Gene detection platform based on micro-fluidic chip and thalassemia detection kit

Through a gene detection platform based on microfluidic chips, integrating nucleic acid extraction, PCR amplification and product color reactions, the existing thalassemia detection technology has solved the problem of cumbersome steps and low efficiency, and achieved efficient, accurate and automated detection, meeting the needs of rapid screening and diagnosis.

CN120209985APending Publication Date: 2025-06-27THE PEOPLES HOSPITAL OF GUANGXI ZHUANG AUTONOMOUS REGION
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510296620.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-13
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

The existing thalassemia detection technology has problems such as cumbersome nucleic acid detection steps, low detection efficiency, and strong dependence on equipment, and cannot meet the integrated testing needs of "sample in and result out".

Method used

It adopts a gene detection platform based on microfluidic chips to integrate nucleic acid extraction, PCR amplification and product color reactions to achieve rapid detection of gene mutation sites and provides a thalassemia detection kit, which is convenient to operate, high detection accuracy and low cost.

Benefits of technology

It realizes automated detection from samples to results, significantly improves detection efficiency and accuracy, reduces costs, and meets the needs of rapid screening and diagnosis of thalassemia.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120209985A_ABST
    Figure CN120209985A_ABST
Patent Text Reader

Abstract

The invention discloses a gene detection platform based on a micro-fluidic chip, which integrates an operation platform, the micro-fluidic chip, a control system, an automatic pipetting device and the like, and is characterized in that a plurality of independent detection channels are arranged on the micro-fluidic chip; each detection channel is provided with a PCR amplification chamber, an amplification product analysis chamber, a two-way pump, a waste liquid collection chamber, a three-way electromagnetic valve and the like, and the detection platform can realize full-automatic liquid preparation, nucleic acid extraction (whole blood mode, omitting the step), PCR amplification, denaturation, molecular hybridization and the like on the basis of the micro-fluidic chip. And the whole process of the steps of result storage, interpretation and the like is automatic, so that the integrated detection requirement of'sample feeding and result outputting 'is met. Meanwhile, the kit is applied to the detection of thalassemia genes, and specific primers and probes are designed and screened to obtain the thalassemia detection kit, and the kit has the advantages of being convenient to operate, high in detection precision, low in cost, visual in result interpretation and the like.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology, and particularly relates to a gene detection platform based on a microfluidic chip and a thalassemia detection kit. Background Art

[0002] Thalassemia, also known as Mediterranean anemia or thalassemia, abbreviated as "thalassemia", is a hereditary hemolytic anemia disease. It is mainly caused by the imbalance in the synthesis of globin peptide chains in hemoglobin. Specifically, it is due to mutations or deletions in the α or β-globin genes, resulting in reduced or complete inability to synthesize α- or β-globin chains. Currently, commonly used thalassemia detection techniques include next-generation sequencing (NGS), single-molecule sequencing (third-generation sequencing, TGS), gap polymerase chain reaction (Gap-PCR), polymerase chain reaction-reverse dot blot (PCR-RDB), multiplex ligation-dependent probe amplification (MLPA), polymerase chain reaction-probe melting curve analysis (PMCA), and Sanger sequencing. These techniques can comprehensively cover α- and β-thalassemia-related pathogenic variants, improving the accuracy of detection and the positive detection rate, providing strong technical support for the diagnosis, prevention, and control of thalassemia. Among them, PCR-RDB is the main detection method for screening thalassemia hotspot gene defects and is currently one of the main methods commonly used in Chinese hospitals for rapid screening of thalassemia types. The advantages of the PCR-RDB technique are its rapidity, simplicity, and the ability to detect multiple mutations simultaneously in thalassemia detection. Its main operating steps include the extraction of patient blood DNA, PCR amplification, and the incubation and binding of the amplification products to the gene chip membrane strip. However, nucleic acid diagnosis of thalassemia mainly includes three major parts: nucleic acid extraction, nucleic acid amplification, and product analysis and detection. In traditional nucleic acid detection, these three parts usually require three types of instruments, such as nucleic acid extraction equipment, nucleic acid amplification, and nucleic acid hybridization instrument detection equipment, to be completed independently. Therefore, when applying the PCR-RDB technique, there are problems such as cumbersome nucleic acid detection steps, low detection efficiency, and strong dependence on various types of equipment, which are not conducive to the popularization and application of nucleic acid diagnosis methods. Existing commercial thalassemia PCR-RDB detection methods require specialized partition experiments, are complex to operate, expensive, and have low automation and integration, and cannot meet the integrated detection requirements of "sample in, result out". Summary of the Invention

[0003] In view of the above deficiencies, the present invention discloses a gene detection platform based on a microfluidic chip, integrating gene amplification and product color reaction into the microfluidic chip for rapid detection of gene mutation sites, realizing an integrated detection of "sample in, result out", and applying the platform to the detection of genes related to thalassemia, providing a thalassemia detection kit, which has the advantages of convenient operation, high detection accuracy, low cost, and intuitive result interpretation.

[0004] The present invention is implemented by the following technical solutions: A gene detection platform based on a microfluidic chip, which includes an operation platform, a microfluidic chip, and a control system; an automatic pipetting device for pipetting is arranged above the operation platform; a reagent placement area is arranged on the operation platform, and several liquid storage boxes are arranged in the reagent placement area for placing various reagents for detection; an operation area is arranged on one side of the reagent placement area, and the microfluidic chip is placed in the operation area for operation. A heating device and a power supply device for the microfluidic chip are arranged in the operation area; several independent detection channels are arranged on the microfluidic chip, and each detection channel is provided with a PCR amplification chamber with an upper opening, an amplification product analysis chamber, a two-way pump A, a waste liquid collection chamber, and a three-way solenoid valve A; the sample to be detected and PCR amplification reagents are added to the PCR amplification chamber through the automatic pipetting device, and reactions are carried out in the PCR amplification chamber; the three-way solenoid valve A is respectively connected to the PCR amplification chamber and the waste liquid collection chamber, and is connected to the amplification product analysis chamber through the two-way pump A; analysis reagents are added to the amplification product analysis chamber through the automatic pipetting device, and reactions are carried out in the amplification product chamber. A membrane chip for detecting different genes is arranged in the amplification product analysis chamber; the control system is respectively connected to the automatic pipetting device, the heating device, and the power supply device. Several wire interfaces are arranged in the operation area. The three-way solenoid valve A is connected to the wire interface through a wire and then connected to the control system through a wire. The two-way pump A is connected to the wire interface through a wire and then connected to the control system and the power supply device through a wire. The control system can be a control system based on PLC or a control system based on a computer.

