Pasture Sanjohnella pastoris, biological agent and application of biological agent in tobacco leaf fermentation

By using the forage yeast Sampayo's yeast tobacco degrades cellulose during the fermentation of tobacco leaves, the problems of insufficient fermentation and limited improvement of tobacco leaves in the prior art are solved, and more efficient fermentation and better tobacco leaves are achieved.

CN120210018APending Publication Date: 2025-06-27CHINA TOBACCO SICHUAN IND CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510477606.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-16
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

Existing microbial strains are difficult to effectively decompose cellulose during the tobacco leaf fermentation process, resulting in insufficient fermentation and limited effect on improving the quality of tobacco leaf.

Method used

Sampaiozyma iningeniosa is used, which can degrade cellulose in tobacco leaves, improve fermentation efficiency, and increase the content of chlorophyll, carotenoids, Maillard reaction products and terpenes in tobacco leaves.

Benefits of technology

It significantly improves the woody, burnt and baking fragrance of tobacco leaves, reduces irritation and miscellaneous air, and improves the comprehensive quality of tobacco leaves.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210018A_ABST
    Figure CN120210018A_ABST
Patent Text Reader

Abstract

The invention provides pasture Sanjohnsonia pastoris, a biological agent and application of the biological agent in tobacco leaf fermentation. The pasture Sanjohnella yeast is preserved in China General Microbiological Culture Collection Center (CGMCC) on September 12, 2024, the address is No.3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the preservation number is CGMCC No. 31956. The strain can degrade cellulose in tobacco leaves in the fermentation process, so that fermentation is more sufficient, and the fermentation efficiency is improved; meanwhile, the bacterial strain can increase the content of chlorophyll degradation products, carotenoid degradation products, Maillard reaction products and terpenoids in the tobacco leaves, so that the costustoot, sweet aroma and baking aroma are remarkably improved, the irritation and offensive odor are reduced, and the comprehensive quality of the tobacco leaves is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the technical field of tobacco fermentation, and particularly to a Sampaiozyma ingeniosa, a biological preparation and their application in tobacco leaf fermentation. Background Art

[0002] Cigars are a common type of tobacco product, and the fermentation process of tobacco leaves has an important impact on their taste and quality. The fermentation of tobacco leaves refers to the accelerated aging of the tobacco leaves after modulation under artificial intervention, while improving the smoking quality and processing performance of tobacco products. Through fermentation, the raw green color in the tobacco leaves is reduced or even eliminated, the color turns darker and the color becomes more uniform; at the same time, the offensive odor and green miscellaneous odor during burning of the fermented tobacco leaves are significantly reduced, and the pleasant tobacco fragrance is revealed; in addition, fermentation can also enhance the softness and elasticity of tobacco leaves, reduce their brittleness, and improve the resistance to mold infection.

[0003] With the development of microbial technology, using microbial strains with excellent characteristics to regulate the fermentation process has gradually become a research hotspot. Different microorganisms can produce unique enzyme systems and metabolites during metabolism, thereby specifically transforming and modifying the chemical components of tobacco leaves.

[0004] The existing microbial strains currently have very limited comprehensive effects on fermentation efficiency, flavor substance generation, and improvement of tobacco leaf quality. Therefore, it is necessary to explore new microbial strains that can be used for cigar tobacco leaf fermentation. Summary of the Invention

[0005] Based on this, one or more embodiments of the present application provide a Sampaiozyma ingeniosa, a biological preparation and their application in tobacco leaf fermentation that can improve the fermentation efficiency and quality of fermented tobacco leaves.

[0006] According to the first aspect of the embodiments of the present application, a Sampaiozyma ingeniosa is provided. The Sampaiozyma ingeniosa was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on September 12, 2024, at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 31956.

[0007] According to the second aspect of the embodiments of the present application, a biological preparation is provided, including one or more of the above-mentioned Sampaiozyma ingeniosa, the culture of the above-mentioned Sampaiozyma ingeniosa, the lysate of the above-mentioned Sampaiozyma ingeniosa, and the extract of the above-mentioned Sampaiozyma ingeniosa.

