081 are shown in Figure 18 , where the key to the figure is:
[0674] · PtF+ cells = patient_positive fraction_cells
[0675] · PtF+ cells = patient_positive fraction_exosomes
[0676] · PtF - cells = patient_negative fraction_cells
[0677] · PtF - cells = patient_negative fraction_exosomes
[0678] Compared with cells, pro - angiogenic miRNAs 126, 130a, 378a are more expressed in exosomes.
[0679] Analysis using the let 7a - 5p housekeeping gene showed better results in miRNA expression and was retained for analysis. In the positive fraction, for the same miRNAs, when comparing their expression in exosomes (PtF+Exo) with their expression in cells (PtF+ cells), the results are as follows:
[0680] · miRNA 126 is expressed 3.3 - fold more in exosomes compared with cells.
[0681] · miRNA 130a is expressed 5.4 - fold more in exosomes compared with cells.
[0682] · miRNA 378a is expressed 2.4 - fold more in exosomes compared with cells.
[0683] These results are consistent with those previously published by Sahoo et al. 2011: “Exosomes From Human CD34+ Stem Cells Mediate Their Proangiogenic Paracrine Activity” (Circ Res., 2011 Sep 16; 109(7):724-8).
[0684] II. Results from healthy donors (FHD) in experimental studies 4, 5, 6, and 8
[0685] Results of angiogenic miRNAs in exosomes from healthy donors (FHD) - Experimental studies 4, 5, 6, and 8 are shown in Figure 19 , where the key to the figures is:[[]]
[0686] · PtF+ cells = patient_positive fraction_cells
[0687] · PtF+ exosomes = patient_positive fraction_exosomes
[0688] · PtF- cells = patient_negative fraction_cells
[0689] · PtF- exosomes = patient_negative fraction_exosomes
[0690] · C4.1 - miRNA study 4_FHD([[]] Figure 19 A)[[]]
[0691] o Assay_cytokine comparison - 1 - K0321 - 12120
[0692] · C5.1 - miRNA study 5_FHD([[]] Figure 19 B)[[]]
[0693] o Assay_cytokine comparison - 2 - K0321 - 12120
[0694] · C6.1 - miRNA study 6_FHD([[]] Figure 19 C)[[]]
[0695] o Assay_cytokine comparison - 3 - K0321 - 12120
[0696] · C8.1 - miRNA study 8_FHD([[]] Figure 19 D)[[]]
[0697] o Assay_Stab_SF 279511T0M
[0698] Finally, analysis of mean microRNA expression using the let 7a-5p housekeeping gene (in FHD+ patients) showed that, in the positive fractions of the same microRNAs, when their expression in exosomes was compared to their expression in cells, the following results were obtained:
[0699] · There was no difference in the expression of miRNA 126
[0700] · miRNA 130a was expressed 3.8-fold more in exosomes compared to cells.
[0701] · miRNA 378a was expressed 1.8-fold more in exosomes compared to cells.
[0702] Data on angiogenic miRNAs in exosomes are shown in Figure 20 and Table 43 below, where RTqPCT_exosomes were from FHD (n = 5) and AMI patients (n = 1)
[0703] Figure 20 The key to the figures is as follows:
[0704] · PtF+ cells = patient_positive fraction_cells
[0705] · PtF+ cells = patient_positive fraction_exosomes
[0706] · PtF- cells = patient_negative fraction_cells
[0707] · PtF- cells = patient_negative fraction_exosomes
[0708] Table 43: Angiogenic miRNAs in exosomes - RTqPCT_exosomes from FHD (n = 5) and AMI patients (n = 1) of.
[0709] miR126 - 3p miR130a - 3p miR378a - 3p Cell F+ 1.2102 1.2102 0.8829 Exosome F+ 1.2746 4.6177 1.6186 Cell F - 0.8899 0.1749 1.0000 Exosome F - 5.8093 2.0352 1.6897
[0710] III. MicroRNA Results for Patients 062, 065, 066, 068, 072, 079, and 081 (EXCELLENT Study) - Experimental Study 9
[0711] Previous studies have shown that adult CD34+ cells secrete exosomes containing high levels of angiogenic microRNAs, such as angiogenic microRNAs 126 and 130a (Sahoo et al., 2011).
