Nucleic acid compound preparation for hair growth and development
By using siRNA to target the inhibition of SRD5A2 and JAK3 gene expression and combined with the auxiliary effects of traditional Chinese medicine extracts, a nucleic acid compound preparation for genital and developmental development has been developed, which solves the problems of the side effects and inconvenient use of existing hair loss treatment methods, and achieves efficient and safe hair growth effects.
Patent Information
- Application Number
- CN202311813539.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-27
- Publication Date
- 2025-06-27
AI Technical Summary
The existing treatments for hair loss have problems such as major side effects, inconvenience in use and unstable effects, especially chemical drugs and oral preparations that can bring systemic adverse reactions.
A nucleic acid compound preparation for genital development and development is used, which includes siRNA and Chinese medicine extracts. SiRNA targets the inhibition of SRD5A2 and JAK3 gene expression, and Chinese medicine extracts such as ginseng and angelica are used to assist in promoting hair growth.
This preparation has high targeting, safety and long-lasting effects, significantly promotes hair growth, reduces hair loss, and has no systemic side effects, making it easy to use.
Smart Images

Figure CN120204288A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine, and particularly to a nucleic acid compound preparation for hair growth and hair loss treatment. Background Art
[0002] RNA interference (RNAi) is a phenomenon of gene expression silencing induced by double-stranded RNA. Its mechanism is to inhibit gene expression by hindering the transcription or translation of specific genes. When double-stranded RNA homologous to the coding region of endogenous mRNA is introduced into cells, the mRNA is degraded, resulting in the silencing of the corresponding gene expression. Artificially synthesized siRNA (Small interfering RNA) sequences are generally 19-23 nt in length, can be chemically synthesized, and have the characteristics of high efficiency, easy synthesis, and easy operation. Therefore, this technology has been widely used in the fields of exploring gene functions and gene therapy for infectious diseases and malignant tumors.
[0003] The hair growth cycle has three stages: "anagen, catagen, and telogen". Normal people shed about 50-100 hairs per day, which is basically equal to the number of newly grown hairs per day, and is in a dynamic balance metabolic state. Pathological hair loss breaks this balance, with more than 100 hairs shed per day, and the number of newly grown hairs is much less than the number of shed hairs, requiring medical intervention.
[0004] Most pathological hair loss is caused by genetic factors. The scalp hair follicles are more sensitive to androgens. Under the influence of the androgen dihydrotestosterone, the hair follicles become smaller, and the hair also becomes smaller and thinner accordingly, and finally completely necrotic, resulting in androgenetic alopecia. Androgens play an important role in the pathogenesis. In individuals with genetic susceptibility, the disease will occur even if the androgen concentration in the blood is normal. Testosterone is metabolized into dihydrotestosterone under the action of 5-α reductase (5-Alpha Reductase, SRD5A2). This metabolite has a higher affinity for androgen receptors and is considered an important cause of androgen-mediated effects in the patient's scalp.
[0005] In addition, another target related to hair growth is JAK. JAK is a type of protein kinase and an important part of the signal transduction pathway mediated by cell membrane receptors. JAK / STAT is a signal transduction mechanism that plays an important role in physiological processes such as cell growth, differentiation, apoptosis, immunity, and inflammation. Currently, four types of JAK proteins are known: JAK1, JAK2, JAK3, and TYK2. They all contain a typical tyrosine kinase domain and play different roles in different physiological processes. Currently, JAK inhibitors are widely used in the treatment of certain malignancies and autoimmune diseases. In the field of hair loss treatment, JAK inhibitors are also used for the treatment of alopecia areata. Some research results also show that JAK3 is more effective in enhancing hair follicle growth compared to JAK1 and JAK2 inhibitors.
[0006] The hair growth agents currently on the market are mainly divided into the following categories:
[0007] 1. Chemical drugs: Such as minoxidil, amifloxacin, etc. These drugs are usually topical liquids or foams. They act on the scalp to promote hair growth and prevent hair loss. Although such drugs can improve the nutrient supply to hair follicles to a certain extent, they need to be used for a long time and may cause side effects such as headache, chest tightness, and other adverse reactions. Moreover, they mostly contain ethanol penetration enhancers, which can cause scalp dryness, dandruff, itching, and reversely damage the scalp. In addition, there are oral preparations for androgenetic alopecia and alopecia areata, and due to their systemic distribution, they all have certain adverse reactions.
[0008] 2. Natural ingredient products: Including plant extracts and animal extracts, such as ginger, green tea, pilose antler, etc. Such hair growth agents are generally considered to be a relatively safe choice and have no obvious side effects. However, due to factors such as complex ingredients, uncertain content, and unstable effects, their effects are also difficult to guarantee.
[0009] 3. Specially designed scalp massage instruments: Based on different principles such as sound waves, electromagnetic waves, and low temperature, these devices can stimulate scalp blood circulation and increase the nutrient supply to hair follicles. At the same time, their prices are relatively high, the usage time and frequency are limited, and professional operation is required.
[0010] Therefore, there is a need for a product for preventing and treating hair loss with few side effects and good patient compliance. Summary of the Invention
[0011] In view of this, the object of the present invention is to provide a nucleic acid compound preparation for hair growth and hair development, which has the advantages of high targeting, high safety, long-lasting effect, and convenient use.
[0012] For the above purposes, a first aspect of the present invention provides a nucleic acid compound preparation for hair growth and hair restoration, which includes siRNA and a traditional Chinese medicine extract. The siRNA includes siSRD5A2 that inhibits the expression of the SRD5A2 gene and / or siJAK3 that inhibits the expression of the JAK3 gene.
[0013] In a preferred embodiment of the present invention, the traditional Chinese medicine extract includes one or more of ginseng extract, angelica extract, polygonum multiflorum extract, sophora flavescens extract, and platycladus orientalis leaf extract.
[0014] In a preferred embodiment of the present invention, siSRD5A2 is composed of a sense strand and an antisense strand. The sense strand is complementary to the antisense strand, and the antisense strand is reverse complementary to a segment on the SRD5A2 gene. The sense strand is 5’-CAAGGUGGCUUGUUUACGUAUGUdTdT-3’ (SEQ ID NO:1), and the antisense strand is 5‘-AAACAUACGUAAACAAGCCACCUUGUG-3’ (SEQ ID NO:2).
[0015] In a preferred embodiment of the present invention, siJAK3 is composed of a sense strand and an antisense strand. The sense strand is complementary to the antisense strand, and the antisense strand is reverse complementary to a segment on the JAK3 gene. The sense strand and the antisense strand are selected from the following sequences:
[0016] (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO:3, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:4:
[0017] 5’-ACUUUCAGCGGGAGAUUCAGA-3’ (SEQ ID NO:3),
[0018] 5’-UCUGAAUCUCCCGCUGAAAGU-3’ (SEQ ID NO:4);
[0019] (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:6:
[0020] 5’-AUCCCUCUCGGACAACAUCUU-3’ (SEQ ID NO:5),
[0021] 5’-AAGAUGUUGUCCGAGAGGGAU-3’ (SEQ ID NO:6).