[0008] According to the third aspect of the embodiments of the present application, a method for fermenting tobacco leaves is provided, including the following steps:

[0009] Ferment the tobacco leaves with the above-mentioned Saccharomyces pampayensis of forage or the above-mentioned biological agent;

[0010] Optionally, the tobacco leaves include cigar tobacco leaves.

[0011] In some embodiments, the temperature of the fermentation treatment is 30°C to 35°C; and / or,

[0012] The relative humidity of the fermentation treatment is 70% to 75%; and / or,

[0013] The time of the fermentation treatment is 20 days to 30 days.

[0014] In some embodiments, the fermentation treatment includes the following steps:

[0015] Perform proliferation culture on the Saccharomyces pampayensis of forage to prepare a bacterial liquid; and

[0016] Mix the bacterial liquid and the tobacco leaves and perform fermentation treatment.

[0017] In some embodiments, the conditions for the proliferation culture include: culturing at 28°C to 30°C and 150 rpm to 220 rpm for 1 day to 2 days.

[0018] In some embodiments, the concentration of the Saccharomyces pampayensis of forage in the bacterial liquid is 10 6 ~10 8 CFU / mL.

[0019] In some embodiments, the mass ratio of the bacterial liquid to the tobacco leaves is (10 to 20):100.

[0020] According to the fourth aspect of the embodiments of the present application, there is provided a fermented tobacco leaf prepared by the above-mentioned fermentation method.

[0021] According to the fifth aspect of the embodiments of the present application, there is provided a method for preparing a cigarette product, and the preparation method includes the following steps:

[0022] Prepare fermented tobacco leaves by the above-mentioned preparation method; and,

[0023] Prepare a cigarette product using the fermented tobacco leaves.

[0024] Compared with the traditional technology, the present application has the following beneficial effects:

[0025] The present application provides a strain of forage yeast Sampaiozyma ingeniosa, which can degrade cellulose in tobacco leaves during the fermentation process, making the fermentation more complete and improving the fermentation efficiency. At the same time, this strain can increase the contents of chlorophyll degradation products, carotenoid degradation products, Maillard reaction products and terpenoids in tobacco leaves, thus significantly enhancing the woody, caramel and baking aromas, reducing irritation and off-flavors, and further improving the overall quality of tobacco leaves. Description of the Drawings

[0026] In order to more clearly illustrate the technical solutions of the specific embodiments of the present application, the drawings required for use in the description of the specific embodiments will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings.

[0027] Figure 1 It is a comparison chart of the cigar quality characteristics of Example 1 and Comparative Example 1 of the present application;

[0028] Figure 2 It is a comparison chart of the cigar aroma characteristics of Example 1 and Comparative Example 1 of the present application.

[0029] The forage yeast Sampaiozyma ingeniosa provided by the present application was deposited on September 12, 2024 at the General Microbiology Center of the China Microbial Culture Collection Center, located at No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 31956. The strain was received and registered by the deposit center on September 12, 2024, and was detected as a viable strain by the deposit center on September 12, 2024. Detailed Embodiments

[0030] In order to make the above objects, features and advantages of the present application more obvious and understandable, the specific embodiments of the present application will be described in detail. Many specific details are set forth in the following description in order to fully understand the present application. However, the present application can be implemented in many other ways different from those described herein. Those skilled in the art can make similar improvements without departing from the connotation of the present application. Therefore, the present application is not limited by the specific embodiments disclosed below.

[0031] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. The terms used in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application. Unless otherwise specifically stated, various raw materials, reagents, instruments, equipment, etc. used in this application can be obtained through the market or prepared by existing methods.

