Preparation method and application of fermented feed for targeted regulation and control of pig intestinal lactobacillus reuteri
Through the fermented feed preparation method with specific bacterial strain combination and process optimization, targeted regulation of Lactobacillus reuteri in the pig intestine has solved the problems of unstable effects and limited improvement in production performance in the existing technology, and achieved the dual improvement of feed nutrition and animal health.
Patent Information
- Application Number
- CN202510567250.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-30
- Publication Date
- 2025-06-27
AI Technical Summary
Existing fermented feeds are difficult to target the regulation of Lactobacillus reuteri in intestinal proliferation in pigs, resulting in unstable results. There is a lack of fast and reliable in vitro model to evaluate the impact of fermented feed on intestinal flora, and the production performance improvement is limited.
Through specific bacterial species combination and process optimization, a fermentation feed targeted regulating Lactobacillus reuder intestine was prepared. The method includes the mixing of raw materials into corn, soybean meal, and rice lees, adding lacticococcus lacticococcus and Bacillus licheniformis, and optimizing the nutritional composition and bacterial structure of the feed through the addition of complex enzymes and the regulation of the fermentation process. At the same time, an in vitro evaluation model was established to verify the effect of the feed through mixing with pig manure and anaerobic culture.
The dual improvement of feed nutrition and animal health has been achieved, and the production performance of sows and piglets has been significantly improved, including enhanced digestion and absorption capacity, improved immunity and reduced diarrhea rate.
Smart Images

Figure CN120203162A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of animal feed, and specifically relates to a preparation method of a fermented feed for targeting and regulating Lactobacillus reuteri in the pig intestine and its application in livestock and poultry production. Background Art
[0002] The live pig breeding industry is an important industry related to the national economy and people's livelihood and occupies a very important position in China. Pork is the main meat food for Chinese residents. However, the live pig breeding faces severe challenges: Since the outbreak of African swine fever, it has seriously affected the live pig breeding in China. There is no generally recognized optimal solution to ensure the health of live pigs under the biosafety such as African swine fever; after the complete ban on antibiotics in feed, the growth performance and immunity of pigs have decreased. How to achieve green and healthy breeding of live pigs; the pressure of environmental protection and green breeding continues to increase. How to improve the nutrient emission reduction of live pigs, etc.
[0003] The existing technologies have the following problems: Inaccurate flora regulation: Traditional fermented feeds are difficult to target and promote the proliferation of specific probiotics (such as Lactobacillus reuteri), resulting in unstable effects; Insufficient evaluation methods: There is a lack of a rapid and reliable in vitro model to evaluate the impact of fermented feeds on the intestinal flora; Limited improvement in production performance: The fermentation process is not optimized, the anti-nutritional factors are not thoroughly degraded, and the feed utilization rate is low.
[0004] The published patent CN111820329A proposes a fermented feed for lactating and weaning piglets, but its strain combination is not targeted at regulating Lactobacillus reuteri, and no in vitro evaluation model is provided. Therefore, there is an urgent need for a fermented feed technology that can precisely regulate the intestinal flora and improve production performance.
[0005] The intestinal microecology is closely related to the growth and health of pigs and plays an important role in improving digestion and absorption, body immunity, etc. In recent years, some studies have found that fermented feeds can regulate the intestinal microecology of pigs, prevent diseases caused by intestinal flora imbalance, and improve the production performance of pigs. On the one hand, fermented feeds may act as potential prebiotics to promote the growth of beneficial intestinal bacteria; on the other hand, fermented feeds also provide probiotic flora, which affects the intestinal microorganisms. However, the causal relationship between fermented feeds and pig intestinal microorganisms, as well as how to precisely regulate them, etc., urgently need to be solved. Summary of the Invention
[0006] The purpose of the present invention is to provide a preparation method of a fermented feed and its application. Through a specific strain combination and process optimization, it targets and promotes the proliferation of Lactobacillus reuteri in the pig intestine. At the same time, an in vitro evaluation model is established to verify its effect, so as to achieve the dual improvement of feed nutrition and animal health.