[0022] In a preferred embodiment of the present invention, at least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group having a modifying group; preferably, the phosphate group having a modifying group is a phosphorothioate group formed by substituting at least one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.
[0023] In a preferred embodiment of the present invention, the modified nucleotides are selected from 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides, 2'-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more thereof. The modified nucleotides are selected from 2'-F-modified nucleotides, 2'-O-CH3-modified nucleotides, 2'-O-CH2-CH2-O-CH3-modified nucleotides, 2'-O-CH2-CH=CH2-modified nucleotides, 2'-CH2-CH2-CH=CH2-modified nucleotides, 2'-deoxynucleotides, nucleotide analogs, or any combination of two or more thereof; the nucleotide analogs are selected from one of isonucleotides, LNA, ENA, cET BNA, UNA, and GNA.
[0024] In a preferred embodiment of the present invention, the modified sense strand of siSRD5A2 is 5'-CsAsAGGUGGCUUGUUUmAmCmGmUmAmUmGmUdTdT-3' (SEQ ID NO:7), and the antisense strand is 5'-mAsmAsmAmCmAmUmAmCGUAAACAAGCCACCUUGUG-3' (SEQ ID NO:8); The modified sequence of siJAK3 is as follows:
[0025] (1) The sense strand is 5'-AsCsUUUCAGCGGGAGAmUmUmCmAmGmA-3' (SEQ ID NO:9), and the antisense strand is 5'-mUsmCsmUmGmAmAmUmCUCCCGCUGAAAGU-3 (SEQ ID NO:10);
[0026] (2) The sense strand is 5'-AsUsCCCUCUCGGACmAmAmCmAmUmCmUmU-3' (SEQ ID NO:11), and the antisense strand is '-mAsmAsmGmAmUmGmUmUGUCCGAGAGGGAU-3' (SEQ ID NO:12).
[0027] In a preferred embodiment of the present invention, the preparation is a gel containing siSRD5A2 and / or siJAK3, a delivery substance cationic polymer, and a gel matrix;
[0028] The cationic polymer is a composition of one or more of polyethyleneimine (PEI), polyamidoamine (PMAMA), poly(b-amino ester) (PBAE), poly(dimethylaminoethyl methacrylate) (PDMAEMA), polyamino acids (PAAs), and chitosan;
[0029] The gel matrix consists of Aculyn 22, glycerol, propylene glycol, 1,3-propanediol, and Tween 20.
[0030] In a preferred embodiment of the present invention, the proportion of Aculyn 22 is 0.6 - 4%, the proportion of glycerol is 0.7% - 2.8%, the proportion of propylene glycol is 0.1% - 1%, the proportion of 1,3-propanediol is 3% - 15%, and the proportion of Tween 20 is 0.5% - 5%.
[0031] In a preferred embodiment of the present invention, the N / P of siSRD5A2 and / or siJAK3 to the cationic polymer is 1:1 - 40:1, and the proportion of siSRD5A2 and / or siJAK3 in the gel is 0.05 - 0.5%.
[0032] In a preferred embodiment of the present invention, the total proportion of the traditional Chinese medicine extract in the gel is 0.5%.
[0033] In a preferred embodiment of the present invention, the gel uses water as a solvent.
[0034] The beneficial effects of the present invention are as follows:
[0035] 1. Compared with traditional drugs, the present invention has higher targeting, only acts on specific cells or proteins, and does not affect other normal tissues.
[0036] 2. High efficiency: Experimental results show that the use of small nucleic acid drugs can significantly promote hair growth, and the effect is long-lasting. This is because small nucleic acid drugs play an important role in promoting hair growth on the main targets SRD5A2 and JAK3.
[0037] 3. Safety: The small nucleic acid drugs administered locally only exist in the scalp and hair follicle tissues and do not enter the blood circulation, so they do not affect other parts of the body. At the same time, such drugs also do not have the side effects that chemical drugs may bring.
[0038] 4. Convenience: The small nucleic acid gel can be applied to the scalp topically, which is simple and easy to perform and does not require too much time and effort, facilitating daily use by people.
[0039] 5. Efficacy: In the form of a composite gel, it promotes hair growth while nourishing the hair and promoting hair growth. Description of the Drawings
[0040] Figure 1 It is the effect diagram of siSRD5A2-1 and siSRD5A2-m1 reducing the expression of SRD5A2 mRNA in 293T cells.
[0041] Figure 2 It is the effect diagram of siSRD5A2-1 and siSRD5A2-m1 reducing the expression of SRD5A2 mRNA in RT4 cells.
[0042] Figure 3 It is the effect diagram of siJAK3-1, siJAK3-2, siJAK3-m1 and siJAK3-m2 inhibiting the expression of JAK3 mRNA in HepG2 cells.
[0043] Figure 4 It is the effect diagram of siJAK3-1, siJAK3-2, siJAK3-m1 and siJAK3-m2 inhibiting the expression of JAK3 mRNA in Jurkat cells.
[0044] Figure 5 It is the effect diagram of siJAK3-1 inhibiting the expression of IL2 inflammatory factor mRNA in Jurkat cells.
[0045] Figure 6 It is the effect diagram of siJAK3-1 inhibiting the expression of IL15 inflammatory factor mRNA in Jurkat cells.
[0046] Figure 7 It is the effect diagram of siJAK3-1 inhibiting the expression of IL1b inflammatory factor mRNA in Jurkat cells.
[0047] Figure 8 It is the effect diagram of siJAK3-1 inhibiting the expression of IL6 inflammatory factor mRNA in Jurkat cells.
[0048] Figure 9 It is the effect diagram of different N / P siJAK3-1 polymer nanoparticles inhibiting the expression of mRNA in Jurkat cells.
[0049] Figure 10 It is the skin tissue penetration diagram of FAM-labeled siRNA gel agent 30 minutes after topical administration to mouse skin.
[0050] Figure 11 This is the skin condition diagram of New Zealand rabbits 72 hours after the administration of siRNA gel II.
[0051] Figure 12 This is the effect diagram of siRNA gel I inhibiting the expression of SRD5A2 and JAK3 mRNA in mouse skin.
[0052] Figure 13 This is the hair growth diagram of male pattern baldness model mice after topical administration of siRNA gel I and gel II.
[0053] Figure 14 This is the skin tissue pathology diagram of the depilated area on the back of mice in each group (HE×100, scale = 50μm) (A: blank group; B: model group; C: gel I; D: gel II).