[0712] To study this, CD34+ cells were analyzed after 9 days of culture The expression of the following miRNAs in exosomes (exosomes: nanovesicles produced) from 7 patients (062, 065, 066, 068, 072, 079, and 081):
[0713] · Angiogenic miRNAs: miR126-3p, miR130a-3p, miR21, miR26a, miR378a
[0714] · Anti-apoptotic miRNAs: miR146a, miR21
[0715] · miRNAs that increase cardiomyocyte proliferation: miR199a, miR590
[0716] · Anti-fibrotic miRNA: MIR133a
[0717] The microRNA results are shown in Figure 21 and 22 .
[0718] The comparison of the average miRNA expression obtained in these produced exosomes with the miRNA expression obtained in the of the 7 analyzed patients ( Figure 22 ) showed that:
[0719] - miR-130a was expressed 6.9-fold more in exosomes
[0720] - miR-126 was expressed 4.4-fold more in exosomes
[0721] - miR-378a was expressed 3.2-fold more in exosomes
[0722] - miR-21 was expressed 12.1-fold more in exosomes
[0723] - miR-26a was expressed 3.2-fold more in exosomes
[0724] - miR-133a was expressed 2.7-fold more in exosomes
[0725] - miR-146a was expressed 3.5-fold more in exosomes
[0726] - miR-199a was expressed 4.6-fold more in exosomes
[0727] - miR-590 was expressed 13.5-fold more in exosomes
[0728] Conclusion
[0729] Pro-angiogenic, anti-apoptotic, and other miRNAs that play a role in myocardial regeneration are expressed in exosomes derived from expanded CD34+ cells from patients with acute myocardial infarction (AMI). Increasing evidence indicates that miRNAs play important roles in myocardial regeneration.
[0730] miRNAs play a role in cardiac repair by regulating angiogenesis, proliferation, apoptosis, and metabolism. Previous studies have shown that exosomes secreted by adult CD34+ stem cells contain high levels of pro-angiogenic microRNAs, such as pro-angiogenic microRNA126 and 130a (Sahoo et al., 2011).
[0731] To investigate this, CD34+ cells cultured for 9 days were analyzed with exosomes (exosomes: nanovesicles produced) from 7 patients (062, 065, 066, 068, 072, 079, 081) from the EXCELLENT clinical study for the expression of the following miRNAs:
[0732] · Pro-angiogenic miRNAs such as miR126, miR130a, miR21, miR26a, miR378a
[0733] · Anti-apoptotic miRNAs such as miR146a, miR21
[0734] · miRNAs that increase cardiomyocyte proliferation: miR199a, miR590
[0735] · Anti-fibrotic miRNAs such as MIR133a
[0736] The results showed that exosomes from had significantly higher expression of all the miRNAs analyzed compared to cells, except for miR133a. The expression of miR-126, miR-130a, miR-21, miR-26, and miR-378a confirmed the pro-angiogenic effect of the derived exosomes.
[0737] These results suggest that is capable of secreting exosomes containing pro-angiogenic miRNAs, which may lead to the induction of angiogenesis and contribute to the vascular repair process after AMI. These results further suggest that may protect cardiomyocytes from immediate apoptosis after AMI by secreting exosomes containing multiple anti-apoptotic miRNAs.
[0738] References:
[0739] 1. Pasquet S, Sovalat H, Henon P et al. Long-term benefit of intracardiac delivery of autologous granulocyte-colony-stimulating factor mobilized blood CD34+ cells containing cardiac progenitors on regional heart structure and function after myocardial infarct. Cytotherapy 2009;11:1002-1015.