[0005] Further, one end of the detection channel is provided with a PCR amplification chamber, and the other end is provided with an amplification product analysis chamber, and a heating device is respectively arranged for the PCR amplification chamber and the amplification product analysis chamber on the operation area.

[0006] Further, a sample treatment chamber, a two-way pump B, and a three-way solenoid valve B are arranged in the detection channel. The reagent for nucleic acid extraction and the sample to be detected are added to the sample treatment chamber through the automatic pipetting device, and nucleic acid extraction treatment is carried out in the sample treatment chamber. The three-way solenoid valve B is respectively connected to the PCR amplification chamber and the waste liquid collection chamber, and is connected to the sample treatment chamber through the two-way pump B.

[0007] Furthermore, magnetic beads are provided in the sample processing chamber.

[0008] Furthermore, a digital camera is provided above the amplification product analysis chamber for taking pictures of the membrane chip in the amplification product analysis chamber and recording the detection results of the membrane chip.

[0009] The usage method of the gene detection platform based on a microfluidic chip includes the following steps: (1) Respectively add PCR amplification reagents, nucleic acid extraction reagents, and analysis reagents into the liquid storage boxes in the reagent placement area. At the same time, place the membrane chip in the amplification product analysis chamber of the microfluidic chip and place the microfluidic chip in the operation area. Then, power on each device in the gene detection platform, and then manually add the sample to be tested into the sample processing chamber or the PCR amplification chamber of the microfluidic chip; (2) The control system controls the automatic pipetting device to add the nucleic acid extraction reagent from the reagent placement area into the sample processing chamber for processing. Then, the control system controls the two-way pump B and the three-way solenoid valve B to transport the solution in the sample processing chamber to the PCR amplification chamber to be mixed with the PCR amplification reagent, and then heats the PCR amplification chamber to perform the amplification reaction; Or the control system controls the automatic pipetting device to add the PCR amplification reagent from the reagent placement area into the PCR amplification chamber for mixing, and then heats the PCR amplification chamber to perform the amplification reaction; (3) The control system controls the two-way pump A and the three-way solenoid valve A to transport the solution in the PCR amplification chamber to the amplification product analysis chamber. Then, the control system controls the automatic pipetting device to add the corresponding analysis reagent (such as hybridization solution) from the reagent placement area into the amplification product analysis chamber, heats the amplification product analysis chamber to 35 - 66 °C for hybridization reaction processing. After the processing is completed, the control system controls the two-way pump A and the three-way solenoid valve A to transport the solution in the amplification product analysis chamber to the waste liquid collection chamber; (4) The control system controls the automatic pipetting device to add the corresponding analysis reagent (such as color developer) from the reagent placement area into the amplification product analysis chamber again for color development reaction processing, so that a color development result appears on the membrane chip, and directly perform interpretation or automatically take a picture through the digital camera and transmit it to the control system for automatic interpretation according to the preset standard.

[0010] Furthermore, the nucleic acid extraction reagent includes proteinase K, TE buffer for eluting nucleic acid from magnetic beads, ethanol for dissolving and removing non-nucleic acid impurities, Tris-HCl buffer for maintaining pH stability, sodium dodecyl sulfate, sodium chloride, EDTA (ethylenediaminetetraacetic acid), and isopropanol.

