Application of scutellarein in preparation of medicine for treating chronic depression

Abstract

The invention belongs to the technical field of medicines, and particularly relates to novel application of scutellarein in preparation of medicines for treating depression, the scutellarein can effectively relieve depression symptoms of mice and drosophila melanogaster induced by a chronic unpredictable stress method, reverse decline of monoamine neurotransmitters and gamma-aminobutyric acid receptors and relieve neuroinflammation. The evidences show that scutellarein can improve depression symptoms.

Description

Technical Field

[0001] The present invention relates to the use of scutellarein in the preparation of a medicament for treating chronic depression, and belongs to the field of pharmaceutical technology. Background Art

[0002] Depression is a mental disorder with core symptoms of persistent low mood, loss of interest, and cognitive function impairment. Existing antidepressant drugs have problems such as slow onset, drug resistance, and side effects (such as sexual dysfunction and weight gain). In patients with depression, in addition to changes in the behavior of depressed patients (such as slow movement and inability to concentrate), there are also characteristics such as an increase in inflammatory indicators, a decrease in the content of brain-derived neurotrophic factor, a decrease in the level of monoamine neurotransmitters, a decrease in the level of γ-aminobutyric acid receptors, and weight loss.

[0003] Scutellarein is mainly extracted from plants of the Compositae, Labiatae families (such as Erigeron breviscapus). As a natural product, its toxic and side effects are significantly lower than those of synthetic drugs. Animal experiments show that no obvious toxic reactions are observed after long-term administration, which is suitable for long-term medication needs. Scutellarein is the aglycone of scutellarin, and is known to have anti-inflammatory, antioxidant, neuroprotective and other effects, but its application in depression has not been reported previously. Compared with its glycoside form (such as scutellarin), it is more easily absorbed and utilized, improving the feasibility of clinical application. Summary of the Invention

[0004] The present invention provides a new use of scutellarein, that is, its use in the preparation of a medicament for treating chronic depression.

[0005] The component (or active ingredient) of the medicament for treating chronic depression in the present invention is scutellarein, and one or more pharmaceutically acceptable excipients can also be added, or it can be compounded with other active ingredients to exert a therapeutic effect; in addition to being made into tablets, the medicament can also be made into various pharmaceutically acceptable forms such as pills, powders, capsules, granules, oral liquids, and injections.

[0006] After treating PC12 cells with corticosterone, the present invention showed obvious cell damage, increased apoptosis, and an increasing trend in the levels of inflammatory factors, which is in line with the impact of depression on human physiological indicators, thus simulating neurodepressive-like damage. After treating corticosterone-induced PC12 cells with scutellarin, we found that scutellarin improved the viability of PC12 cells, reduced the proportion of apoptosis, and decreased the expression of cellular inflammatory factors. In vitro experiments showed that scutellarin could protect nerve cells and reduce neuroinflammation, thereby alleviating depressive symptoms. After adding scutellarin to the food of Drosophila and feeding the depressive Drosophila, we found through open-field experiments and climbing experiments that scutellarin reversed the behavioral symptoms of depressive Drosophila, restored the body weight of depressive Drosophila, increased the degree of nerve excitability of Drosophila, and found that the expression of 5-hydroxytryptamine and γ-aminobutyric acid receptors in the Drosophila brain increased. In the mouse depression model, we also found through open-field experiments that scutellarin reversed the behavioral symptoms of depressive mice. These animal experiments also showed that scutellarin has the function of improving depressive symptoms, and this improvement of depressive symptoms may be due to scutellarin increasing the expression of monoamine neurotransmitters and reducing neuroinflammation.

[0007] The present invention reveals the therapeutic potential of scutellarin against the pathological mechanisms (neuroinflammation, monoamine neurotransmitter imbalance) of depression and improves the clinical value of depressive symptoms: The present invention provides an alternative treatment plan with small side effects and high compliance, which is especially suitable for patients who need long-term medication. Description of the Drawings