[0054] Figure 15 This is the immunohistochemical staining diagram of IL-15 in the skin of mice in each group (×40, scale = 50μm) (A: blank group; B: model group; C: gel I; D: gel II). Detailed implementation manners
[0055] It should be noted that, unless otherwise defined, the technical terms or scientific terms used in this application should have the ordinary meanings understood by those skilled in the art.
[0056] Unless otherwise specified, the experimental methods in the following examples are all conventional methods. Unless otherwise specified, the medicinal raw materials, reagent materials, etc. used in the following examples are all commercially available products.
[0057] When used in this specification and the appended claims, the singular forms "a", "an", "another" and "the" include plural referents unless the context clearly indicates otherwise.
[0058] Definition
[0059] Throughout the specification, unless otherwise specified, the capital letters A, U, C, G represent the base composition of nucleotides.
[0060] As used above and below, the term "2-fluorinated modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose moiety of the nucleotide is replaced by fluorine. The "non-fluorinated modified nucleotide" refers to a nucleotide or nucleotide analogue in which the hydroxyl group at the 2'-position of the ribose moiety of the nucleotide is replaced by a non-fluorine group. In some embodiments, each non-fluorinated modified nucleotide is independently selected from a nucleotide or nucleotide analogue in which the hydroxyl group at the 2'-position of the ribose moiety of the nucleotide is replaced by a non-fluorine group. These nucleotides in which the hydroxyl group at the 2'-position of the ribose moiety is replaced by a non-fluorine group are well known to those skilled in the art, and these nucleotides may be selected from one of 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-amino modified nucleotides, 2'-substituted amino modified nucleotides, and 2'-deoxynucleotides.
[0061] "Alkyl" includes straight-chain, branched-chain or cyclic saturated alkyl groups. For example, alkyl groups include, but are not limited to, methyl, ethyl, propyl, cyclopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, cyclobutyl, n-pentyl, cyclohexyl and similar groups. Exemplarily, "C1-6 alkyl" in which "C1-6" refers to a group arranged in a straight-chain, branched-chain or cyclic form containing 1, 2, 3, 4, 5 or 6 carbon atoms.
[0062] "Alkoxy" as used herein refers to an alkyl group linked to the rest of the molecule through an oxygen atom (-O-alkyl), wherein the alkyl group is as defined herein. Non-limiting examples of alkoxy groups include methoxy, ethoxy, trifluoromethoxy, difluoromethoxy, n-propoxy, isopropoxy, n-butoxy, tert-butoxy, n-pentyloxy and the like.
[0063] "Nucleotide analogue" refers to a group that can replace a nucleotide in a nucleic acid but has a structure different from adenosine ribonucleotide, guanosine ribonucleotide, cytidine ribonucleotide, uridine ribonucleotide or thymidine deoxyribonucleotide. Such as isonucleotide, bridged nucleic acid (abbreviated as BNA) or acyclic nucleotide.
[0064] BNA refers to a constrained or inaccessible nucleotide. BNA may contain a bridged structure with a "fixed" C3'-endo sugar puckering in a five-membered ring, six-membered ring, or seven-membered ring. Usually, this bridge is incorporated into the 2'- and 4'-positions of the ribose to provide a 2',4'-BNA nucleotide, such as LNA, ENA, cET BNA, etc., wherein LNA is shown in formula (1), ENA is shown in formula (2), and cET BNA is shown in formula (3).
[0065]
[0066] Acyclic nucleotides are a class of nucleotides formed by opening the sugar ring of nucleotides, such as unlocked nucleic acid (UNA) or glycerol nucleic acid (GNA), where UNA is shown in formula (3) and GNA is shown in formula (4).
[0067]
[0068] In the above formulas (3) and (4), R is selected from H, OH or alkoxy (O-alkyl).
[0069] An isonucleotide refers to a compound formed by changing the position of the base on the ribose ring in a nucleotide. For example, a compound formed by moving the base from the 1'-position to the 2'-position or 3'-position of the ribose ring, as shown in formula (5) or (6).
[0070]
[0071] In the compounds of the above formulas (5)-(6), Base represents a base, such as A, U, G, C or T; R is selected from H, OH, F or the non-fluorine group as described above.
[0072] In some embodiments, the nucleotide analog is selected from one of isonucleotides, LNA, ENA, cET BNA, UNA and GNA.
[0073] The technical solution provided by the present invention will be further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and will not limit the protection scope of the present invention.
[0074] Embodiments of the present invention are directed to the siSRD5A2 and JAK3 genes. After screening and design, the following siRNA sequences are artificially synthesized:
[0075] Sequence Sense strand (5'-3') SEQ ID NO: Antisense strand (5'-3') SEQ ID NO: siSRD5A2-1 CAAGGUGGCUUGUUUACGUAUGUdTdT 1 AAACAUACGUAAACAAGCCACCUUGUG 2 siJAK3-1 ACUUUCAGCGGGAGAUUCAGA 3 UCUGAAUCUCCCGCUGAAAGU 4 siJAK3-2 AUCCCUCUCGGACAACAUCUU 5 AAGAUGUUGUCCGAGAGGGAU 6 siSRD5A2-m1 CsAsAGGUGGCUUGUUUmAmCmGmUmAmUmGmUdTdT 7 mAsmAsmAmCmAmUmAmCGUAAACAAGCCACCUUGU 8 siJAK3-m1 AsCsUUUCAGCGGGAGAmUmUmCmAmGmA 9 mUsmCsmUmGmAmAmUmCUCCCGCUGAAAGU 10 siJAK3-m2 AsUsCCCUCUCGGACmAmAmCmAmUmCmUmU 11 mAsmAsmGmAmUmGmUmUGUCCGAGAGGGAU 12
[0076] Example 1: Inhibition of SRD5A2 mRNA in 293T cells by siSRD5A2-1 and siSRD5A2-m1
[0077] 1) Trypsinize 293T cells in the logarithmic growth phase, add DMEM medium containing 10% FBS to terminate digestion, then centrifuge to collect the cells, add MEM medium containing 10% FBS, count the cells with a hemocytometer, and then add 0.6×10 5 cells to each well of a 24-well plate for culture.
[0078] 2) After culturing for 24 h, transfect the dual-luciferase reporter plasmid DNA (pSV40-hRluc-5UTR-SRD5A2 (human)-3UTR-Fluc). Preparation of the mixture of Lipofectamine 3000 (invitrogen) and plasmid DNA: Gently vortex 0.05 mg of plasmid DNA and 0.1 ml of Lipofectamine 3000 in 50 ml of serum-free culture medium (Opti-MEM, purchased from gibco) (per well), and let it stand at room temperature for 15 minutes.
[0079] 3) Add the plasmid DNA and Lipofectamine 3000 incubation solution (50 ml / well) to a 24-well plate.