[0032] As used herein, the alternative terms "and / or", "or / and", and "and / or" cover any one of two or more of the related listed items, as well as any and all combinations of the related listed items. The said any and all combinations include combinations of any two of the related listed items, any more of the related listed items, or all of the related listed items. It should be noted that when at least two conjunctions selected from "and / or", "or / and", and "and / or" are used to connect at least three items, it should be understood that in this application, this technical solution undoubtedly includes the technical solution connected by "logical AND", and also undoubtedly includes the technical solution connected by "logical OR". For example, "A and / or B" includes three parallel solutions: A, B, and A + B. Another example, the technical solution of "A, and / or, B, and / or, C, and / or, D" includes any one of A, B, C, and D (that is, the technical solution connected by "logical OR"), and also includes any and all combinations of A, B, C, and D, that is, it includes combinations of any two or any three of A, B, C, and D, and also includes the combination of the four items A, B, C, and D (that is, the technical solution connected by "logical AND").

[0033] In this application, the terms "a plurality of", "a variety of", "multiple times", "multiple elements", etc., unless otherwise specifically defined, refer to a quantity greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0034] As used herein, "its combination", "any combination thereof", "any combination mode thereof", etc. include all suitable combination modes of any two or more of the listed items.

[0035] In this application, the "suitable" in "suitable combination mode", "suitable mode", "any suitable mode", etc. is subject to being able to implement the technical solution of this application, solve the technical problems of this application, and achieve the expected technical effects of this application.

[0036] In this application, "preferred", "better", "more preferable", "it is advisable" are only used to describe embodiments or examples with better effects, and it should be understood that they do not constitute a limitation on the protection scope of this application.

[0037] In this application, terms such as "further", "even further", "especially", etc. are used for descriptive purposes, indicating differences in content, but should not be construed as limiting the scope of protection of this application.

[0038] In this application, "optionally", "optional", "option" mean optional, that is, it refers to either of the two alternative options of "yes" or "no". If "optional" appears multiple times in a technical solution, without special instructions and without contradictions or mutual restrictions, each "optional" is independent.

[0039] In this application, for the technical features described in an open-ended manner, it includes a closed-ended technical solution composed of the listed features, as well as an open-ended technical solution including the listed features.

[0040] In this application, regarding numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical values are considered continuous within the above numerical intervals, and include the two numerical endpoints of the numerical range (i.e., the minimum value and the maximum value), as well as each numerical value between these two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to integers within the numerical interval, it includes the two endpoint integers of the numerical range, as well as each integer between the two endpoints. In this article, it is equivalent to directly listing each integer. For example, t is an integer selected from 1 to 10, which means t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges subsumed therein.

[0041] The temperature parameter in this application, unless otherwise specifically limited, allows both constant temperature treatment and variation within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuation within ranges such as ±5°C, ±4°C, ±3°C, ±2°C, ±1°C is allowed.

[0042] In this application, %(w / w) and wt% both represent weight percentage, %(v / v) refers to volume percentage, and %(w / v) refers to mass-volume percentage.

[0043] During the fermentation process of cigar tobacco leaves, traditional microbial fermentation methods often cannot effectively decompose the cellulose in the tobacco leaves, resulting in insufficient fermentation.

[0044] Based on this, in the first aspect of the embodiments of the present application, a kind of Sampaiozyma ingeniosa for forage grass is provided. This Sampaiozyma ingeniosa for forage grass was deposited on September 12, 2024 at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms, with the address being No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number being CGMCC No. 31956.

[0045] Sampaiozyma ingeniosa for forage grass belongs to the phylum Basidiomycota, class Microbotryomycetes, and is a facultative aerobe. The optimal growth temperature is 2°C to 30°C. The colony morphology of the above-mentioned Sampaiozyma ingeniosa for forage grass is round, white, convex, and has a neat edge.

[0046] Sampaiozyma ingeniosa for forage grass generally exists in plant leaves and plays a role in decomposing plant residues in nature. It has a strong ability to decompose plant fibers and chlorophyll and has potential application value in the fields of biodegradation and biotransformation.