[0008] Figure 1 It is for detecting the protective effect of scutellarin on corticosterone (CORT)-induced PC12 cell damage by CCK8 method; Figure 2 It is the result of detecting the apoptosis of PC12 cells in each group by flow cytometry; Figure 3 It is the result of detecting the apoptosis of PC12 cells in each group by flow cytometry; Figure 4 It is the result of detecting the apoptosis of PC12 cells in each group by flow cytometry; Figure 5 It is the statistical result of detecting the apoptosis of PC12 cells in each group by flow cytometry; Figure 6 It is the result of detecting the mRNA expression of inflammatory factors (TNF-α, 1L-6, iNOS) in PC12 cells in each group by Q-PCR method; Figure 7 It is the mRNA level result of 5-hydroxytryptamine (left figure) and γ-aminobutyric acid receptor (right figure) in each group of Drosophila brains; Figure 8 It is the trajectory diagram of the Drosophila open-field experiment; Figure 9 It is the trajectory heat map of the Drosophila open field experiment; Figure 10 It is the schematic diagram of the statistical results of the Drosophila open field experiment. In Figure A, it is the total movement distance of Drosophila; in Figure B, it is the average movement speed of Drosophila; in Figure C, it is the maximum movement speed of Drosophila. Figure 11 It is the results of the Drosophila climbing experiment (Figure A), sleep experiment (Figure B), and body weight change (Figure C); Figure 12 It is the trajectory map (right figure) and trajectory heat map (left figure) of the mouse open field experiment; Figure 13 It is the schematic diagram of the statistical results of the mouse open field experiment. In Figure A, it is the total movement distance of the mouse; in Figure B, it is the average movement speed of the mouse; in Figure C, it is the maximum movement speed of the mouse. Detailed implementation manners

[0009] The present invention will be further described below in conjunction with embodiments. However, the scope of the present invention is not limited to the following examples. Those skilled in the art can understand that various changes and modifications can be made to the present invention without departing from the spirit and scope of the present invention. The instruments, reagents, and materials involved in the following embodiments, unless otherwise specified, are all conventional instruments, reagents, and materials existing in the prior art and can be obtained through regular commercial channels. The experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, are all conventional experimental methods and detection methods existing in the prior art.

[0010] Example 1: Protective effect of scutellarin on PC12 cells induced by corticosterone (CORT) First, prepare RPMI 1640 medium supplemented with 7.5% fetal bovine serum, 2.5% horse serum, 100 U / mL penicillin, and 10 μg / mL streptomycin. Then, adjust the density of PC12 cells to 5×10 4 cells / mL with RPMI 1640 medium. Next, inoculate the PC12 cell suspension with adjusted cell density into a 96-well plate at a volume of 100 μL per well, and culture it in a humidified atmosphere at 37 °C and 5% CO2 for 24 h to allow the PC12 cells to adhere. Then, discard the old medium, and incubate the PC12 cells with RPMI 1640 medium (100 μL per well) supplemented with 50 ng / mL nerve growth factor, 7.5% fetal bovine serum, 100 U / mL penicillin, and 100 μg / mL streptomycin for 24 hours to induce neurite formation and simulate neuron cells.

[0011] The induced PC12 cells in the 96-well plate were incubated with RPMI 1640 medium (100 μL per well) containing 400 μM CORT and scutellarin (0, 1, 2, 4, 8, 12, 14 μM) for 48 hours as the experimental group; the blank control group was only added with RPMI 1640 medium; the control group was only incubated with RPMI 1640 medium and PC12 cells for 48 hours; then 10 μL of CCK8 reagent was added to each well, gently mixed, and incubated in the dark at 37 °C for 4 hours, and then the absorbance (OD) was measured at 450 nm using a microplate reader. The calculation method of cell viability is as follows: ; The results are shown in Figure 1 , as can be seen from the figure, compared with the control group, the survival rate of PC12 cells exposed to 400 μM CORT for 48 hours was significantly reduced, and the treatment with 1-8 μM scutellarin for 48 hours significantly increased the cell survival rate. The results showed that 1-8 μM scutellarin alleviated the decrease in the survival rate of PC12 cells caused by CORT treatment.

[0012] Example 2: Recovery effect of scutellarin on apoptosis of PC12 cells induced by corticosterone (CORT) The differentiated PC12 cells were seeded on a 96-well culture plate and incubated with 400 μM CORT and scutellarin (0, 1, 2, 4, 8, 12, 14 μM) for 48 hours respectively. Then the cells were collected by centrifugation, washed twice with pre-cooled phosphate buffer (PBS) to remove the serum in the medium, and the cells were resuspended with phosphate buffer. The cell density was 1×10 6 cells / mL. In the 96-well plate, 100 μL of cell suspension was added to each well, then 5 μL of Annexin V-FITC was added, gently mixed, incubated in the dark at room temperature for 15 min, and then 5 μL of PI (final concentration 1-2 μg / mL) was added, incubated in the dark for 5 min, and then the apoptosis rate of the samples was detected using a flow cytometer; The results are as Figures 2 - 5 shown. Corticosterone increased the apoptosis rate of cells up to 50%, while 1-8 μM scutellarin significantly decreased the apoptosis rate of PC12-simulated nerve cells in a dose-dependent manner, and the apoptosis rate of PC12-simulated nerve cells was reduced to less than 20% with scutellarin doses of 2 μM and above.