[0080] 4) After the plasmid DNA has been transfected for 24 h, change the medium and transfect the siSRD5A2 sequence. Preparation of the mixture of Lipofectamine 3000 and siSRD5A2: Dilute the siRNA and 3 ml of Lipofectamine 3000 separately in 50 ml of serum-free culture medium (Opti-MEM, Gibco), then mix the above siSRD5A2 solution and Lipofectamine 3000 solution, and let it stand at room temperature for 15 minutes.
[0081] 5) Add 100 ml of the siSRD5A2 and Lipofectamine 3000 mixed solution (final concentration of siSRD5A2 is 10 nM) corresponding to each group to each well.
[0082] 6) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add 100 ml of reporter gene lysis buffer to lyse the cells. After sufficient lysis, centrifuge at 10,000 - 15,000 g for 3 - 5 minutes, and take the supernatant for determination.
[0083] 7) Take 50 ml of the supernatant, add 100 ml of firefly luciferase detection reagent, mix well with a pipette or other appropriate methods, and then measure the RLU (relative light unit). After completing the firefly luciferase measurement, add 100 ml of Renilla luciferase detection working solution, mix well with a pipette or other appropriate methods, and then measure the RLU. Using Renilla luciferase as an internal reference, calculate the relative value of firefly luciferase RLU to Renilla luciferase RLU, which is the ratio of the relative expression level of SRD5A2 mRNA.
[0084] As Figure 1As shown, the results indicated that after transfection with Lipofectamin 3000, siSRD5A2-1 inhibited 76.5% of SRD5A2 mRNA in 293T cells, and siSRD5A2-m1 inhibited 88.5% of SRD5A2 mRNA.
[0085] Example 2: Inhibition of SRD5A2 mRNA in RT4 cells by siSRD5A2-1 and siSRD5A2-m1
[0086] 1) Trypsinize RT4 cells in the logarithmic growth phase. After adding MEM medium containing 10% FBS to terminate digestion, centrifuge to collect the cells. Add MEM medium containing 10% FBS, count the cells using a hemocytometer, and then add 0.25×10 5 cells to each well of a 24-well plate for culture.
[0087] 2) After culturing for 24 h, add the siSRD5A2 transfection solution. Preparation of the Lipofectamine 3000 and siSRD5A2 mixture: Dilute siRNA and 3 ml of Lipofectamine 3000 separately in 50 ml of serum-free culture medium (Opti-MEM, Gibco), then mix the above siSRD5A2 solution and Lipofectamine 3000 solution, and let it stand at room temperature for 15 minutes.
[0088] 3) Add 100 μl of the siSRD5A2 and Lipofectamine 3000 mixed solution (final concentration of siSRD5A2 is 10 nM) corresponding to each group to each well.
[0089] 4) After culturing for 48 hours, discard the culture medium, wash the cells twice with enzyme-free PBS, then add lysis buffer (BioFlux) to lyse the cells, add chloroform (MREDA) for extraction, shake well and let it stand at room temperature for 2 - 3 minutes, centrifuge, transfer the supernatant after stratification to a well plate to bind with the binding solution, use a nucleic acid extractor, and place the well plate in order according to the kit instructions (MagaBio plus Total RNA Purification Kit II), and then use the BSC69 program to extract RNA.
[0090] 5) Prepare the qPCR system on ice. Add 1 μl of One Step SYBR Green Mix (Novizan), 10 μl of 2x One Step SYBR Green Mix (Novizan), and 0.4 μl of each primer to each well. Dilute 200 ng of RNA in 8.2 μl of Rnase ddH2O (Novizan) and add it to the well, mix well and put it into a qPCR instrument for reaction.
[0091] PCR reaction conditions: pre-denaturation at 50°C for 15 minutes, 95°C for 1 minute, annealing at 95°C for 15 seconds, extension at 60°C for 1 minute, for 39 cycles.
[0092] The PCR primers are as follows (5'-3'):
[0093] Forword: ACTGCTCAATCGAGGGAGG (SEQ ID NO:13)
[0094] Reverse: CACCCAAGCTAAACCGTATGTC (SEQ ID NO:14)
[0095] As Figure 2 shown, the results indicated that after transfection with Lipofectamin 3000, siSRD5A2-1 inhibited 61.3% of SRD5A2 mRNA in RT4 cells, and siSRD5A2-m1 inhibited 67.0% of SRD5A2 mRNA.
[0096] Example 3: siJAK3-1, siJAK3-2, siJAK3-m1 and siJAK3-m2 inhibit JAK3 mRNA in HepG2 cells
[0097] 1) Digest HepG2 cells in logarithmic growth phase with trypsin, add MEM medium containing 10% FBS to terminate digestion, then centrifuge to collect cells, add MEM medium containing 10% FBS, count cells with a hemocytometer, and then add 1×10 5 cells to each well of a 12-well plate for culture.
[0098] 2) After culturing for 24 h, add the siJAK3 transfection solution. Preparation of the mixture of Lipofectamine 3000 and siJAK3-1, siJAK3-2: Dilute siRNA and 3 ml of Lipofectamine 3000 separately in 50 ml of serum-free culture medium (Opti-MEM, Gibco), then mix the above siRNA solution and Lipofectamine 3000 solution, and let it stand at room temperature for 15 minutes.
[0099] 3) Add 100 μl of the siRNA and Lipofectamine 3000 mixed solution (final concentration of siRNA is 10 nM) corresponding to each group to each well.
[0100] 4) After culturing for 48 hours, discard the culture medium, wash twice with enzyme-free PBS, add lysis buffer (BioFlux) to lyse the cells, add chloroform (MREDA) for extraction, mix well by shaking and let stand at room temperature for 2 - 3 minutes, centrifuge, transfer the supernatant after stratification to a well plate to bind with the binding solution, use a nucleic acid extractor, place the well plate in order according to the kit instructions (MagaBio plus Total RNA Purification Kit II), and then use the BSC69 program to extract RNA.
[0101] 5) Prepare the qPCR system on ice. Add 1 μl of One Step SYBR Green Mix (Novizan), 10 μl of 2x One Step SYBR Green Mix (Novizan), and 0.4 μl of each primer to each well. Dilute 200 ng of RNA in 8.2 μl of Rnase ddH2O (Novizan) and add it to the well, mix well and put it into the qPCR instrument for reaction.
[0102] PCR reaction conditions: pre-denaturation at 50 °C for 15 minutes, 95 °C for 1 minute, annealing at 95 °C for 15 seconds, extension at 60 °C for 1 minute, and perform 39 cycles.