[0007] To achieve the above purpose, the present invention adopts the following technical solutions: 1. Fermentation Feed Preparation Method Raw material ratio: Corn, soybean meal, and yellow rice wine distillers' grains are mixed in a mass ratio of 4:4:2 to 4.5:4.5:1; preferably, the raw materials are in a mass ratio of corn:soybean meal:yellow rice wine distillers' grains = 4:4:2.
[0008] Strain addition: Add Pediococcus acidilactici ( Pediococcus acidilactici , preservation number CGMCC NO: 1.12332) at 0.06% - 0.10% of the total mass of the fermentation raw materials, and add Bacillus licheniformis ( Bacillus licheniformis , preservation number CGMCC NO: 1.9048) at 0.10% - 0.12%; add a compound enzyme at 0.1 - 0.2%, and the compound enzyme includes cellulase, hemicellulase, and xylanase, which are mixed in a mass ratio of 1:1:1; preferably, the compound enzyme can also include α-amylase, which is mixed with the cellulase, hemicellulase, and xylanase in a mass ratio of 1:1:1:1; preferably, the addition amount of Pediococcus acidilactici powder is 0.08%, the addition amount of Bacillus licheniformis powder is 0.11%, and the addition amount of the compound enzyme is 0.15%.
[0009] Fermentation process: Adjust the moisture to 35% - 40%, ferment statically at a constant temperature of 30°C for 3 days until the pH drops below 4.5, and the viable count of Pediococcus acidilactici in the final feed reaches 4.7×10 8 CFU / g, and the viable count of Bacillus licheniformis reaches 5.3×10 8 CFU / g.
[0010] 2. In Vitro Evaluation Method Take the fermented feed after boiling and mix it with the pig feces sample in a volume ratio of 1:1; preferably, the mixing ratio of the fermented feed to the feces is 2.5 mL of the fermented feed solution and 2.5 mL of the feces suspension.
[0011] Inoculate into a sterile medium (formula: peptone 2 g / L, yeast powder 2 g / L, Tween 80 0.16 g / L, NaHCO3 2 g / L, NaCl 0.1 g / L, K2HPO4 0.04 g / L, CaCl2 0.01 g / L, MgSO4 0.01 g / L, heme 0.02 g / L); Cultivate with shaking at 155 rpm under anaerobic conditions at 37°C for 12 - 14 hours, and detect the abundance of lactic acid bacteria and the absolute content of Lactobacillus reuteri.
[0012] 3. Production Application Replace corn and soybean meal with the fermented feed at 10% of the total weight of the daily diet, and add 1.0% - 2.0% soybean oil; Significantly improve the feed intake of sows (6.16 kg / d vs. 5.76 kg / d), reduce backfat loss (1.28 mm vs. 2.11 mm), increase the weaning weight gain of piglets (4.33 kg vs. 3.92 kg), and reduce the diarrhea rate (1.05% vs. 1.57%).
[0013] The beneficial effects of the present invention are as follows: 1. Nutrition improvement: After fermentation, the crude protein increases from 27.38% to 28.27%, the acid-soluble protein increases from 3.57% to 12.52%, and the anti-nutritional factors (such as glycinin) are reduced by 85.3% (Table 1); 2. Microflora regulation: The absolute content of Lactobacillus reuteri in the feces of sows in the fermented feed group increases by 2.5 times, and the abundance of lactic acid bacteria in the in vitro fermentation broth increases by 40%; 3. Production performance optimization: The milk protein content of sows increases from 4.38% to 4.92%, the milk fat content increases from 6.57% to 7.31%, and the daily weight gain of piglets increases by 3.58% (Table 3). Description of the Drawings
[0014] Figure 1 It is the scatter plot of the principal component analysis (PCA) of the main components of the fermented feed for targeted regulation of Lactobacillus reuteri in the pig intestine of the present invention. The horizontal axis is Axis 1 (49.3%), representing the principal component 1, which explains 49.3% of the data variation; the vertical axis is Axis 2 (32.2%), representing the principal component 2, which explains 32.2% of the data variation; the pink dots represent the control group, and the cyan dots represent the fermented feed group.