[0740] 2. Sahoo S, Klychko E, Thorne T, Misener S, Schultz KM, Millay M, Ito A, Liu T, Kamide C, Agrawal H, Perlman H, Qin G, Kishore R, Losordo DW. Exosomes from human CD34(+) stem cells mediate their proangiogenic paracrine activity. Circ Res. 2011;109(7):724-8.
[0741] 3. Saucourt C, Vogt S, Merlin A, Valat C, Criquet A, Harmand L, Birebent B, Rouard H, Himmelspach C, Jeandidier E, Chartois-Leaute AG, Derenne S, Koehl L, Salem JE, Hulot JS, Tancredi C, Aries A, Jude S, Martel E, Richard S, Douay L, Henon P. Design and Validation of an Automated Process for the Expansion of Peripheral Blood-Derived CD34+ Cells for Clinical Use After Myocardial Infarction. Stem Cells Transl Med. 2019;8(8):822-832.
[0742] Embodiments of the present invention are set forth in the following numbered paragraphs:
[0743] 1. An in vitro method for selecting CD34+ cells, comprising:
[0744] (i) determining the amount of VEGF expressed by a population of CD34+ cells, and
[0745] (ii) selecting CD34+ cells based on the amount of VEGF expressed by said population.
[0746] 2. The method of paragraph 1, wherein said CD34+ cells are selected if the amount of VEGF expressed by the cells is at least about 150 pg / ml.
[0747] 3. The method of paragraph 1, wherein said CD34+ cells are selected if the amount of VEGF expressed by the cells is at least about 1 fg / cell.
[0748] 4. An in vitro method for selecting CD34+ cells, comprising:
[0749] (i) detecting one or more microRNAs expressed by a population of CD34+ cells and / or contained in their exosomes, and
[0750] (ii) selecting CD34+ cells based on said one or more microRNAs expressed by said population.
[0751] 5. An in vitro method for selecting CD34+ cells, comprising:
[0752] (i) detecting one or more microRNAs expressed by a population of CD34+ cells and / or contained in their exosomes and determining the amount of VEGF expressed by a population of CD34+ cells, and
[0753] (ii) selecting CD34+ cells based on the detected one or more microRNAs and the amount of VEGF expressed.
[0754] 6. The method of paragraph 4 or paragraph 5, wherein said CD34+ cells are selected if the expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590 and miR133a is detected.
[0755] 7. The method of paragraph 6, wherein said CD34+ cells are selected if the expression of one or more or each of miR126, miR130a, miR21, miR26a and miR378a is detected.
[0756] 8. The method of paragraph 6 or paragraph 7, wherein if the expression of one or more or each of miR21, miR26a and miR378a is detected, the CD34+ cells are selected.
[0757] 9. The method of paragraph 6, wherein if the expression of miR146a and / or miR21 is detected, the CD34+ cells are selected.
[0758] 10. The method of paragraph 6, wherein if the expression of miR199a and / or miR590 is detected, the CD34+ cells are selected.
[0759] 11. The method of any preceding paragraph, wherein the CD34+ cells are human CD34+ cells.
[0760] 12. The method of any preceding paragraph, wherein the CD34+ cells are autologous or allogeneic CD34+ cells.
[0761] 13. The method of any preceding paragraph, the method further comprising expanding the population of CD34+ cells before and / or after step (i) or (ii).
[0762] 14. The method of paragraph 13, wherein the cells are expanded for 9 days.
[0763] 15. The method of paragraph 13 or paragraph 14, wherein the expansion comprises one or more of the following:
[0764] · Expanding at 37 °C,
[0765] · Expanding in a controlled atmosphere of 5% CO2, and / or
[0766] · Expanding in a medium containing cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin and / or Fms-like tyrosine kinase 3 ligand.
[0767] 16. The method of any preceding paragraph, wherein the amount of VEGF is determined by ELISA or automated ELISA (ELLA).