[0103] The PCR primers are as follows (5’-3’):
[0104] Forward: TTCGGGCTACGCAAGGATTTG (SEQ ID NO:15)
[0105] Reverse: AGGCTGAGACACTCACCCT (SEQ ID NO:16)
[0106] As Figure 3 shown, the results indicate that after transfection with Lipofectamin 3000, siJAK3-1 inhibited 81.1% of JAK3 mRNA in HepG2 cells, the inhibition rate of siJAK3-2 was 87.7%, the inhibition rate of siJAK3-m1 was 95.2%, and the inhibition rate of siJAK3-m2 was 94.0%.
[0107] Example 4: Inhibition of JAK3 mRNA in Jurkat cells by siJAK3-1, siJAK3-2, siJAK3-m1, and siJAK3-m2
[0108] 1) Collect Jurkat cells in the logarithmic growth phase, add RPMI-1640 medium containing 10% FBS, count the cells with a hemocytometer, and then add 2.5×10 5 cells to each well of a 12-well plate for culture.
[0109] 2) Preparation of the mixture of Lipofectamine 3000 and siJAK3-1, siJAK3-2: Dilute siRNA and 3 ml of Lipofectamine 3000 separately in 50 ml of serum-free culture medium (Opti-MEM, Gibco), then mix the above siRNA solution and Lipofectamine 3000 solution, and let it stand at room temperature for 15 minutes.
[0110] 3) Add 100 μl of the siRNA and Lipofectamine 3000 mixed solution (final concentration of siRNA is 10 nM) of the corresponding group to each well.
[0111] 4) After culturing for 48 h, collect the cells, add Buffer RL1 (Vazyme) lysate containing 1% DTT, transfer it to gDNA-Filter Columns (Vazyme) after sufficient lysis, collect the filtrate, elute the RNA after crude RNA extraction, protein removal, desalting, removal of gDNA residue, and removal of residual ethanol, and collect the RNA.
[0112] 5) Prepare the qPCR system on ice. Add 1 μl of One Step SYBR Green Mix (Vazyme), 10 μl of 2x One Step SYBR Green Mix (Vazyme), and each primer to each well. Dilute 120 ng of siRNA in 8.2 μl of Rnase ddH2O (Vazyme) and add it to the well, mix well and put it into the qPCR instrument for reaction.
[0113] PCR reaction conditions: Pre-denaturation at 50 °C for 15 minutes, 95 °C for 1 minute, annealing at 95 °C for 15 seconds, extension at 60 °C for 1 minute, and perform 39 cycles.
[0114] The PCR primers are as follows (5'-3'):
[0115] Forward: TTCGGGCTACGCAAGGATTTG (SEQ ID NO:15)
[0116] Reverse: AGGCTGAGACACTCACCCT (SEQ ID NO:16)
[0117] As Figure 4 shown, the results indicate that after transfection with Lipofectamin 3000, siJAK3-1 inhibited 76.0% of JAK3 mRNA in Jurkat cells, the inhibition rate of siJAK3-2 was 71.0%, the inhibition rate of siJAK3-m1 was 74.3%, and the inhibition rate of siJAK3-m2 was 79.8%.
[0118] Example 5: siJAK3-1 inhibits the mRNA of inflammatory factors in Jurkat cells
[0119] 1) Collect Jurkat cells in the logarithmic growth phase, add RPMI-1640 medium containing 10% FBS, count the cells with a hemocytometer, and then add 2.5×10 5 cells to each well of a 12-well plate for culture, and add 1% lipopolysaccharide (LPS) for inflammatory stimulation.
[0120] 2) Preparation of the mixture of Lipofectamine 3000 and siJAK3-1, siJAK3-2: Dilute siRNA and 3 ml of Lipofectamine 3000 separately in 50 ml of serum-free culture medium (Opti-MEM, Gibco), then mix the above siRNA solution and Lipofectamine 3000 solution, and let it stand at room temperature for 15 minutes.
[0121] 3) Add 100 μl of the siRNA and Lipofectamine 3000 mixed solution (final concentration of siRNA is 10 nM) corresponding to each group to each well.
[0122] 4) After culturing for 48 h, collect the cells, add Buffer RL1 (Novizan) lysis buffer containing 1% DTT, transfer to gDNA-Filter Columns (Novizan) after sufficient lysis, collect the filtrate, elute the RNA after crude RNA extraction, protein removal, desalting, removal of residual gDNA, and removal of residual ethanol, and collect the RNA.
[0123] 5) Prepare the qPCR system on ice. Add 1 μl of One Step SYBR Green Mix (Novizan), 10 μl of 2x One Step SYBR Green Mix (Novizan), and 0.4 μl of each primer to each well. Dilute 120 ng of siRNA in 8.2 μl of Rnase ddH2O (Novizan) and add it to the well, mix well and put it into the qPCR instrument for reaction.
[0124] PCR reaction conditions: Pre-denaturation at 50°C for 15 minutes, 95°C for 1 minute, annealing at 95°C for 15 seconds, extension at 60°C for 1 minute, and perform 39 cycles.
[0125] The PCR primers are as follows:
[0126] IL 2 Forward: AACCTCAACTCCTGCCACAAT (SEQ ID NO:17)
[0127] IL 2 Reverse: GTGGCCTTCTTGGGCATGTA (SEQ ID NO:18)
[0128] IL 6 Forward: TTCTGCGCAGCTTTAAGGAG (SEQ ID NO:19)
[0129] IL 6 Reverse: AGGTGCCCATGCTACATTTG (SEQ ID NO:20)
[0130] IL 15 Forward: TGCAGGGCTTCCTAAAACAGA (SEQ ID NO:21)
[0131] IL 15 Reverse: CAACTGGGGTGAACATCACTTT (SEQ ID NO:22)
[0132] IL 1b Forward: AGCTACGAATCCGACCAC (SEQ ID NO:23)
[0133] IL 1b Reverse: CGTTATCCCATGTGTCGAAGAA (SEQ ID NO:24)
[0134] The results are as Figures 5-8 shown, the siJAK3-1 sequence can inhibit the expression of inflammatory factors in Jurkat cells stimulated by LPS.
[0135] Example 6: Inhibition of JAK3 mRNA in Jurkat cells by siJAK-1 cationic polymer (PEI) nanoparticles with different N / P ratios
[0136] 1) Preparation of siJAK3-1 cationic polymer nanoparticles with different N / P ratios: Prepare a 1 mg / ml siJAK-1 solution and mix it with PEI solutions at concentrations of 0.125 mg / ml, 0.625 mg / ml, 1.25 mg / ml, 1.875 mg / ml, and 2.50 mg / ml in equal volumes to prepare polymer nanoparticle solutions with N / P ratios of 1:1, 5:1, 10:1, 20:1, 30:1, and 40:1 respectively.
[0137] 2) Collect Jurkat cells in the logarithmic growth phase, add RPMI-1640 medium containing 10% FBS, count the cells using a hemocytometer, and then add 2.5×10 5 cells to each well of a 12-well plate for culture.