[0015] Figure 2 It is the stacked bar chart of the microbial community composition of the fermented feed for targeted regulation of Lactobacillus reuteri in the pig intestine of the present invention. Among them, the different color layers represent the relative abundances of each bacterial genus, and the legend at the bottom clarifies the name of the bacterial genus corresponding to each color, which will be described in detail later.
[0016] Figure 3 It is the impact of the fermented feed for targeted regulation of Lactobacillus reuteri in the pig intestine of the present invention on the intestinal flora of growing pigs, the principal component analysis (PCA) chart. Among them, the horizontal axis is the principal component 1, that is, the fermented feed group, which explains 18.4% of the data variation and reflects the main difference direction of the samples in this dimension; the vertical axis is the principal component 2, that is, the control group, which explains 17.3% of the data variation and is the second most important variation dimension; the red dots represent the control group, which are circled by a pink ellipse, and the samples within the group are aggregated, showing the similarity within the group; the green dots represent the fermented feed group, which are circled by a green ellipse, and the samples within the group are also aggregated.
[0017] Figure 4The impact of the fermented feed targeting the regulation of Lactobacillus reuteri in the pig intestine on the intestinal flora of growing pigs, heat map, color scale (Z - score): The color bar on the left shows the Z - score range, where red (0.6) indicates high abundance and blue (-0.2) indicates low abundance; microbial classification: The microbial names are listed on the right, including the genus (g__), family (f__), and class (c__) levels; sample distribution: The horizontal axis represents the sample names, with the CON series being the control group and the MFD series being the fermented feed group.
[0018] Figure 5 The bar chart of the relative abundance of the microbial community in the intestinal flora of growing pigs by the fermented feed targeting the regulation of Lactobacillus reuteri in the pig intestine of the present invention. The vertical axis is "Relative abundance" (relative abundance), and the height of each color layer in each bar reflects the proportion of the abundance of the corresponding microbial group in the samples of this group.
[0019] Figure 6 The enrichment map of the fermented feed targeting the regulation of Lactobacillus reuteri in the intestinal microorganisms of sows and piglets of the present invention. Among them, the vertical axis: Relative abundance, %, represents the relative abundance (percentage), and the horizontal axis: includes two categories, namely "sow intestinal OTU 4417690" and "piglet intestinal OTU 561796", where OTU represents the operational taxonomic unit, and "*" and "***" represent significant and extremely significant respectively.
[0020] Figure 7 The absolute quantification map of Lactobacillus reuteri in the feces and in vitro fermentation broth of sows and piglets by the fermented feed targeting the regulation of Lactobacillus reuteri in the pig intestine of the present invention, where "*" indicates a significant difference between the two groups. Detailed implementation mode
[0021] The content of the present invention will be described in more detail below in conjunction with the embodiments. It should be understood that the implementation of the present invention is not limited to the following embodiments, and any formal modification or change made to the present invention falls within the protection scope of the present invention; and the methods in the following embodiments are conventional methods in the art unless otherwise specified.
[0022] Example 1: Preparation of fermented feed Take corn, soybean meal, and yellow rice wine distillers grains as raw materials and pre - mix them in a mass ratio of 4:4:2; add 0.08% of Lactococcus lactis powder and 0.11% of Bacillus licheniformis powder of the total mass of the fermentation raw materials to warm water to prepare the fermentation seed liquid, then add the pre - mixed fermentation raw materials and 0.15% of the compound enzyme, so that the total moisture content accounts for 35% - 40% of the total mass of the fermentation system, and stir evenly; the above - mentioned Pediococcus acidilactici powder ( Pediococcus acidilacticiwas deposited in the China General Microbiological Culture Collection Center with the deposit number CGMCC NO: 1.12332; Bacillus licheniformis ( Bacillus licheniformis was purchased from the China General Microbiological Culture Collection Center with the deposit number CGMCC NO: 1.9048 and has good lactic acid-producing ability. The composite enzyme includes α-amylase, which is mixed with the cellulase, hemicellulase, and xylanase in a mass ratio of 1:1:1:1. The above fermentation system is filled into a common feed bag and fermented statically at a constant temperature of 30 °C for 3 days. It can be used when the pH of the feed in the bag drops to 4.5.