[0013] Example 3: Regulatory effect of scutellarin on the expression of inflammatory factors in PC12 cells induced by corticosterone (CORT) Differentiated PC12 cells were seeded onto 96-well culture plates and incubated with CORT at a concentration of 400 μM and scutellarin (0, 1, 2, 4, 8, 12, 14 μM) for 48 hours. After that, the cells were collected, washed with pre-chilled PBS, and then total RNA was extracted using TRIzol lysis buffer. The concentration and purity of the RNA were measured. Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit. Then, using the cDNA as a template, the following primers were used for amplification to calculate the relative expression levels of TNF-α, IL-6, and iNOS (2^(-ΔΔCt) method), with β-actin as an internal reference.

[0014] TNF-α-F: CACCATGAGCACGGAAAGCA, TNF-α-R: GCAATGACTCCAAAGTAGACC; IL-6-F: GAGAAAAGAGTTGTGCAATGGCA, IL-6-R: AGTGCATCATCGCTGTTCATACA; iNOS-F: CACCTACTTCCTGGACATCACTAC, iNOS -R: GTACTCTGAGGGCTGACACAAG; β-actin-F: CATGTGCAAGGCCGGCTTCG, β-actin-R: GTAGCAGGAGAAGTTGTTGG.

[0015] The reaction system for real-time PCR was as follows: SYBR Green Master Mix (2×) 10 μL, each primer (10 μmol / L) 0.4 μL, template cDNA 1 μL, and ddH2O was added to make up the total volume to 20 μL; the reaction conditions were: 94°C for 15 s; denaturation at 94°C for 15 s, annealing at 60°C for 5 s, extension at 72°C for 10 s, for 40 cycles; after the reaction, the amplification curve was adjusted to a linear distribution, and the Ct values of each sample were read for relative quantification.

[0016] The results were as Figure 6 shown. The RNA of TNF-α, IL-6, and iNOS increased significantly after induction by corticosterone, while scutellarin reversed this process, significantly reducing the expression of inflammatory factors, demonstrating that scutellarin has the ability to reduce neuroinflammation in in vitro experiments.

[0017] Example 4: Therapeutic effect of scutellarin on a Drosophila depression model induced by unforeseen stress stimuli Adult male Drosophila melanogaster were selected as experimental subjects, and the flies were randomly stimulated with the following combinations of 2 stressors every day for 7 days to construct a Drosophila depression model; Temperature change: Expose Drosophila to low temperature (e.g., 10 °C) or high temperature (e.g., 30 °C) environments for 1 - 2 hours each time; Light cycle inversion: Disrupt the normal 12-hour light / dark cycle, such as continuous light or darkness for 24 hours; Mechanical vibration: Place the Drosophila culture tubes in a shaker and vibrate at medium speed (e.g., 200 rpm) for 15 - 30 minutes; Water restriction: Temporarily remove the moist filter paper or water source in the culture tubes for 12 hours; The experimental groups were wild blank group (not induced by unforeseen stress stimuli and fed with conventional Drosophila medium), model group (induced by unforeseen stress stimuli and fed with conventional Drosophila medium), positive drug group (induced by unforeseen stress stimuli and fed with Drosophila medium containing 10 μM fluoxetine), and experimental group (induced by unforeseen stress stimuli and fed with Drosophila medium containing 20 - 40 μM scutellarin); After one week of feeding, open field experiments, climbing experiments, and sleep monitoring experiments were conducted to perform behavioral tests on Drosophila and measure the weight changes of Drosophila. After the tests were completed, the heads of Drosophila were cut off, and then the head tissues were homogenized, then lysis buffer was added, and then total RNA was extracted using the RNeasy Mini Kit. The RNA concentration and purity were measured, and finally, the RNA was reverse transcribed into cDNA using a reverse transcription kit; Then, using the cDNA as a template, the following primers were used for amplification to calculate the relative expression levels of 5-HT1A (serotonin receptor) and GABA B R3 (γ-aminobutyric acid receptor) (2^(-ΔΔCt) method), with rp49 as an internal reference; 5-HT1A-F: AGTCGGAGGACCAATGCAAG, 5-HT1A-R: GTGGCATTTGACGTACTGGC; GABA B R3-F: TCCGAATTTCCTGCCTAT, GABA B R3-R: CTCCAGCAGTTTCACATACTTT; rp49-F: ACTTCATCCGCCACCAGTC, rp49-R: ATCT CGCCGCAGTAAACG; The real-time PCR reaction system was 10 μL of SYBR Green Master Mix (2×), 0.4 μL of each primer (10 μmol / L), 1 μL of template cDNA, and ddH2O was added to make up the total volume to 20 μL; The reaction conditions were 95 °C for 30 s; Denaturation at 95 °C for 20 s, annealing at 58 °C for 10 s, extension at 72 °C for 15 s, for 40 cycles; After the reaction was completed, the amplification curve was adjusted to a linear distribution, and the Ct values of each sample were read for relative quantification.