[0138] 3) Add polymer nanoparticle solutions with different N / P ratios (final concentration of siRNA: 10 nM) to each well and continue culturing.
[0139] 4) After culturing for 48 h, collect the cells, add Buffer RL1 (Vazyme) lysis buffer containing 1% DTT, transfer the lysate to gDNA-Filter Columns (Vazyme) after thorough lysis, collect the filtrate, elute the RNA after crude RNA extraction, protein removal, desalting, removal of residual gDNA, and removal of residual ethanol to obtain the RNA.
[0140] 5) Prepare the qPCR system on ice. Add 1 μl One Step SYBR Green Mix (Vazyme), 10 μl 2× One Step SYBR Green Mix (Vazyme), and each primer to each well. Dilute 120 ng of siRNA in 8.2 μl of Rnase ddH2O (Vazyme) and add it to the well. Mix well and place it in a qPCR instrument for reaction.
[0141] PCR reaction conditions: pre-denaturation at 50 °C for 15 minutes, 95 °C for 1 minute, annealing at 95 °C for 15 seconds, extension at 60 °C for 1 minute, for 39 cycles.
[0142] The PCR primers are as follows (5’-3’):
[0143] Forward: TTCGGGCTACGCAAGGATTTG (SEQ ID NO:15)
[0144] Reverse: AGGCTGAGACACTCACCCT (SEQ ID NO:16)
[0145] As Figure 9 shown, the results indicate that siJAK3-1 polymer nanoparticles with N / P ratios of 1 to 40 can inhibit JAK3 mRNA in Jurkat cells, with an inhibition rate of 9 to 95%.
[0146] Example 7: Preparation and transdermal effect of siRNA hair growth gel
[0147] 1) Preparation of traditional Chinese medicine extract: Crush ginseng, angelica, fleece-flower root, lightyellow sophora root, and oriental arborvitae leaf respectively, use 70% ethanol-water as the solvent, heat under reflux for extraction three times, 2 hours each time, combine the three extraction solutions, and evaporate and recover ethanol until there is no ethanol solution.
[0148] 2) Components and ratios of gel 1:
[0149] Component Proportion siRNA 0.05% PEI 0.05% 1,3-propanediol 15% Glycerol 0.7% Tween 20 5% Aculyn 22 0.6% Triethanolamine 0.5% Propylene glycol 0.1% Ginseng extract 0.1% Angelica extract 0.1% Polygonum multiflorum extract 0.1% Sophora flavescens extract 0.1% Biota orientalis extract 0.1%
[0150] 3) Prepare 30 g of siRNA gel according to the above component ratios. The specific method is as follows:
[0151] a. Weigh 7.5 mg each of siSRD5A2-m1 and siJAK3-m1, and dissolve them in enzyme-free and sterile water to prepare a solution with a total siRNA concentration of 2 mg / ml.
[0152] b. Weigh 0.015 g of PEI and prepare a 2 mg / ml solution with enzyme-free and sterile water.
[0153] c. Vortex and mix the above siRNA solution and PEI solution at a volume ratio of 1:1 to form Solution A.
[0154] d. Weigh 4.5 g of 1,3-propanediol, 0.21 g of glycerol, 1.5 g of Tween, 0.03 g of propylene glycol, 0.18 g of Aculyn 22, and 0.03 g each of ginseng extract, angelica extract, polygonum multiflorum extract, sophora flavescens extract, and platycladus orientalis extract. Add an appropriate amount of water and stir to mix evenly to obtain Solution B.
[0155] e. Stir and mix Solution A and B to obtain Solution C.
[0156] f. Take 3 ml of 5% triethanolamine aqueous solution, drop it into Solution C under stirring, add water to 30 g, and stir to mix evenly to obtain siRNA gel I.
[0157] 4) Select male C57BL / 6 mice. After one week of adaptive feeding, anesthetize the mice and depilate them. The depilated area is in the middle of the chest (on the side of the spleen under the xiphoid process), and the depilated area is about 2 cm2. Before administration, wash the depilated area with room-temperature enzyme-free PBS. Aspirate 200 μl of FAM-labeled siRNA gel and evenly apply it on the skin. After administration, lie the animal on its back for 30 min, then sacrifice the mouse and wash the administration site with tap water. Make paraffin sections from the removed skin, stain with DAPI, and observe the transdermal penetration of siRNA under a confocal microscope.
[0158] As Figure 10 shown, 30 min after topical administration of siRNA gel I, it has penetrated into the skin.
[0159] Example 8: Preparation of siRNA hair growth gel II and skin irritation test on New Zealand rabbits
[0160] 1) Components and ratios of gel II:
[0161] Component Proportion siRNA 0.5% PEI 1.5% 1,3-propanediol 3% Glycerol 2.8% Tween 20 0.5% Aculyn 22 4% Triethanolamine 3% Propylene glycol 1% Ginseng extract 0.1% Angelica extract 0.1% Polygonum multiflorum extract 0.1% Sophora flavescens extract 0.1% Biota orientalis extract 0.1%
[0162] 2) Prepare 30 g of siRNA gel according to the above component ratios. The specific method is as follows:
[0163] a. Weigh 75 mg each of siSRD5A2-m1 and siJAK3-m2, and dissolve them in enzyme-free and sterile water to prepare a solution with a total siRNA concentration of 25 mg / ml.
[0164] b. Weigh 0.45 g of PEI and prepare a 75 mg / ml solution with enzyme-free and sterile water.
[0165] c. Vortex and mix the above siRNA solution and PEI solution in a 1:1 ratio to form Solution A.
[0166] d. Weigh 0.9 g of 1,3-propanediol, 0.84 g of glycerol, 0.15 g of Tween, 0.3 g of propylene glycol, and 1.2 g of Aculyn 22, add an appropriate amount of water and stir to mix evenly, which is called Solution B.
[0167] e. Stir and mix Solution A and B to form Solution C.
[0168] f. Take 3 ml of 30% triethanolamine aqueous solution, add it dropwise to Solution C under stirring, add water to 30 g, and stir to mix evenly to obtain siRNA gel II.
[0169] 3) Select four female New Zealand white rabbits with a body weight of 2.165 Kg - 2.319 Kg. After 3 days of adaptive feeding, 24 hours before the experiment, carefully shave the hair on both sides of the spine on the back, and the hair removal area is about 3 cm * 3 cm on each side.
[0170] On the next day, after weighing, directly apply 0.5 mL of the test substance on the left skin, cover it with two layers of gauze (2.5 cm x 2.5 cm) and one layer of glass paper, and then fix it with non-irritating tape and bandage. The right skin is used as a control. Adopt a closed test with an application time of 4 h. After the experiment, use warm water to remove the residual test substance. 3) Clinical observation: Observe the skin reaction at the test site at 1 h, 24 h, 48 h, and 72 h after removing the residual test substance.