[0023] Table 1 Changes in Feed Nutritional Components before and after Fermentation Item Before fermentation After fermentation Dry matter, % 89.45 89.95 Crude protein, % 27.38 28.27 Acid-soluble protein, % 3.57 12.52 Neutral detergent fiber, % 15.02 7.95 Resistant starch, % 4.99 2.31 Glycinin, mg / g 57.47 8.46 pH 6.72 4.62 <![CDATA[Bacillus licheniformis, cfu·g −1 > - <![CDATA[5.3×10 8 > <![CDATA[Pediococcus acidilactici, cfu·g −1 > - <![CDATA[4.7×10 8 > As can be seen from Table 1, fermentation increases the crude protein, acid-soluble protein, and probiotic content of the feed, reduces the anti-nutritional factors and pH, and the degradation rate of soy globulin reaches 85.3%.
[0024] In vitro evaluation of the effect of fermented feed on the flora The preparation of the fecal in vitro fermentation medium is shown in Table 2. Take 1 g of fermented feed and place it in 25 mL of sterile medium, and boil for 10 min. Inoculate 0.1 g of fecal samples from (Duroc×Landrace×Yorkshire) growing pigs (40.69 ± 1.16 kg body weight) into 5 mL of sterile medium. Subsequently, take 2.5 mL of the homogenized fecal suspension and mix it with 2.5 mL of the fermented feed solution, and culture it on a shaker (155 rpm) under anaerobic conditions at 37 °C for 14 h. Take 1 mL of the fermentation broth, freeze it at -80 °C, and then perform 16S microbial detection.
[0025] Table 2 Preparation of In Vitro Fermentation Medium Composition Dosage for 1L system Peptone 2g Yeast extract 2g Tween 80 0.16g <![CDATA[NaHCO3]]> 2g NaCl 0.1g <![CDATA[K2HPO4]]> 0.04g <![CDATA[Calcium chloride]]> 0.01g <![CDATA[MgSO4]]> 0.01g Hemin 0.02g As Figure 1 can be seen, the effects of the feed before and after fermentation on the structure of the in vitro fermented porcine intestinal flora are significantly different. As Figure 2 can be seen, in the fermented feed group, "Lactobacillus genus ( Lactobacillus )" is marked with a specific color (pink series) and occupies a certain proportion in the column, showing its abundance in this group. By comparison, it can be seen that there are differences in the microbial compositions of the two groups, intuitively presenting the effect of fermented feed on the microbial community structure and facilitating the analysis of the relative abundance changes of various microorganisms in the two groups of samples. It can be known that fermented feed can promote the abundance of porcine intestinal Lactobacillus.
[0026] In the figure, Escherichia : Escherichia; Methanobrevibacter : Brevibacterium; YRC22, CF231, L7A_E11, 0206 are unknown groups; Lactobacillus : Lactobacillus; Oscillospira: Oscillospira; Pedococcus : Pediococcus; Bacteroides : Bacteroides; Eubacterium : Eubacterium; Clostridium : Clostridium; Enterococcus : Enterococcus; Bacillus : Bacillus; Lactococcus : Lactococcus; Dorea : Dorea; Not_Assigned: Unassigned; Parabacteroides : Parabacteroides; Sporosarcina : Sarcina; Desulfovibrio : Desulfovibrio; Paenibacillus : Paenibacillus; Streptococcus : Streptococcus; Phascolarctobacterium : Phascolarctobacterium; Treponema : Treponema; Coprococcus : Coprococcus; Turicibacter : Turicibacter; Adlercreutzia : Adlercreutzia; Blautia : Blautia; Prevotella : Prevotella; Ruminococcus : Ruminococcus; Peptococcus : Peptococcus; Bifidobacterium : Bifidobacterium.