[0018] The results were as Figure 7As shown, compared with the wild blank group, unpredictable stress stimulation reduced the mRNA levels of serotonin and gamma-aminobutyric acid receptors in the model group (control) Drosophila, demonstrating the successful establishment of a Drosophila depression model.

[0019] After treatment with fluoxetine, the mRNA levels of serotonin and gamma-aminobutyric acid receptors increased. After administration of scutellarin, a dose-dependent increase in the mRNA levels of serotonin and gamma-aminobutyric acid receptors was observed. This demonstrated that scutellarin could reverse the decrease in serotonin and gamma-aminobutyric acid receptors caused by depression.

[0020] The results of the open field test were as Figures 8 - 10 shown. After modeling, the average movement speed, maximum speed, and total movement distance of Drosophila decreased. Moreover, from the trajectory diagram and heat map, it could be observed that the frequency of Drosophila entering the center of the open field decreased, and they only moved at the edge of the open field for most of the time. However, treatment with scutellarin reversed these symptoms. And in the climbing test, the positive drug group and scutellarin restored the climbing ability of depressed Drosophila. Even the effect of 40 μM scutellarin was slightly better than that of the positive drug fluoxetine ( Figure 11 A). In the Drosophila sleep test, the positive drug group and the scutellarin group reduced the immobile time of Drosophila, indicating that scutellarin increased the excitability of the nervous system in the depressed Drosophila model ( Figure 11 B). In addition, after treatment with scutellarin, the body weight of the depressed Drosophila model recovered ( Figure 11 C). These changes in indicators indicated that scutellarin improved the behavioral characteristics of depressed Drosophila and increased the mRNA levels of serotonin and gamma-aminobutyric acid receptors in the Drosophila brain.

[0021] Example 5: Therapeutic effect of scutellarin on a mouse depression model induced by chronic unpredictable mild stress Male C57BL / 6J mice, weighing 20 - 22 g, were housed in the Experimental Animal Center of Kunming University of Science and Technology, with free access to food and water, at a room temperature of 22 ± 1°C, a relative humidity of 55 - 65%, and a 12 h light cycle. All other reagents were domestic and met the experimental requirements.

[0022] The mice were randomly divided into 3 groups, with 6 mice in each group. The wild group received no treatment; The model group was subjected to 1 - 2 types of unpredictable stimuli daily for 4 consecutive weeks, including fasting / water deprivation for 24 hours, wet bedding, cage tilting (45°), circadian rhythm reversal, ice water swimming (4°C, 5 minutes), noise (>80 dB), tail clamping (10 minutes), and foot shock (0.8 mA, 5 seconds / time) to establish a chronic unpredictable mild stress (CUMS) depressed mouse model, and then the depressed mouse model was intragastrically administered PBS daily; In the scutellarin group, the scutellarin was intragastrically administered to the depression mouse model at a dose of 20 mg / kg (dissolved in PBS) every day; After 1 week of intragastric administration, the depressive symptoms of mice in each group were evaluated by the open field test; The results were as Figure 12 , 13 shown. The data of the open field test indicated that after chronic unpredictable mild stress, the average speed, maximum speed, and average moving distance of the mice decreased significantly. Moreover, it could be observed from the trajectory map and heat map that the residence time of the mice in the central area was significantly shortened during the open field test. This avoidance behavior of the central area was related to the enhanced thigmotaxis in rodents, reflecting the decreased willingness to explore the novel environment under anxiety and depressive states, which indicated that the mice showed depressive symptoms. The intragastric administration of 20 mg / kg scutellarin for one week reversed the depressive symptoms of the mice.

Claims

1. A use of baicalin in the preparation of a drug for treating chronic depression.

Images