[0171] According to the scoring table (Table 1) and Figure 11 The results show that the gel has no irritation.
[0172] Table 1 Scoring table for skin irritation test of siRNA gel II group on New Zealand rabbits
[0173]
[0174] Example 9: Effect of siRNA gel I on inhibiting the expression of SRD5A2 and JAK3 mRNA in mouse skin
[0175] 1) Male C57BL / 6 mice were selected and the experiment started at 4 - 6 weeks of age. Breeding conditions: temperature 24 - 26°C, humidity 60%, 12 hours of light and 12 hours of darkness each. After one week of adaptive breeding, the mice were anesthetized and depilated. The depilated area was in the middle of the chest (on the side of the spleen, below the xiphoid process), and the depilated area was about 2 cm2. Before administration, the depilated area was washed with enzyme-free PBS at room temperature. 200 μl of the gel was aspirated and evenly applied to the skin. After administration, the animals were fixed in a supine position for a certain period of time (about 2 hours) to allow the drug to have a certain absorption time.
[0176] 2) Sample collection
[0177] The mice were sacrificed 24 hours after administration. The skin was wiped clean with enzyme-free PBS at room temperature, and the skin in the area where the drug was applied was cut, avoiding subcutaneous adipose tissue. After removing the chest skin, the skin was processed by liquid nitrogen grinding method.
[0178] 3) RNA extraction.
[0179] 4) The expressions of SRD5A2 and JAK3 were detected by RT-PCR respectively
[0180] Prepare the qPCR system on ice. Add 1 ml of One Step SYBR Green Mix (Novizan), 10 ml of 2x One Step SYBR Green Mix (Novizan), and 0.4 μl of each primer to each well. Dilute 120 ng of siRNA in 8.2 μl of Rnase ddH2O (Novizan) and add it to the well. Mix well and put it into the qPCR instrument for reaction.
[0181] PCR reaction conditions: pre-denaturation at 50°C for 15 minutes, 95°C for 1 minute, annealing at 95°C for 15 seconds, extension at 60°C for 1 minute, for 39 cycles.
[0182] The PCR primers are as follows (5’-3’):
[0183] SRD5A2 Forward: ACACCTCTGATCCCTCAGC (SEQ ID NO:25)
[0184] SRD5A2 Reverse: GCGAATGATAAACAGGCAGGATG (SEQ ID NO:26)
[0185] JAK3 Forward: CGTGGACACTCAAGTCTTGGT (SEQ ID NO:27)
[0186] JAK3 Reverse: CAGCCCAAAGCGGTGACAT (SEQ ID NO:28)
[0187] As Figure 12 shown, the results indicate that after 24 hours of topical administration of the siRNA mixed gel to the skin, the inhibition rates of SRD5A2 and JAK3 mRNA in the skin are approximately 49.3% and 49.8% respectively.
[0188] Example 10: Pharmacodynamic effects of siRNA gel I and gel II on male androgenetic alopecia model mice
[0189] 1) Twenty-one SPF-grade male C57BL / 6 mice, weighing 20 - 22 g, were purchased from Beijing Sibefu Experimental Animal Technology Co., Ltd. The animal license number is SYXK (Jing) 2023 - 0011, and the animal certificate number is No.110324231103725753. Since the mice were purchased, the breeding temperature has been 22 ± 2°C, and they had free access to food and drinking water. They were adaptively bred for 3 days.
[0190] 2) Construction of the male androgenetic alopecia mouse model
[0191] After 3 days of adaptive feeding for each group of mice, they were anesthetized by inhalation of isoflurane. A depilation area of approximately 2×3 cm in size with its long side parallel to the spine was selected at a point 0.5 cm proximal to the distal end of the tail. First, use a pet-specific hair clipper to cut all the hair in the depilation area on the back of all mice until the back skin was faintly visible. Then, apply the depilatory cream evenly to the area where the hair had been removed according to the instructions. Moisten a cotton ball with physiological saline and use the moist cotton ball to wipe off the depilatory cream and the remaining hair. Confirm that the hair follicles on the back skin of the mice were all in the resting phase, that is, the back skin of the mice was pinkish red as observed with the naked eye. The day of shaving was defined as day 0 of the experiment. Twenty-four hours after shaving, the mice were randomly grouped according to their body weight. Among them, there were 3 mice in the blank group, 6 mice in the model group, 6 mice in the siRNA gel I group, and 6 mice in the siRNA gel II group. Except for the blank group injected with the solvent, the mice in the other groups were subcutaneously injected with testosterone propionate solution at a dose of 5 mg / kg at multiple points in the depilated area on the back. At the same time of model establishment, the blank group and the model group were wiped with physiological saline on the skin 3 times a day, and the administration groups were wiped with sterile and enzyme-free water from the inside to the outside 3 times, and then 300 μl of the corresponding gel was applied for 14 days, and the samples were taken for detection.
[0192] 3) Detection of each index
[0193] The skin and hair growth conditions at the depilated sites of each group of mice were observed daily to evaluate the effect of the drug on the hair growth cycle of the mice. Photographs were taken and the hair growth conditions were recorded on days 0, 7, and 14 of the experiment (as Figure 13 shown).
[0194] a. Hair weight
[0195] On the 22nd day of the experiment, the mice were killed by cervical dislocation after their eyeballs were removed and blood was collected. The skin of the hair removal area on the back of each mouse was taken using a mouse ear punch (6 mm in diameter) and weighed using a precision analytical balance. The hair on the surface of the skin was burned off with an open flame and weighed again. The difference between the two values divided by the punched area was the hair weight per unit area. The results are shown in Table 2.
[0196] Table 2 Effects of siRNA gel group 1 and gel group 2 on the hair weight per unit area of male baldness model mice ( )
[0197] n Hair weight per unit area (mg / cm2) Blank group 3 35.39±7.85 Model group 6 15.81±4.04* Gel 1 5 29.02±7.92# Gel 2 6 35.03±12.15##
[0198] b. Skin tissue pathological examination
[0199] The mouse skin tissue was embedded in paraffin and sliced for hematoxylin-eosin staining (HE staining) to examine the inflammatory response of skin irritation; hair follicle morphological changes: The cross-section of the hair follicle was taken, and the number of hair follicles, terminal hair (diameter larger than the inner hair root sheath diameter, hair shaft pigment is darker) and vellus hair (diameter smaller than the inner hair root sheath diameter, hair shaft pigment is light or absent) were counted under a microscope (×100), and the ratio of terminal hair / vellus hair was calculated. (For each specimen, three fields of view with the most hair follicles were selected, and the fields of view were not overlapped as much as possible. The number of terminal hair and vellus hair was counted separately, and the ratio of terminal hair / vellus hair was calculated. The average was taken for statistical analysis). Figure 14 shown.