[0027] Absolute quantification of feces from sows and piglets in the fermented feed group. Genomic DNA of sow fecal samples was extracted, and the concentration and quality of DNA samples were measured using a ultra-micro nucleic acid analyzer. A standard curve for the copy number of Lactobacillus reuteri was established using SYBR Green real-time PCR, and the PCR primers were as follows. The reaction system included 12.5 μl of 2×Taq PCR Master mix, 1 μl of fecal DNA sample, 0.5 μl of each upstream and downstream primer, and 10.5 μl of sterile H2O. The mixed system was at 95°C for 5 min; 95°C for 10 s, 52°C for 50 s, for 40 cycles; 95°C for 15 s, 62°C for 15 s. The abundance of Lactobacillus reuteri in the samples was calculated according to the standard curve.
[0028] Primer 5’----3’: Lreu-1F CAGACAATCTTTGATTGTTTAG; Lreu-4R GCTTGTTGGTTTGGGCTCTTC As Figure 6 and Figure 7 shown, lactic acid bacteria in the intestinal microbiota of sows and piglets were enriched in the fermented feed group. The OTU with the largest difference in lactic acid bacteria was compared with the NCBI database, and all were found to be Lactobacillus reuteri. The absolute content of Lactobacillus reuteri was 1.2×106 CFU / mL increased to 3.0×10 6 CFU / mL. To verify the omics data, absolute quantification of bacteria was used to find that Lactobacillus reuteri in the feces of sows and piglets was enriched in the fermented feed group. Further, anaerobic fermentation of the feces of control group sows in vitro showed that the absolute content of Lactobacillus reuteri LR in the in vitro fermentation broth with fermented feed as the substrate increased significantly. Therefore, the results of relative abundance and absolute content in vivo and in vitro jointly indicated that fermented feed could target the regulation of lactic acid bacteria in the pig intestine, especially the proliferation of Lactobacillus reuteri, reflecting the promoting effect of fermented feed on the enrichment of Lactobacillus reuteri.
[0029] Sow performance test In this experiment, 60 healthy Landrace×Large White sows were selected and randomly divided into 2 treatment groups according to the principles of sow expected farrowing date, parity, body condition, genetic background and reproductive performance, with 30 sows in each group. Treatment 1 was the basal diet (control group), and 10% fermented feed was added to the basal diet in Treatment 2. The experimental period was from 85 days of sow pregnancy to 21 days after piglet weaning. The crude protein and digestible energy of the diets in each group were the same, meeting the nutritional requirements of NRC (2012), and fed in the form of wet mash.
[0030] Table 3. Effects of fermented feed on sow performance
[0031] The results in Table 3 showed that: The average daily feed intake of sows in the experimental group increased by 6.9% (6.16 kg / d vs. 5.76 kg / d); The backfat loss decreased by 39.3% (1.28 mm vs. 2.11 mm); The milk protein content increased by 11.6% (4.92% vs. 4.38%), and the milk fat content increased by 11.3% (7.31% vs. 6.57%).
[0032] Compared with the control group, 10% fermented feed could significantly increase the feed intake of sows and the litter weight at weaning, reduce the stillbirth rate, and significantly increase the milk production and milk protein content of sows. (a, b indicate significant differences).
[0033] By Figure 3It can be seen that the two groups of samples are clearly separated in the figure, indicating that there are significant differences between the control group and the fermented feed group in the analyzed variables (such as microbial community composition, metabolite content, etc.). By reducing the dimension, PCA projects high-dimensional data onto a low-dimensional plane, visually presenting the differences between groups and the clustering within groups, which is convenient for quickly judging the distribution characteristics and difference degrees of samples in different treatment groups. The samples of the control group are concentrated on the left, and the samples of the fermented feed group are concentrated on the right. There is a clear distinction especially in the first principal component, that is, the fermented feed group, and there is also a certain separation on the vertical axis, further verifying the differences between the two groups.