[0047] When the above-mentioned Sampaiozyma ingeniosa for forage grass screened in the present application is applied to the fermentation of cigar tobacco leaves, it can degrade cellulose and improve the fermentation efficiency; at the same time, it can increase the contents of chlorophyll degradation products (such as neophytadiene, phytol), Maillard reaction products (such as 5-methyl-2-furanmethanol, 2-ethyl-5-methylfuran), carotenoid degradation products (dehydrovomifoliol, 4,7,9-germacratriene-3-one, nerolidol), and terpenoids (such as caryophyllene, cedrene diol, viridiflorol, isopulegol acetate, δ-elemene), significantly enhancing the woody, caramel, and baking aromas, reducing irritation and off-flavors, and thus improving the usability of tobacco leaves.

[0048] In the second aspect of the embodiments of the present application, a biological preparation is provided, including one or more of the above-mentioned Sampaiozyma ingeniosa for forage grass, the culture of the above-mentioned Sampaiozyma ingeniosa for forage grass, the lysate of the above-mentioned Sampaiozyma ingeniosa for forage grass, and the extract of the above-mentioned Sampaiozyma ingeniosa for forage grass.

[0049] In the third aspect of the embodiments of the present application, a method for fermenting tobacco leaves is provided, including the following steps:

[0050] Fermenting the tobacco leaves with the Sampaiozyma ingeniosa for forage grass in the first aspect above or the biological preparation in the second aspect above.

[0051] In some of the embodiments, the tobacco leaves include cigar tobacco leaves.

[0052] Furthermore, the tobacco leaves include one or more different varieties of cigar tobacco leaves or leaf fragments.

[0053] In some of the embodiments, fermenting the tobacco leaves with Sampaiozyma ingeniosa for forage grass includes the following steps:

[0054] S100: Perform proliferation culture on Pichia pastoris of forage grass, and prepare a bacterial solution; and

[0055] S200: Mix the bacterial solution and tobacco leaves and perform fermentation treatment.

[0056] In some embodiments, in S100, the conditions for proliferation culture include: culturing at 28°C to 30°C and 150 rpm to 220 rpm for 1 day to 2 days.

[0057] As an example, the temperature for proliferation culture can be 28°C, 28.5°C, 29°C, 29.5°C, 30°C, or any value within the range formed by any two of the above point values; the rotation speed for proliferation culture can be 150 rpm, 155 rpm, 160 rpm, 165 rpm, 170 rpm, 175 rpm, 180 rpm, 185 rpm, 190 rpm, 195 rpm, 200 rpm, 205 rpm, 210 rpm, 215 rpm, 220 rpm, or any value within the range formed by any two of the above point values; the time for proliferation culture can be 1.0 day, 1.2 days, 1.4 days, 1.6 days, 1.8 days, 2.0 days, or any value within the range formed by any two of the above point values.

[0058] In some embodiments, before the proliferation culture, it further includes the step of performing activation culture on Pichia pastoris of forage grass.

[0059] In some embodiments, the conditions for activation culture include: culturing at 28°C to 30°C for 40 h to 48 h.

[0060] As an example, the temperature for activation culture can be 28°C, 28.5°C, 29°C, 29.5°C, 30°C, or any value within the range formed by any two of the above point values; the time for activation culture can be 40 h, 41 h, 42 h, 43 h, 44 h, 45 h, 46 h, 47 h, 48 h, or any value within the range formed by any two of the above point values.

[0061] Furthermore, the conditions for activation culture include: culturing at 28°C for 48 h.

[0062] In some embodiments, the culture medium used for proliferation culture is yeast extract peptone dextrose medium.

[0063] Furthermore, the yeast extract peptone dextrose medium includes peptone, yeast powder, dextrose, and distilled water.

[0064] Still further, the yeast extract peptone dextrose medium includes 2% (w / v) peptone, 1% (w / v) yeast powder, 2% (w / v) dextrose, and distilled water.

[0065] Further, the pH value of the yeast extract peptone dextrose medium is 5.5 to 7.0. As an example, the pH value of the yeast extract peptone dextrose medium can be 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7.0, or any value within the range formed by any two of the above point values.