[0200] c. Immunohistochemical detection of IL15 content in skin tissue
[0201] Paraffin sections were routinely dewaxed to water, incubated with endogenous peroxidase blocker at 37°C for 10 min, added with primary antibody (IL15 1:200) and incubated at 37°C for 90 min, added with reaction enhancement solution and secondary antibody, incubated at 37°C for 20 min respectively, developed with DAB for 10 min, rinsed, counterstained with hematoxylin, dehydrated and sealed with neutral resin, brown particles were observed under the microscope as positive expression, 5 different fields of view (×400) were randomly selected for photography, and the staining results were analyzed by gray value using Image5 software, as shown in Figure 5. Figure 15 shown.
[0202] The results are as follows Figure 13 As shown in Table 2, after 14 days of drug treatment, the hair growth of the mice modeled by gel 1 and gel 2 resumed, and the hair weight per unit area increased significantly (compared with model group B, P < 0.01). Both groups were able to increase the number of hair follicles, especially terminal hair follicles, and promote hair growth. Figure 14 It can be seen that after drug administration, the number of hair follicles increased compared with the model group; Figure 15As can be seen from C and D, compared with model group B, the color becomes lighter, indicating a decrease in the expression of the inflammatory factor IL-15 in androgenetic alopecia model mice.
[0203] The series of detailed descriptions listed above are only specific descriptions of the feasible implementation modes of the present invention, and they are not intended to limit the protection scope of the present invention. Those skilled in the art can design many other modifications and implementation modes, and these modifications and implementation modes will fall within the principle scope and spirit disclosed in this application. More specifically, within the scope of the disclosure, drawings and claims of this application, various variations and improvements can be made to the components and / or layout of the subject combination layout. In addition to the variations and improvements made to the components and / or layout, other uses will also be obvious to those skilled in the art.
Claims
1. A nucleic acid compound preparation for hair growth and development, wherein, It includes siRNA and traditional Chinese medicine extracts. The siRNA includes siSRD5A2 that inhibits the expression of the SRD5A2 gene and / or siJAK3 that inhibits the expression of the JAK3 gene.
2. The preparation according to claim 1, wherein The traditional Chinese medicine extracts include one or more of ginseng extract, angelica extract, fleece-flower root extract, lightyellow sophora root extract, and oriental arborvitae leaf extract.
3. The preparation according to claim 1, wherein, The siSRD5A2 is composed of a sense strand and an antisense strand. The sense strand and the antisense strand are at least partially reverse complementary, and the antisense strand is reverse complementary to a segment on the SRD5A2 gene. The sense strand is 5’-CAAGGUGGCUUGUUUACGUAUGUdTdT-3’ (SEQ ID NO:1), and the antisense strand is 5‘-AAACAUACGUAAACAAGCCACCUUGUG-3’ (SEQ ID NO:2).
4. The preparation according to claim 1, wherein, The siJAK3 is composed of a sense strand and an antisense strand. The sense strand and the antisense strand are complementary, and the antisense strand is reverse complementary to a segment on the JAK3 gene. The sense strand and the antisense strand are selected from the following sequences: (1) The sense strand contains the nucleotide sequence shown in SEQ ID NO:3, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:4: 5’-ACUUUCAGCGGGAGAUUCAGA-3’ (SEQ ID NO:3), 5’-UCUGAAUCUCCCGCUGAAAGU-3’ (SEQ ID NO:4); (2) The sense strand contains the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand contains the nucleotide sequence shown in SEQ ID NO:6: 5’-AUCCCUCUCGGACAACAUCUU-3’ (SEQ ID NO:5), 5’-AAGAUGUUGUCCGAGAGGGAU-3’ (SEQ ID NO:6).
5. The preparation according to claim 3 or 4, wherein At least one nucleotide in the sense strand or the antisense strand is a modified nucleotide, and / or at least one phosphate group is a phosphate group with a modifying group; the phosphate group with a modifying group is a phosphorothioate group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate group with a sulfur atom.
6. The preparation according to claim 5, wherein The modified nucleotide is selected from 2’-fluoro-modified nucleotides, 2’-alkoxy-modified nucleotides, 2’-substituted alkoxy-modified nucleotides, 2’-alkyl-modified nucleotides, 2’-substituted alkyl-modified nucleotides, 2’-amino-modified nucleotides, 2’-substituted amino-modified nucleotides, nucleotide analogs, or any combination of two or more of them.
7. The preparation according to claim 6, wherein The modified sense strand of siSRD5A2 is 5’-CsAsAGGUGGCUUGUUUmAmCmGmUmAmUmGmUdTdT-3’ (SEQ ID NO:7), and the antisense strand is 5’-mAsmAsmAmCmAmUmAmCGUAAACAAGCCACCUUGUG-3’ (SEQ ID NO:8); The modified sequence of siJAK3 is as follows: (1) The sense strand is 5’-AsCsUUUCAGCGGGAGAmUmUmCmAmGmA-3’ (SEQ ID NO:9), and the antisense strand is 5’-mUsmCsmUmGmAmAmUmCUCCCGCUGAAAGU-3 (SEQ ID NO:10); (2) The sense strand is 5’-AsUsCCCUCUCGGACmAmAmCmAmUmCmUmU-3’ (SEQ ID NO:11), and the antisense strand is 5’-mAsmAsmGmAmUmGmUmUGUCCGAGAGGGAU-3’ (SEQ ID NO:12).
8. The preparation according to claim 7, wherein The preparation is a gel containing siSRD5A2 and / or siJAK3, a delivery substance cationic polymer, and a gel matrix; The cationic polymer is a composition of one or more of polyethyleneimine (PEI), polyamidoamine (PMAMA), poly(b-amino ester) (PBAE), poly(dimethylaminoethyl methacrylate) (PDMAEMA), polyamino acids (PAAs), and chitosan; The gel matrix consists of Aculyn 22, glycerol, propylene glycol, 1,3-propanediol, and Tween 20.
9. The preparation according to claim 8, wherein, The proportion of Aculyn 22 is 0.6% to 4%, the proportion of glycerol is 0.7% to 2.8%, the proportion of propylene glycol is 0.1% to 1%, the proportion of 1,3-propanediol is 3% to 15%, and the proportion of Tween 20 is 0.5% to 5%.
10. The preparation according to claim 9, wherein, The N / P of siSRD5A2 and / or siJAK3 to the cationic polymer is 1:1 to 40:1, and the proportion of siSRD5A2 and / or siJAK3 in the gel is 0.05% to 0.5%.
11. The gelling agent according to claim 2, wherein, The total proportion of the traditional Chinese medicine extract in the gel is 0.5%.