[0011] Application of the gene detection platform based on a microfluidic chip in detecting thalassemia genes. When using the gene detection platform to detect thalassemia genes, the test sample solution includes anticoagulated peripheral blood, DBS samples and / or samples treated similarly to DBS, chorionic villi, amniotic fluid, cord blood, peripheral blood, saliva, genetic material of embryos (including gametes such as sperm or eggs), blastomeres of cleavage-stage embryos, trophectoderm cells of blastocysts (i.e., blastocyst cells), etc.; the PCR amplification reagents such as PCR buffer, enzyme solution, MgCl2, and dNTP, etc. Specifically, the enzyme solution is a Taq polymerase system, including a hot start enzyme system that can be used for direct PCR method, etc.; the buffer is a direct PCR buffer for blood; the reagents for the direct PCR amplification system preferably include MightyAmp Taq, 2×MightyAmp Buffer, primer sets, 10×Additive for High Specificity, and the primer sets include the following primers: Primer 1F: GTCATCACTTAGACCTCACCCTGT (as shown in Sequence 1 in the sequence listing), Primer 1R: AAAAAGAAGGGGAAAGAAAACAT (as shown in Sequence 2 in the sequence listing), Primer 2F: TAATCTCTTTCTTTCAGGGCAATAA (as shown in Sequence 3 in the sequence listing), Primer 2R: TATTAGGCAGAATCCAGATGCTCA (as shown in Sequence 4 in the sequence listing), Primer A2F: ACCTCCCCGCCGAGTTCA (as shown in Sequence 5 in the sequence listing), Primer A2R / A2-R: AGGAAGGGCCGGTGCAAG (as shown in Sequence 6 in the sequence listing), Primer 3.7F / A2-F: CCCCTGTCCTTTCCCTACCC (as shown in Sequence 7 in the sequence listing), Primer 3.7R: GGAGTGGGACTTCTCTGACCTACC (as shown in Sequence 8 in the sequence listing), Primer 4.2F: TGCTTTTGTGAGTGCTGTGTTGAC (as shown in Sequence 9 in the sequence listing), Primer 4.2R: GCGGAGTTTCGCTGTTGTTTTC (as shown in Sequence 10 in the sequence listing), Primer SEA-F: CCTTCACCCTCCCACAGTTCC (as shown in Sequence 11 in the sequence listing), Primer SEA-R: CGTCACCCTCAGAGCCATCAC (shown as Sequence 12 in the Sequence Listing), Primer THAI-F: CACCCATGGGAGAGAGGAGC (shown as Sequence 13 in the Sequence Listing), Primer THAI-R: TCACCACCACCTGTGTAGGAGTG (shown as Sequence 14 in the Sequence Listing); The reagents for analysis include a 10% SDS solution, 20× SSC solution, 1M sodium citrate solution, Hybridization Solution I, Hybridization Solution II, Hybridization Solution III, horseradish peroxidase (Streptavidin-POD) with a concentration of 0.005 - 1 U / mL, chromogenic solution, water, and silicone oil. Among them, for the 10% SDS solution, 20 g of SDS is dissolved in 180 mL of pure water, the pH value is adjusted to 7.0 with 1N HCl, and finally the volume is made up to 200 mL; for the 20× SSC solution, 175.3 g of NaCl and 88.2 g of sodium citrate are dissolved in 750 mL of pure water, the pH value is adjusted to pH 7.0 with concentrated hydrochloric acid, and finally the volume is made up to 1000 mL and autoclaved; for the 1M sodium citrate solution, 294 g of sodium citrate is dissolved in 700 mL, the pH value is adjusted to 5.0 with concentrated HCl, and finally the volume is made up to 1000 mL; Hybridization Solution I contains 1 - 6× SSC and 0.1% - 1% SDS; Hybridization Solution II contains 0.1 - 1× SSC and 0.1% - 1% SDS; Hybridization Solution III is prepared by adding pure water to 100 mL of 1M sodium citrate solution to make up the volume to 1000 mL; the chromogenic solution is prepared by adding 19 mL of Hybridization Solution III, 1 mL of TMB (3,3',5,5'-tetramethylbenzidine), and 2 μL of 30% hydrogen peroxide. The membrane chip includes Membrane Chip A for detecting β-thalassemia gene, Membrane Chip B for detecting non-deletion type α-thalassemia gene, and Membrane Chip C for detecting deletion type α-thalassemia gene; Membrane Chip B and C can also be integrated into one chip (the PCR reaction system adopts the deletion α-thalassemia amplification system); The following probes are immobilized on Membrane Chip A: Probe - 28N: ACTTTTATGCCCAGCCCT (shown as Sequence 15 in the Sequence Listing), Probe - 32M: GGGCTGGGAATAAAAGTCAG (shown as Sequence 16 in the Sequence Listing), Probe - 30M: TGACTTTTGTGCCCAGCC (shown as Sequence 17 in the Sequence Listing), Probe - 29M: TGACTTTCATGCCCAGCC (shown as Sequence 18 in the Sequence Listing), Probe - 28M: CCCTGACTTCTATGCCCA (as shown in Sequence 19 in the Sequence Listing), Probe Cap + 40 - 43M: AGCAACCTCAGACACCATG (as shown in Sequence 20 in the Sequence Listing), Probe Int M: CAGACACCAGGGTGCATC (as shown in Sequence 21 in the Sequence Listing), Probe CD17N: GTTCACCTTGCCCCACAG (as shown in Sequence 22 in the Sequence Listing), Probe CD14 - 15M: TCACCTTGCCCCACCAG (as shown in Sequence 23 in the Sequence Listing), Probe CD17M: TGTGGGGCTAGGTGAACG (as shown in Sequence 24 in the Sequence Listing), Probe CD26(βE)N: CCCAGGGCCTCACCAC (as shown in Sequence 25 in the Sequence Listing), Probe CD26(βE)M: GTTGGTGGTAAGGCCCTG (as shown in Sequence 26 in the Sequence Listing), Probe CD27 - 28M: GTGGTGAGGCCCCTGG (as shown in Sequence 27 in the Sequence Listing), Probe IVS - I - 1N: TGATACCAACCTGCCCAG (as shown in Sequence 28 in the Sequence Listing), Probe IVS - I - 1M: CCCTGGGCAGATTGGTATC (as shown in Sequence 29 in the Sequence Listing), Probe IVS - I - 5M: GGCAGGTTGCTATCAAGGTTA (as shown in Sequence 30 in the Sequence Listing), Probe CD31N: CCTTAGGCTGCTGGTGGT (as shown in Sequence 31 in the Sequence Listing), Probe CD31M: CCCTTAGGTGCTGGTGG (as shown in Sequence 32 in the Sequence Listing), Probe CD41 - 42N: ACCCAGAGGTTCTTTGAGTC (as shown in Sequence 33 in the Sequence Listing), Probe CD41 - 42M: ACCCAGAGGTTGAGTCCTTT (as shown in Sequence 34 in the Sequence Listing), Probe CD43M: AGAGGTTCTTTTAGTCCTTTGG (as shown in Sequence 35 in the Sequence Listing), Probe CD71 - 72N: GCTCGGTGCCTTTAGTGA (as shown in Sequence 36 in the Sequence Listing), Probe CD71-72M: TGCCTTTAAGTGATGGCCT (as shown in Sequence 37 in the Sequence Listing), Probe IVS-II-654N: TTGCTATTGCCTTAACCCAG (as shown in Sequence 38 in the Sequence Listing), Probe IVS-II-654M: TATTGCTATTACCTTAACCCAG (as shown in Sequence 39 in the Sequence Listing), Probe IVS-II-5N: TCAGGGTGAGTCTATGGGA (as shown in Sequence 40 in the Sequence Listing), Probe IVS-II-5M: TCCCATAGAGTCACCCTGA (as shown in Sequence 41 in the Sequence Listing), Probe CD37M: TCTACCCTTAGACCCAGAGG (as shown in Sequence 42 in the Sequence Listing), Probe CC: CACATCACACACTCTGCGAC (as shown in Sequence 43 in the Sequence Listing); The following probes are immobilized on the membrane chip B: Probe WSN: GGGAGGCGTGCACCGCA (as shown in Sequence 44 in the Sequence Listing), Probe QSN: GAACTTGTCCAGGGAGGC (as shown in Sequence 45 in the Sequence Listing), Probe CSN: GGCTCCAGCTTAACGGTATTT (as shown in Sequence 46 in the Sequence Listing), Probe WSM: GGAGGCCTGCACCGCAG (as shown in Sequence 47 in the Sequence Listing), Probe QSM: GCCTCCCCGGACAAGTTC (as shown in Sequence 48 in the Sequence Listing), Probe CSM: CCAAATACCGTCAAGCTGGA (as shown in Sequence 49 in the Sequence Listing), Probe AC: CTCGGTAGCCGTTCCTCCTG (as shown in Sequence 50 in the Sequence Listing), Probe NC: ACACCAACCGCATCGTCAT (as shown in Sequence 51 in the Sequence Listing), Probe CC: CACATCACACACTCTGCGAC (as shown in Sequence 43 in the Sequence Listing); The following probes are immobilized on the membrane chip C: Probe 3.7: CATGTGTGTCCCAGCTGC (as shown in Sequence 52 in the Sequence Listing), Probe 4.2: GGGTTGGAAGTGCTGCTCAT (as shown in Sequence 53 in the Sequence Listing), Probe SEA: CCAGCCTCCAAGTGAACCT (as shown in Sequence 54 in the Sequence Listing), Probe THAI: CTGAGCCCTTGAGCCGC (as shown in Sequence 55 in the Sequence Listing), Probe A2: CTCGGTAGCCGTTCCTCCTG (as shown in Sequence 56 in the Sequence Listing), Probe NC: ACACCAACCGCATCGTCAT (as shown in Sequence 51 in the Sequence Listing), Probe CC: CACATCACACACTCTGCGAC (as shown in Sequence 43 in the Sequence Listing).