[0066] In some of these embodiments, in S100, the concentration of Pichia pastoris in the bacterial liquid is 10 6 ~10 8 CFU / mL. As an example, the concentration of Pichia pastoris in the bacterial liquid can be 10 6 CFU / mL, 2×10 6 CFU / mL, 3×10 6 CFU / mL, 4×10 6 CFU / mL, 5×10 6 CFU / mL, 6×10 6 CFU / mL, 7×10 6 CFU / mL, 8×10 6 CFU / mL, 9×10 6 CFU / mL, 10 7 CFU / mL, 2×10 7 CFU / mL, 3×10 7 CFU / mL, 4×10 7 CFU / mL, 5×10 7 CFU / mL, 6×10 7 CFU / mL, 7×10 7 CFU / mL, 8×10 7 CFU / mL, 9×10 7 CFU / mL, 10 8 CFU / mL, or any value within the range formed by any two of the above point values.

[0067] In some of these embodiments, in S100, after culturing Pichia pastoris, the following steps are further included: diluting the culture product. Optionally, the dilution factor is 5 to 50 times. It should be noted that as long as the concentration of the bacterial liquid obtained after dilution is 10 6 ~10 8 CFU / mL.

[0068] In some of these embodiments, in S200, the mass ratio of the bacterial liquid to the tobacco leaves is (10~20):100.

[0069] As an example, the mass ratio of the bacterial liquid to the tobacco leaves can be 10:100, 11:100, 12:100, 13:100, 14:100, 15:100, 16:100, 17:100, 18:100, 19:100, 20:100, or any value within the range formed by any two of the above point values.

[0070] Furthermore, the mass ratio of the bacterial liquid to the tobacco leaves is 15:100.

[0071] In some of the embodiments, in S200, the way of mixing the bacterial liquid with the tobacco leaves is: spraying the bacterial liquid onto the surface of the tobacco leaves.

[0072] In some of the embodiments, the temperature of the fermentation treatment is 30°C to 35°C. As an example, the temperature of the fermentation treatment can be 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, or any value within the range formed by any two of the above point values.

[0073] In some of the embodiments, the relative humidity of the fermentation treatment is 70% to 75%. As an example, the relative humidity of the fermentation treatment can be 70%, 71%, 72%, 73%, 74%, 75%, or any value within the range formed by any two of the above point values.

[0074] In some of the embodiments, the time of the fermentation treatment is 20 days to 30 days. As an example, the time of the fermentation treatment can be 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days, 30 days, or any value within the range formed by any two of the above point values.

[0075] In the fourth aspect of the implementation manner of the present application, a fermented tobacco leaf is provided, which is prepared by using the above fermentation method.

[0076] For the fermented tobacco leaf prepared by using the above fermentation method, the costus root fragrance, caramel-like sweet fragrance, and baking fragrance are significantly improved, the irritation and off-odor are reduced, and it has good quality and odor characteristics.

[0077] In the fifth aspect of the implementation manner of the present application, a preparation method of a cigarette product is provided, including the following steps:

[0078] Preparing fermented tobacco leaves by using the above preparation method;

[0079] Preparing a cigarette product by using the above fermented tobacco leaves.

[0080] The present application will be further described below in conjunction with specific examples and comparative examples, but it should not be construed as a limitation on the protection scope of the present application. The raw materials involved in the following specific examples, unless otherwise specified, can all be obtained commercially. The instruments used, unless otherwise specified, can all be obtained commercially. The processes involved, unless otherwise specified, are all conventional selections of those skilled in the art.

[0081] Example 1

[0082] An embodiment of the present application provides a strain of forage grass Saccharomyces sampaiozyma, which was deposited on September 12, 2024, at the General Microbiology Center of the China Microbial Culture Collection Center, located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number CGMCC No. 31956.

[0083] The ITS species identification sequence of the above strain is shown as SEQ ID NO:1.