[0034] It can be seen from Figure 4 that this is a heat map used to show the standardized abundances (Z - score) of different microbial taxa in the control group (CO1 - CO6) and the fermented feed group (MFD1 - MFD6); g__ Lactobacillus : Lactobacillus, g__ Succiniclasticum : Succinivibrio, f__WCHB1 - 25: Family WCHB1 - 25, c__GKS2 - 174: Class GKS2 - 174, f__ Clostridiaceae : Clostridiaceae, f__ Enterobacteriaceae : Enterobacteriaceae, g__ Turicibacter : Turicibacter, g__ Klebsiella : Klebsiella, g__ Clostridium : Clostridium, g__SMB53: Genus SMB53, f__ Peptostreptococcaceae : Peptostreptococcaceae.
[0035] In summary, fermented feed can significantly change the structure of the pig intestinal flora and promote the abundance of lactic acid bacteria in the sow intestine.
[0036] Piglet production performance test In this experiment, 216 healthy (Duroc × Landrace × Yorkshire) growing pigs at about 40 days old with an average weight of 9.25 ± 0.78 kg were selected. The feeding period was 24 days. At 25 days, they were weighed and 6 piglets with similar weights in each group were selected for slaughter and sampling. The experimental animals were randomly divided into 2 treatment groups, with 6 replicates in each treatment (half male and half female), and 18 pigs in each replicate. The experiment included 2 kinds of diets. Treatment 1 was a corn - soybean meal - based basal diet (control group); in Treatment 2, 10% of the fermented compound feed was used to replace corn and soybean meal in the basal diet isonitrogenously, without adding antibiotics, and the nutritional level was guaranteed to be the same as that of the basal group diet, and they were fed with pellet feed.
[0037] Table 4. Effects of fermented feed on piglet production performance Item Control group 10% fermented feed Standard error Value Initial weight, kg 9.29 9.24 0.35 0.72 Final weight, kg 19.02 18.95 0.92 0.34 Average daily gain, g 391 405 19.11 0.09 Average daily feed intake, g 599 621 29.93 0.42 Feed conversion ratio 1.53 1.52 0.06 0.15 Diarrhea rate, % 8.23 6.18 0.22 0.02 As can be seen from Table 4, compared with the control group, the daily feed intake of piglets in the 10% fermented feed group increased by 3.67%; the daily weight gain increased by 3.58%, the feed-to-weight ratio decreased by 1.65%, and at the same time, the diarrhea of piglets was effectively controlled.
[0038] As Figure 5 can be seen, the bar chart of the relative abundances of the microbial communities in the control group and the fermented feed group. The vertical axis is "Relative abundance" (relative abundance), and different colors represent different microbial groups (such as Actinobacillus, Alloprevotella, Lactobacillus etc.). The control group and the fermented feed group are presented by multiple stacked bar charts respectively. The height of each color layer in each column reflects the proportion of the abundance of the corresponding microbial group in the samples of this group. By comparison, it can be seen that there are differences in the microbial compositions of the two groups, and the abundance distributions of different groups are different in the two groups, intuitively presenting the impact of the fermented feed on the microbial community structure. The fermented feed can significantly promote the abundance of lactic acid bacteria (Lactobacillus) in the intestines of piglets. 216 piglets were divided into a control group and an experimental group. After 24 days of feeding: The daily weight gain of piglets in the experimental group increased by 3.58% (405 g / d vs. 391 g / d); The diarrhea rate decreased by 24.9% (6.18% vs. 8.23%); The abundance of intestinal lactic acid bacteria increased by 35%.
[0039] The present invention can be widely applied to feed enterprises and farms for preparing highly efficient fermented feed, replacing antibiotics and improving the health level of animals. After the farms cooperating with the right holder applied the present invention, the litter size of sows increased by 6%, the survival rate of piglets increased by 8%, and the feed cost decreased by 12%, verifying its economy and practicability.