[0012] Furthermore, the preparation method of the membrane chip includes the following steps: S1. Prepare a working solution with a concentration of 10 μM by taking the probe; S2. Immerse the nylon membrane in a 10% EDAC solution for activation treatment for 30 minutes, then take out the nylon membrane, wash it with pure water, and dry it at room temperature. Drop the working solution on the nylon membrane in a dot matrix array, with each drop being 0.5 μL. Then place the nylon membrane at room temperature for reaction for 20 - 60 minutes, and then immerse it in a 0.1 mol / L sodium hydroxide solution for treatment to stop the reaction. Then wash the nylon membrane 3 times with pure water, with each washing time being 1 minute. Finally, dry it to obtain the membrane chip for detection.

[0013] A thalassemia detection kit, which includes the above PCR amplification reagent, analysis reagent, membrane chip, and / or nucleic acid extraction reagent.

[0014] The technical solution of the present invention has the following beneficial effects compared with the prior art: The present invention is an integrated construction of a microfluidic chip laboratory detection platform based on polymerase chain reaction (PCR), reverse hybridization and microfluidic chip technology. Based on the microfluidic chip, the present invention integrates nucleic acid extraction (this step can be omitted in the direct amplification mode), nucleic acid amplification and reverse hybridization into one; when the detection platform is used for thalassemia gene detection, whole blood, amniotic fluid and filter paper dried blood spots of patients can be directly used as the direct template for PCR amplification without DNA extraction. After the amplification product is denatured and unwound, it is incubated and hybridized with the membrane chip. Finally, the result is judged by the color reaction of TMB (tetramethylbenzidine) and HRP (horseradish peroxidase), realizing the rapid detection of thalassemia mutant genes. And the present invention accommodates all these operation steps into a microfluidic chip, realizing the full-process automation from automatic liquid dispensing, nucleic acid extraction (this step can be omitted for direct amplification samples), PCR amplification, denaturation, molecular hybridization to result storage and interpretation, etc., achieving the goal of "sample in, result out" rapid detection. Just add the sample, and the instrument can automatically complete all steps and directly obtain the detection result, greatly reducing the personnel burden and the risk of contamination. At the same time, in cooperation with the detection of thalassemia genes, the present invention designs and screens primers and probes according to the gene characteristics of 19 point mutations of β-thalassemia / 3 non-deletion types and 4 deletion types of α-thalassemia, fixes the probes on the nylon membrane to prepare a membrane chip for detection, and then combines the primers and the membrane chip with the reagents required for PCR amplification, hybridization, color development and other steps to obtain a kit for detecting thalassemia genes. Using the kit and combining with the detection platform described in the present invention can quickly, accurately and effectively detect and analyze thalassemia genes. The whole detection takes about 130 minutes, saving more than 1 day of time and a large amount of labor costs compared with the traditional detection method. Therefore, the present invention has the advantages of short detection time, low cost, convenient operation, closed operation, reduced pollution, and is of great significance for carrying out thalassemia population screening, genetic counseling and prenatal diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a schematic diagram of the operation platform described in Example 1.

[0016] Figure 2 It is a schematic diagram of the equipment connection in one detection channel of the microfluidic chip described in Example 2.

[0017] Figure 3 It is a result diagram of the gene detection platform for detecting thalassemia genes described in Example 3.

[0018] Figure 4 It is a layout diagram of the membrane chip for detecting β-thalassemia genes described in Example 5.

[0019] Figure 5 It is the layout diagram of the membrane chip for detecting non-deletional α-thalassemia gene in Example 5.

[0020] Figure 6 It is the layout diagram of the membrane chip for detecting deletional α-thalassemia gene in Example 5.

[0021] Reference numerals: 11 - operation platform, 12 - automatic pipetting device, 13 - operation area, 14 - microfluidic chip, 15 - digital camera, 16 - PCR amplification chamber, 17 - waste liquid collection chamber, 18 - three-way solenoid valve A, 19 - two-way pump A, 20 - amplification product analysis chamber, 21 - sample processing chamber, 22 - two-way pump B, 23 - three-way solenoid valve B. Detailed implementation manners

[0022] The present invention will be further illustrated by the following examples, which shall not be construed as limiting the present invention. For the specific experimental conditions and methods not specified in the following examples, the technical means adopted are usually conventional means well-known to those skilled in the art.

[0023] Example 1: As Figure 1As shown in the figure, a gene detection platform based on a microfluidic chip includes an operation platform, a microfluidic chip, and a control system. An automatic pipetting device (automatic pipetting workstation) for pipetting is provided above the operation platform. A reagent placement area is provided on the operation platform, and several liquid storage boxes are arranged in the reagent placement area for placing various reagents for detection. An operation area is arranged on one side of the reagent placement area. The microfluidic chip is placed in the operation area for operation. A heating device and a power supply device for the microfluidic chip are arranged in the operation area. The microfluidic chip is provided with 4 independent detection channels. Each detection channel is provided with a PCR amplification chamber with an upper opening, an amplification product analysis chamber, a two-way pump A, a waste liquid collection chamber, and a three-way solenoid valve A. The sample to be detected and the PCR amplification reagent are added to the PCR amplification chamber through the automatic pipetting device, and the reaction is carried out in the PCR amplification chamber. The three-way solenoid valve A is respectively connected to the PCR amplification chamber and the waste liquid collection chamber, and is connected to the amplification product analysis chamber through the two-way pump A. The analysis reagent is added to the amplification product analysis chamber through the automatic pipetting device, and the reaction is carried out in the amplification product chamber. A membrane chip for detecting different genes is arranged in the amplification product analysis chamber. The control system is respectively connected to the automatic pipetting device, the heating device, and the power supply device. Several wire interfaces are arranged in the operation area. The three-way solenoid valve A is connected to the wire interface through a wire and then connected to the control system through a wire. The two-way pump A is connected to the wire interface through a wire and then connected to the control system and the power supply device through a wire. A digital camera is arranged above the amplification product analysis chamber for taking pictures of the membrane chip in the amplification product analysis chamber and recording the detection results of the membrane chip. The control system is a control system based on a computer. The two-way pump A and the two-way pump B can adopt peristaltic pumps.