[0768] 17. The method of any paragraph of paragraphs 1 to 16, wherein the amount of VEGF is determined by mass spectrometry.
[0769] 18. The method of any paragraph of paragraphs 1 to 16, wherein the amount of VEGF is determined by radioimmunoassay.
[0770] 19. The method of any paragraph of paragraphs 1 to 16, wherein the amount of VEGF is determined by multiplex assay.
[0771] The method according to any of the preceding paragraphs, further comprising collecting, centrifuging, and / or purifying the selected cells, optionally wherein the purification is performed by immunoselection.
[0772] The method according to any of the preceding paragraphs, wherein the cells are for treatment.
[0773] An isolated population of CD34+ cells selected by the method according to any of paragraphs 1 to 21.
[0774] An isolated population of CD34+ cells selected by the method according to any of paragraphs 1 to 21, which is for treatment.
[0775] An isolated population of CD34+ cells selected by the method according to any of paragraphs 1 to 21, which is for treatment of myocardial infarction.
[0776] The isolated population of CD34+ cells according to paragraph 23 or 24, wherein administration of the CD34+ cells to a subject reduces NT-proBNP in the subject.
Claims
1. An in vitro method for selecting CD34+ cells, comprising: (i) determining the amount of VEGF expressed by a CD34+ cell population, and (ii) selecting CD34+ cells based on the amount of VEGF expressed by said population.
2. The method according to claim 1, wherein the CD34+ cells are selected if the amount of VEGF expressed by the cells is at least about 1 fg / cell.
3. An in vitro method for selecting CD34+ cells, comprising: (i) detecting one or more microRNAs expressed by a CD34+ cell population and / or contained in its exosomes, and (ii) selecting CD34+ cells based on said one or more microRNAs expressed by said population.
4. An in vitro method for selecting CD34+ cells, comprising: (i) detecting one or more microRNAs expressed by a CD34+ cell population and / or contained in its exosomes and determining the amount of VEGF expressed by the CD34+ cell population, and (ii) selecting CD34+ cells based on the detected one or more microRNAs and the amount of VEGF expressed.
5. The method according to claim 3 or claim 4, wherein the CD34+ cells are selected if the expression of one or more or each of miR126, miR130a, miR21, miR26a, miR378a, miR146a, miR199a, miR590 and miR133a is detected.
6. The method according to any one of the preceding claims, wherein the CD34+ cells are human CD34+ cells, and / or wherein the CD34+ cells are autologous or allogeneic CD34+ cells.
7. The method according to any one of the preceding claims, further comprising amplifying the CD34+ cell population before and / or after step (i) or (ii), optionally wherein the cells are amplified for 9 days.
8. The method according to claim 7, wherein the amplification comprises one or more of the following: · Amplifying at 37 °C, · Amplifying in a 5% CO2 controlled atmosphere, and / or · Amplifying in a medium containing cytokines such as interleukin 6 (IL6), interleukin 3 (IL3), stem cell factor, thrombopoietin and / or Fms-like tyrosine kinase 3 ligand.
9. The method according to any one of the preceding claims, wherein the amount of VEGF is determined by ELISA, automated ELISA (ELLA), mass spectrometry, radioimmunoassay or multiplex assay.
10. The method according to any one of the preceding claims, further comprising collecting, centrifuging and / or purifying the selected cells, optionally wherein the purification is performed by immunoselection.
11. The method according to any one of the preceding claims, wherein the cells are for therapy.
12. An isolated CD34+ cell population selected by the method according to any one of claims 1-11.
13. An isolated CD34+ cell population selected by the method according to any one of claims 1-11, which is for therapy.
14. An isolated population of CD34+ cells selected by the method according to any one of claims 1-11, for use in the treatment of myocardial infarction.
15. The isolated population of CD34+ cells according to claim 13 or 14, wherein administration of the CD34+ cells to a subject reduces NT-proBNP in the subject.
Citation Information
Patent Citations
Automated apparatus and method of cell culture
US10676705B2