[0084] SEQ ID NO:1

[0085] GCCTGCGGAAGGATCATTAGTGAATTTAGCGCATCTGCTTTGCAGAGCGTGACCTCCACTTTCTAACTCTGTGCACTTAATGGCGGAAGAGATGAAATATGCTCTTCTGCGGCTCATTTTATAACACTAGTTAAAGAATGTAACGAAATATCGAAACAAAAAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGTGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGTCTGTTTGAGTGTCATGAACTCTTCAACCCACCGGTTTCTTGTAAACTGGCTGGTGTTTGGTTTCTGAGTGTTGCTCGTCCTTGTGACTGAGCTCATTCGTAATATATGAGCATCTCTAATTCGAATTCGGATTGACTCAGTGTAATAGACTATTCGCTGAGGACACACCTAGTGTGGCCGAATAAGATAATTGTAGAAGCTTCTAACCCTTCTAGTCATTTTAAGATTAGACCTCAGATCAGATAGGACTACCCGCTGAACTTAAGCATATCAAAGC。

[0086] (1)Strain culture: Inoculate the Saccharomyces pastoris of Morus alba L. preserved on the slant into the yeast extract peptone dextrose agar medium and activate it at 28°C for 48 h; pick a single colony after activation culture and inoculate it into the yeast extract peptone dextrose liquid medium for fermentation culture. The culture temperature is 28°C, the rotation speed is 200 rpm, and the culture is carried out for 2 days to obtain the fermentation broth.

[0087] The formula of the agar medium includes: peptone 10 g, yeast powder 5.0 g, dextrose 1.0 g, agar 15.0 g, distilled water 1000 mL, and the pH value is 6.8 - 7.0.

[0088] The formula of the yeast extract peptone dextrose medium includes: peptone 20 g, yeast powder 10 g, dextrose 20 g, and distilled water 1000 mL, and the pH value is 6.8 - 7.0; after measuring each substance according to the above formula, mix them evenly and put them into a triangular flask (the liquid loading volume accounts for about 20% of the volume of the triangular flask).

[0089] (2)Bacterial suspension preparation: Dilute the fermentation broth with sterile water to make the concentration of the diluted bacteria 10 6 CFU / mL to obtain the bacterial suspension.

[0090] (3)Fermentation of cigar tobacco leaves: Inoculate the bacterial suspension prepared in step (2) above onto the surface of the rehydrated cigar tobacco leaves at a mass ratio of 15%; put the inoculated tobacco leaves into a burlap bag and place them in a fermentation room for fermentation. The fermentation temperature is 35°C, the relative humidity is 75%, and the fermentation time is 20 days.

[0091] (4)Place the fermented cigar tobacco leaf samples in an oven at 45°C for drying, pulverize them, and pass them through a 0.25-mm sieve. Then, use gas chromatography-mass spectrometry (GC-MS) to determine the content of aroma components and use a flow analyzer to detect the content of chemical components.

[0092] (5)Roll the fermented tobacco leaf samples into single-flavor cigarettes with a length of 110 mm and a diameter of 14 mm, cure them in a Binder constant temperature and humidity box at a temperature of 18°C and a relative humidity of 65% for 1 month for sensory evaluation, and organize a sensory quality evaluation expert group to conduct sensory quality evaluation.

[0093] Refer to the product technical standard of Great Wall Cigar Factory, "Style Characteristics and Quality Sensory Evaluation Method of Chinese Cigar 'Mellow Sweet Aroma'" QJ / 08.J.6005-2020 A for the sensory quality evaluation standard.

[0094] Comparative Example 1

[0095] (1)Fermentation of cigar tobacco leaves: Inoculate pure water onto the surface of the rehydrated cigar tobacco leaves at a mass ratio of 15%; put the inoculated tobacco leaves into a burlap bag and place them in a fermentation room for fermentation. The fermentation temperature is 35°C, the relative humidity is 75%, and the fermentation time is 20 days.

[0096] (2)Place the fermented cigar tobacco leaf samples in an oven at 45°C for drying, pulverize them, and pass them through a 0.25-mm sieve. Then, use gas chromatography-mass spectrometry (GC-MS) to determine the content of aroma components.