[0024] The usage method of the gene detection platform based on the microfluidic chip in this embodiment includes the following steps: (1) Add the PCR amplification reagent and the analysis reagent into the liquid storage boxes in the reagent placement area respectively. At the same time, place the membrane chip in the amplification product analysis chamber of the microfluidic chip and place the microfluidic chip in the operation area. Then, power on each device in the gene detection platform, and then manually add the sample to be detected into the PCR amplification chamber of the microfluidic chip. (2) The control system controls the automatic pipetting device to add the PCR amplification reagent from the reagent placement area into the PCR amplification chamber for mixing, and then heats the PCR amplification chamber for the amplification reaction. (3) The control system controls the two-way pump A and the three-way solenoid valve A to transport the solution in the PCR amplification chamber to the amplification product analysis chamber. Then, the control system controls the automatic pipetting device to add the corresponding analysis reagents (such as hybridization solution) from the reagent placement area to the amplification product analysis chamber, heats the amplification product analysis chamber to 35-75 °C for hybridization reaction treatment. After the treatment is completed, the control system controls the two-way pump A and the three-way solenoid valve A to transport the solution in the amplification product analysis chamber to the waste liquid collection chamber; (4) The control system controls the automatic pipetting device to add the corresponding analysis reagents (such as color developing agent) from the reagent placement area to the amplification product analysis chamber again for color development reaction treatment, so that the color development result appears on the membrane chip, and the result can be directly judged or automatically photographed by a digital camera and then transmitted to the control system for automatic judgment according to the preset standard.

[0025] Example 2: The difference between the gene detection platform based on the microfluidic chip described in this example and that in Example 1 is only that one end of the detection channel is provided with a PCR amplification chamber, and the other end is provided with an amplification product analysis chamber, and a heating device is respectively provided for the PCR amplification chamber and the amplification product analysis chamber on the operation area; a sample processing chamber, a two-way pump B and a three-way solenoid valve B are arranged in the detection channel. The extraction nucleic acid reagent and the sample to be detected are added into the sample processing chamber through the automatic pipetting device, and nucleic acid extraction treatment is carried out in the sample processing chamber. The three-way solenoid valve B is respectively connected to the PCR amplification chamber and the waste liquid collection chamber, and is connected to the sample processing chamber through the two-way pump B; magnetic beads are arranged in the sample processing chamber.

[0026] The usage method of the gene detection platform based on the microfluidic chip described in this example includes the following steps: (1) Add the PCR amplification reagent, the extraction nucleic acid reagent, and the analysis reagent into the storage boxes in the reagent placement area respectively. At the same time, place the membrane chip in the amplification product analysis chamber of the microfluidic chip and place the microfluidic chip in the operation area. Then, power on each device in the gene detection platform, and then manually add the sample to be detected into the sample processing chamber of the microfluidic chip; (2) The control system controls the automatic pipetting device to add the extraction nucleic acid reagent from the reagent placement area to the sample processing chamber for treatment. Then, the control system controls the two-way pump B and the three-way solenoid valve B to transport the solution in the sample processing chamber to the PCR amplification chamber to be mixed with the PCR amplification reagent, and then heats the PCR amplification chamber for amplification reaction; (3) The control system controls the bi-directional pump A and the three-way solenoid valve A to transfer the solution in the PCR amplification chamber to the amplification product analysis chamber. Then, the control system controls the automatic pipetting device to add the corresponding analysis reagents (such as hybridization solution, etc.) from the reagent placement area to the amplification product analysis chamber, heats the amplification product analysis chamber to 35 - 66 °C for hybridization reaction processing. After the processing is completed, the control system controls the bi-directional pump A and the three-way solenoid valve A to transfer the solution in the amplification product analysis chamber to the waste liquid collection chamber; (4) The control system controls the automatic pipetting device to add the corresponding analysis reagents (such as chromogenic agent, etc.) from the reagent placement area to the amplification product analysis chamber again for chromogenic reaction processing, so that the chromogenic result appears on the membrane chip, and the result is directly judged or automatically photographed by a digital camera and then transmitted to the control system for automatic judgment according to the preset standard.

[0027] Example 3: The gene detection platform based on the microfluidic chip described in Example 1 was used to detect thalassemia genes. Anticoagulated peripheral blood was selected as the sample to be tested, and the PCR amplification reagents and analysis reagents were configured. The PCR amplification reagents included PCR buffer, enzyme solution, MgCl2, dNTP, etc. Specifically, the enzyme solution was a Taq polymerase system, including a hot start enzyme system that could be used for direct PCR method; the buffer was a direct PCR buffer for blood; the direct PCR amplification system reagents preferably included MightyAmp Taq, 2×MightyAmp Buffer, primer set, 10×Additive for High Specificity; the analysis reagents included a 10% SDS solution, 20×SSC solution, 1M sodium citrate solution, hybridization solution I, hybridization solution II, hybridization solution III, a horseradish peroxidase (Streptavidin-POD) with a concentration of 0.05 U / mL, chromogenic solution, water, and silicone oil. Among them, for the 10% SDS solution, 20 g of SDS was dissolved in 180 mL of pure water, the pH value was adjusted to 7.0 with 1N HCl, and finally the volume was fixed to 200 mL; for the 20×SSC solution, 175.3 g of NaCl and 88.2 g of sodium citrate were dissolved in 750 mL of pure water, the pH value was adjusted to pH 7.0 with concentrated hydrochloric acid, and finally the volume was fixed to 1000 mL and autoclaved; for the 1M sodium citrate solution, 294 g of sodium citrate was dissolved in 700 mL, the pH value was adjusted to 5.0 with concentrated HCl, and finally the volume was fixed to 1000 mL; hybridization solution I was prepared by adding pure water to 100 mL of 20×SSC solution and 10 mL of 10% SDS solution to a volume of 1000 mL; hybridization solution II was prepared by adding pure water to 25 mL of 20×SSC solution and 10 mL of 10% SDS solution to a volume of 1000 mL; hybridization solution III was prepared by adding pure water to 100 mL of 1M sodium citrate solution to a volume of 1000 mL; the chromogenic solution was prepared by adding 1 mL of TMB (3,3',5,5'-tetramethylbenzidine) and 2 μL of 30% hydrogen peroxide to 19 mL of hybridization solution III; the membrane chip included membrane chip A for detecting β-thalassemia genes, membrane chip B for detecting non-deletion type α-thalassemia genes, and membrane chip C for detecting deletion type α-thalassemia genes; membrane chips B and C could also be integrated into one chip (the PCR reaction system used the deletion α-thalassemia amplification system); at the same time, primers of the present invention were designed and screened according to the characteristics of thalassemia genes, and corresponding probes were screened simultaneously; Take 4 samples to be tested and place them in the PCR amplification chambers of 4 detection channels of the microfluidic chip respectively. Then place the microfluidic chip on the gene detection platform for detection. The amplification system in the PCR amplification chamber is shown in Table 1, and the amplification program is shown in Table 2. At the same time, the temperature for the hybridization reaction treatment in the amplification product analysis chamber is 60 °C, and the treatment time is controlled at 20 min. The detection results of some samples are shown in Figure 3 ; The information of β / non-deletion type α / deletion type α-thalassemia mutation detection sites is shown in Table 3.