[0040] So far, the technical solution of the present invention has been described in conjunction with the preferred embodiments shown in the drawings. However, it is easy for those skilled in the art to understand that the protection scope of the present invention is obviously not limited to these specific embodiments. Without departing from the principle of the present invention, those skilled in the art can make equivalent changes or substitutions to the relevant technical features, and the technical solutions after these changes or substitutions will all fall within the protection scope of the present invention.
Claims
1. A method for preparing fermented feed by targeting and regulating Lactobacillus reuteri in the pig intestine, characterized in that: The following steps are involved: a. Premixing of raw materials: Mix corn, soybean meal and rice wine grains in a mass ratio of 4:4:2 to 4.5:4.5:1; b. Add bacterial enzymes: Add Pediococcus acidilactici at 0.06% to 0.10% of the total mass of the fermentation raw materials. Pediococcus acidilactici Bacteria powder, add Bacillus licheniformis at 0.10% to 0.12% Bacillus licheniformis Bacterial powder, wherein the preservation number of the lactic acid Pediococcus is CGMCC NO: 1.12332, the preservation number of the Bacillus licheniformis is CGMCC NO: 1.9048, and a composite enzyme is added at a rate of 0.1-0.2%, wherein the composite enzyme comprises cellulase, hemicellulase and xylanase, and is mixed at a mass ratio of 1:1:1; c. Fermentation condition control: After mixing the bacterial powder with the raw materials, adjust the moisture to 35%-40% of the total mass, put it into a feed bag, and ferment it at a constant temperature of 30℃ for 3 days until the pH drops below 4.
5.
2. The method according to claim 1, characterized in that The raw materials described in step a are proportioned by mass as follows: corn: soybean meal: yellow wine grains = 4:4:
2.
3. The method according to claim 1, characterized in that In step b, the addition amount of the lactic acid Pediococcus powder is 0.08%, the addition amount of the Bacillus licheniformis powder is 0.11%, and the addition amount of the complex enzyme is 0.15%.
4. The method according to claim 1, characterized in that: The complex enzyme in step b may also include α-amylase, which is mixed with the cellulase, hemicellulase and xylanase in a mass ratio of 1:1:1:
1.
5. The method according to claim 1, characterized in that The fermentation is terminated when the pH of the fermented feed in step c drops to 4.5, and the number of live bacteria of Pediococcus acidilactici in the feed reaches 4.7×10 8 CFU / g, the number of viable Bacillus licheniformis reached 5.3×10 8 CFU / g.
6. A method for evaluating the effect of fermented feed on pig intestinal flora by in vitro anaerobic fermentation, characterized in that: The following steps are involved: i. Take the fermented feed prepared according to claim 1 and boil it and mix it with the pig feces sample; ii. inoculate into a sterile culture medium, wherein the culture medium contains 2 g / L peptone, 2 g / L yeast powder, 0.16 g / L Tween 80, 2 g / L NaHCO3, 0.1 g / L NaCl, 0.04 g / L K2HPO4, 0.01 g / L CaCl2, 0.01 g / L MgSO4, and 0.02 g / L heme; iii. culture under anaerobic conditions at 37°C with shaking at 155 rpm for 12 to 14 hours; iv. detect the abundance of lactic acid bacteria and the absolute content of Lactobacillus reuteri in the fermentation broth.
7. The method according to claim 6, characterized in that The mixing ratio of the fermented feed and feces in step i is 2.5 mL of fermented feed solution and 2.5 mL of feces suspension.
8. An application of the fermented feed according to any one of claims 1 to 5 in livestock and poultry production, characterized in that: The fermented feed according to claim 1 is used to replace corn and soybean meal at a mass of 10% of the total weight of the diet, and 1.0% to 2.0% of soybean oil is added.
Citation Information
Patent Citations
Fermented feed for suckling piglets
CN111820329A