[0028] Table 1 Amplification system

[0029] Table 2 Amplification program

[0030] Table 3 Information of β / non-deletion type α / deletion type α-thalassemia mutation detection sites

[0031] Example 4: Use the gene detection platform based on the microfluidic chip described in Example 2 to detect thalassemia genes. The difference from that described in Example 3 is only that it is necessary to supplement and prepare the reagents for nucleic acid extraction, which include proteinase K, TE buffer, ethanol, Tris-HCl buffer, sodium dodecyl sulfate, sodium chloride, EDTA (ethylenediaminetetraacetic acid), isopropanol, and prepare the following reagents: Lysis solution: 2.0 - 2.5 M guanidine salt + 37% - 38% ethanol + 1% surfactant + 10 mM Tris buffer, pH 8.0; The lysis solution is used to break cells and can also be composed of multiple components. For example, sodium dodecyl sulfate (SDS), SDS is an anionic detergent that can destroy the lipid bilayer structure of cell membranes and nuclear membranes, causing cell lysis and releasing nucleic acids; salts, such as sodium chloride (NaCl), salt ions can adjust the ionic strength of the solution, helping to separate nucleic acids from other components; ethylenediaminetetraacetic acid (EDTA), EDTA is a metal ion chelator that can chelate divalent metal ions such as magnesium ions (Mg²⁺). In cells, the activity of many nucleases depends on these metal ions. By chelating metal ions, EDTA can inhibit the activity of nucleases and prevent nucleic acids from being degraded; the functions of isopropanol include promoting nucleic acid precipitation, removing polysaccharides and liposoluble impurities, etc.; Magnetic beads: magnetic beads + ethanol (50% v / v); Elution solution I: 2.0 - 2.5 M guanidine salt + 37% - 38% ethanol + 10 mM Tris buffer, pH 8.0; Elution solution II: 80% ethanol; Elution solution III: 0.1% DEPC water.

[0032] Example 5: The preparation method of the membrane chip described in Example 3 includes the following steps: S1. Prepare a working solution with a concentration of 10 μM by taking probes; S2. Immerse a nylon membrane in a 10% EDAC solution for activation treatment for 30 minutes, then take out the nylon membrane, wash it with pure water, and dry it at room temperature. Drop the working solution on the nylon membrane in a dot matrix array, with each drop being 0.5 μL. Then place the nylon membrane at room temperature for reaction for 30 minutes, and then immerse it in a 0.1 mol / L sodium hydroxide solution for treatment to stop the reaction. Then wash the nylon membrane 3 times with pure water, with each washing time being 1 minute, and finally dry it to obtain the membrane chip for detection. The layout of the membrane chip can be referred to Figures 4 to 6 as shown.

[0033] Experimental example: Verify the performance of the method of the present invention: (1) Determination of accuracy: Under the consent of the Ethics Committee of the People's Hospital of Guangxi Zhuang Autonomous Region and the informed consent of the patients, 15 negative samples and 30 thalassemia samples were collected. The samples were repeated 3 times and detected with 3 batches of chips respectively, and the negative and positive coincidence rates were calculated respectively. The results showed the corresponding genotypes. The research results were completely consistent with the detection results of the thalassemia gene diagnostic kits (PCR method) of Shenzhen Yishengtang Biotechnology Co., Ltd. and Yanneng Biotechnology (Shenzhen) Co., Ltd. The positive coincidence rate and negative coincidence rate of the product both reached 100%, and kappa = 1.

[0034] (2) Analysis of sensitivity: The microfluidic gene detection chip of the present invention was used to analyze the sensitivity of the thalassemia detection site. Using whole blood as the detection sample and adding 8 gradients of whole blood sample addition amounts, the volume ratio of the whole blood sample addition amount that can stably detect each genotype to the total volume of the amplification system was determined to be 0.1 μL / 50 μL; taking 200 μL of whole blood sample as the standard, the lowest concentration of genomic DNA that can stably detect each genotype was 40 pg / μL.

[0035] (3) Analysis of specificity: Through the interference screening test, clinically normal doses of EDTA and sodium citrate are not interfering substances for this product; hemolyzed samples do not interfere with the detection results of this kit; samples with high triglycerides (400 mmol / L) and high bilirubin samples (640 μmol / L) do not interfere with the detection of this product. Using this product to detect 8 clinical samples outside the detection range of this product, including 1 α-thalassemia negative sample, 2 β-thalassemia clinical samples, 2 iron deficiency anemia clinical samples, 2 G-6-PD clinical samples, and 1 whole blood sample infected with chlamydia, there was no cross-reaction.

[0036] (4)Repeatability: Different batches of the microfluidic detection chip of the present invention were used, and different operators (2 persons) performed the operations. Two tests were conducted on the same day for a total of 3 days, and each reference sample was detected 3 times repeatedly in each test. The α / β-thalassemia genotype can be stably detected repeatedly under different experimental conditions, and the results are consistent.

[0037] In addition, it should be understood that although this specification is described according to the embodiments, not every embodiment only contains an independent technical solution. This narrative way of the specification is only for clarity. Those skilled in the art should regard the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.

Claims

1. A gene detection platform based on a microfluidic chip, characterized in that: The invention comprises an operating platform, a microfluidic chip and a control system; an automatic liquid transfer device for liquid transfer is arranged above the operating platform; a reagent placement area is arranged on the operating platform and a plurality of liquid storage boxes are arranged in the reagent placement area for placing various reagents for detection; an operating area is arranged on one side of the reagent placement area, the microfluidic chip is placed in the operating area for operation, and a heating device and a power supply device for the microfluidic chip are arranged in the operating area; a plurality of independent detection channels are arranged on the microfluidic chip, and each detection channel is provided with a PCR amplification chamber with an upper opening and an amplification product analysis chamber, a two-way pump A, a waste liquid collection chamber, and a three-way electromagnetic valve A; a sample to be detected is added to the PCR amplification chamber by the automatic liquid transfer device; The invention relates to a method for preparing a PCR amplification chamber and a PCR amplification chamber, wherein the three-way solenoid valve A is connected to the PCR amplification chamber and the waste liquid collection chamber respectively, and is connected to the amplification product analysis chamber through a two-way pump A; an analysis reagent is added to the amplification product analysis chamber through an automatic liquid transfer device, and a reaction is carried out in the amplification product analysis chamber, wherein a membrane chip for detecting different genes is arranged in the amplification product analysis chamber; the control system is respectively connected to the automatic liquid transfer device, the heating device and the power supply device, and a plurality of wire interfaces are arranged in the operation area, the three-way solenoid valve A is connected to the wire interface through a wire and then to the control system through a wire, and the two-way pump A is connected to the wire interface through a wire and then to the control system and the power supply device through a wire.

2. The microfluidic chip-based gene detection platform according to claim 1, characterized in that: A PCR amplification chamber is arranged at one end of the detection channel, and an amplification product analysis chamber is arranged at the other end, and a heating device is respectively arranged for the PCR amplification chamber and the amplification product analysis chamber in the operation area.

3. The gene detection platform based on microfluidic chip according to claim 1, characterized in that: The detection channel is provided with a sample processing chamber, a two-way pump B and a three-way solenoid valve B. Reagents for extracting nucleic acids and samples to be detected are added into the sample processing chamber through an automatic pipetting device, and nucleic acid extraction is performed in the sample processing chamber. The three-way solenoid valve B is respectively connected to the PCR amplification chamber and the waste liquid collection chamber, and is connected to the sample processing chamber through the two-way pump B.

4. The microfluidic chip-based gene detection platform according to claim 3, characterized in that: Magnetic beads are arranged in the sample processing chamber.

5. The microfluidic chip-based gene detection platform according to claim 1, characterized in that: A digital camera is arranged above the amplification product analysis chamber for taking pictures of the membrane chip in the amplification product analysis chamber and recording the detection results of the membrane chip.

6. The method for using the microfluidic chip-based gene detection platform according to any one of claims 1 to 5, characterized in that: The following steps are involved: (1) Add PCR amplification reagents, nucleic acid extraction reagents, and analysis reagents to the liquid storage boxes in the reagent placement area, respectively, place a membrane chip in the amplification product analysis chamber of the microfluidic chip, and place the microfluidic chip in the operation area, then power each device in the gene detection platform, and then manually add the sample to be tested to the sample processing chamber or PCR amplification chamber of the microfluidic chip; (2) The control system controls the automatic pipetting device to add the reagent for nucleic acid extraction from the reagent placement area to the sample processing chamber for processing, and then the control system controls the two-way pump B and the three-way solenoid valve B to transport the solution in the sample processing chamber to the PCR amplification chamber to mix with the PCR amplification reagent, and then heats the PCR amplification chamber for amplification reaction; Alternatively, the control system controls the automatic liquid transfer device to add the PCR amplification reagent from the reagent placement area into the PCR amplification chamber for mixing, and then heats the PCR amplification chamber for amplification reaction; (3) The control system controls the two-way pump A and the three-way solenoid valve A to transport the solution in the PCR amplification chamber to the amplification product analysis chamber. Then, the control system controls the automatic liquid transfer device to add the corresponding analysis reagent from the reagent placement area to the amplification product analysis chamber, and heats the amplification product analysis chamber to 35-75°C for hybridization reaction. After the treatment is completed, the control system controls the two-way pump A and the three-way solenoid valve A to transport the solution in the amplification product analysis chamber to the waste liquid collection chamber. (4) The control system controls the automatic pipetting device to add the corresponding analytical reagents from the reagent placement area to the amplification product analysis chamber for color development reaction, so that the color development results are displayed on the membrane chip, and the results are directly interpreted or automatically photographed by a digital camera and transmitted to the control system for automatic interpretation according to preset standards.

7. The method of use according to claim 6, characterized in that: The reagents for extracting nucleic acid include proteinase K, TE buffer for eluting nucleic acid from magnetic beads, ethanol for dissolving and removing non-nucleic acid impurities, Tris-HCl buffer for maintaining pH stability, sodium dodecyl sulfate, sodium chloride, EDTA, and isopropanol.

8. The use of the microfluidic chip-based gene detection platform according to any one of claims 1 to 5 in detecting thalassemia genes, characterized in that: When the gene detection platform is used to detect thalassemia genes, the sample solution to be tested includes anticoagulated peripheral blood, DBS samples and / or samples treated similarly to DBS, chorionic villi, amniotic fluid, umbilical cord blood, peripheral blood, saliva, embryonic genetic material, blastomeres of cleavage-stage embryos, and trophectoderm cells of blastocysts; the PCR amplification reagent includes MightyAmp Taq, 2×MightyAmp Buffer, a primer set, and 10×Additive for High Specificity, and the primer set includes the following primers: Primer 1F: GTCATCACTTAGACCTCACCCTGT, Primer 1R: AAAAGAAGGGGAAAGAAAACAT, Primer 2F: TAATCTCTTTCTTTCAGGGCAATAA, Primer 2R: TATTAGGCAGAATCCAGATGCTCA, Primer A2F: ACCTCCCCGCCGAGTTCA, Primer A2R / A2-R: AGGAAGGGCCGGTGCAAG, Primer 3.7F / A2-F: CCCCTGTCCTTTCCCTACCC, Primer 3.7R: GGAGTGGGACTTCTCTGACCTACC, Primer 4.2F: TGCTTTTGTGAGTGCTGTGTTGAC, Primer 4.2R: GCGGAGTTTCGCTGTTGTTTTC, Primer SEA-F: CCTTCACCCTCCCACAGTTCC, Primer SEA-R: CGTCACCCTCAGAGCCATCAC, Primer THAI-F: CACCCATGGGAGAGAGGAGC, Primer THAI-R: TCACCACCACCTGTGTAGGAGTG; The analytical reagents include a 10% SDS solution, a 20× SSC solution, a 1M sodium citrate solution, a hybridization solution I, a hybridization solution II, a hybridization solution III, a horseradish peroxidase with a concentration of 0.005-1 U / mL, a color developing solution, water, and silicone oil, wherein the 10% SDS solution is prepared by dissolving 20 g of SDS in 180 mL of pure water, adjusting the pH value to 7.0 with 1N HCl, and finally settling the volume to 200 mL; the 20× SSC solution is prepared by dissolving 175.3 g of NaCl and 88.2 g of sodium citrate in 750 mL of pure water, adjusting the pH value to pH 7.0 with concentrated hydrochloric acid, and finally settling the volume to 1000 mL and sterilizing by high pressure; the 1M sodium citrate solution is prepared by dissolving 294 g of sodium citrate in 700 mL of pure water, adjusting the pH value to pH 7.0 with concentrated hydrochloric acid, and finally settling the volume to 1000 mL and sterilizing by high pressure. mL was dissolved, pH was adjusted to 5.0 with concentrated HCl, and finally the volume was adjusted to 1000 mL; hybridization solution I contained 1-6× SSC and 0.1%-1% SDS; hybridization solution II contained 0.1-1× SSC and 0.1%-1% SDS; hybridization solution III was made by taking 100 mL of 1M sodium citrate solution and adding pure water to make the volume to 1000 mL; the color developing solution was made by taking 19 mL of hybridization solution III, adding 1 mL TMB and 2 μL 30% hydrogen peroxide; The membrane chip includes a membrane chip A for detecting β-thalassemia gene, a membrane chip B for detecting non-deletion type α-thalassemia gene, and a membrane chip C for detecting deletion type α-thalassemia gene; The membrane chip A has the following probes fixed on it: Probe-28N: ACTTTTATGCCCAGCCCT, Probe-32M: GGGCTGGGAATAAAAGTCAG, Probe-30M:TGACTTTTGTGCCCAGCC, Probe-29M: TGACTTTCATGCCCAGCC, Probe-28M:CCCTGACTTCTATGCCCA, Probe Cap+40-43M: AGCAACCTCAGACACCATG, Probe Int M: CAGACACCAGGGTGCATC, Probe CD17N: GTTCACCTTGCCCCACAG, Probe CD14-15M: TCACCTTGCCCCACCAG, Probe CD17M: TGTGGGGCTAGGTGAACG, Probe CD26 (βE) N: CCCAGGGCCTCACCAC, Probe CD26 (βE) M: GTTGGTGGTAAGGCCCTG, Probe CD27-28M: GTGGTGAGGCCCCTGG, Probe IVS-I-1N: TGATACCAACCTGCCCAG, Probe IVS-I-1M: CCCTGGGCAGATTGGTATC, Probe IVS-I-5M: GGCAGGTTGCTATCAAGGTTA, Probe CD31N: CCTTAGGCTGCTGGTGGT, Probe CD31M: CCCTTAGGTGCTGGTGG, Probe CD41-42N: ACCCAGAGGTTCTTTGAGTC, Probe CD41-42M: ACCCAGAGGTTGAGTCCTTT, Probe CD43M: AGAGGTTCTTTTAGTCCTTTGG, Probe CD71-72N: GCTCGGTGCCTTTAGTGA, Probe CD71-72M: TGCCTTTAAGTGATGGCCT, Probe IVS-II-654N: TTGCTATTGCCTTAACCCAG, Probe IVS-II-654M: TATTGCTATTACCTTAACCCAG, Probe IVS-II-5N: TCAGGGTGAGTCTATGGGA, Probe IVS-II-5M: TCCCATAGAGTCACCCTGA, Probe CD37M: TCTACCCTTAGACCCAGAGG, Probe CC: CACATCACACACTCTGCGAC; The following probes are fixed on the membrane chip B: Probe WSN: GGGAGGCGTGCACCGCA, Probe QSN: GAACTTGTCCAGGGAGGC, Probe CSN: GGCTCCAGCTTAACGGTATTT, Probe WSM: GGAGGCCTGCACCGCAG, Probe QSM: GCCTCCCGGACAAGTTC, Probe CSM: CCAAATACCGTCAAGCTGGA, Probe AC: CTCGGTAGCCGTTCCTCCTG, Probe NC: ACACCAACCGCATCGTCAT, Probe CC: CACATCACACACTCTGCGAC; The following probes are fixed on the membrane chip C: Probe 3.7: CATGTGTGTCCCAGCTGC, Probe 4.2: GGGTTGGAAGTGCTGCTCAT, Probe SEA: CCAGCCTCCAAGTGAACCT, Probe THAI: CTGAGCCCTTGAGCCGC, Probe A2: CTCGGTAGCCGTTCCTCCTG, Probe NC: ACACCAACCGCATCGTCAT, Probe CC: CACATCACACACTCTGCGAC.

9. The use according to claim 8, characterized in that: The method for preparing the membrane chip comprises the following steps: S1. Prepare the probe configuration to obtain a working solution with a concentration of 10 μM; S2. Take the nylon membrane and soak it in a 10% EDAC solution for activation treatment for 30 minutes. Then take out the nylon membrane, wash it with pure water and dry it at room temperature. Drop the working solution on the nylon membrane in a dot matrix array, each drop is 0.5μL, and then place the nylon membrane at room temperature for reaction for 20 to 60 minutes, and then immerse it in a 0.1mol / L sodium hydroxide solution to stop the reaction. Then wash the nylon membrane with pure water 3 times, each washing time is 1 minute, and finally dry it to obtain a membrane chip for detection.

10. A thalassemia detection kit, characterized in that: The thalassemia detection kit comprises the PCR amplification reagent, analysis reagent, membrane chip described in claim 8 and / or the nucleic acid extraction reagent described in claim 7.