[0097] (3)Roll the fermented tobacco leaf samples into single-flavor cigarettes with a length of 110 mm and a diameter of 14 mm, cure them in a Binder constant temperature and humidity box at a temperature of 18°C and a relative humidity of 65% for 1 month for sensory evaluation, and organize a sensory quality evaluation expert group to conduct sensory quality evaluation.

[0098] The detection results of the chemical components in the fermented cigar tobacco leaves in Example 1 and Comparative Example 1 are shown in Table 1.

[0099] Table 1

[0100]

[0101] As can be seen from the above table, fermenting cigar tobacco leaves with the Pichia pastoris of the present application can effectively reduce the contents of total sugar, total alkaloid, total nitrogen, and the proportion of cellulose in the tobacco leaves; by degrading cellulose in the tobacco leaves, the fermentation can be more sufficient and the fermentation efficiency can be improved.

[0102] The results of the aroma component contents after the fermentation of cigar tobacco leaves in Example 1 and Comparative Example 1 are shown in Table 2.

[0103] Table 2

[0104]

[0105]

[0106] The sensory quality scoring results of the above examples and comparative examples are shown in Table 3 and Table 4. Figure 1 It is a comparison chart of the cigar quality characteristics of Example 1 and Comparative Example 1; Figure 2 It is a comparison chart of the aroma characteristics of Example 1 and Comparative Example 1.

[0107] Table 3 Scoring Results of Cigar Quality Characteristics

[0108]

[0109] Table 4 Scoring Results of Cigar Aroma Characteristics

[0110]

[0111] As can be seen from the above table, compared with Comparative Example 1, using the Pichia pastoris of the present application can degrade cellulose and increase the contents of chlorophyll degradation products (such as neophytadiene and phytol), Maillard reaction products (such as 5-methyl-2-furanmethanol and 2-ethyl-5-methylfuran), carotenoid degradation products (such as dehydrololiolide, 4,7,9-germacratriene-3-one, and nerolidol), and terpene substances (such as caryophyllene, cedrenediol, viridiflorol, isopulegol acetate, and δ-elemene) and other aroma substances in cigar tobacco leaves. The smoking evaluation results also show that the yeast-enhanced group can significantly improve the woody aroma, caramel-like sweet aroma, and baking aroma, reduce irritation and off-flavors, thereby improving the usability of the tobacco leaves.

[0112] The technical features of the above-described embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as the scope described in this specification.

[0113] The above-described embodiments merely represent several implementation manners of the present application. The description thereof is relatively specific and detailed, but it should not be construed as a limitation to the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all fall within the protection scope of the present application. Therefore, the protection scope of the present application shall be subject to the appended claims.

Claims

1. A forage Sampaiozyma ingeniosa, characterized in that The forage sampayo yeast was deposited in the General Microbiology Center of the China Microorganism Culture Collection Administration on September 12, 2024, with the address being No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with the deposit number being CGMCC No. 31956.

2. A biological agent, characterized in that: The invention comprises one or more of the forage S. sampayosaccharomyces according to claim 1, the culture of the forage S. sampayosaccharomyces according to claim 1, the lysate of the forage S. sampayosaccharomyces according to claim 1 and the extract of the forage S. sampayosaccharomyces according to claim 1.

3. A tobacco leaf fermentation method, characterized in that: The steps include: Fermenting tobacco leaves with the forage yeast S. sampayolis of claim 1 or the biological preparation of claim 2; Optionally, the tobacco leaves include cigar tobacco leaves.

4. The tobacco leaf fermentation method according to claim 3, characterized in that: The fermentation temperature is 30°C to 35°C; and / or, The relative humidity of the fermentation process is 70% to 75%; and / or, The fermentation time is 20 to 30 days.

5. The tobacco leaf fermentation method according to claim 3, characterized in that: The fermentation process includes the following steps: Proliferating and culturing the forage yeast S. sampayolis to prepare a bacterial liquid; and The bacterial liquid and tobacco leaves are mixed and fermented.

6. The tobacco leaf fermentation method according to claim 5, characterized in that: The conditions for proliferation culture include: culturing at 28°C to 30°C and 150rpm to 220rpm for 1 to 2 days.

7. The tobacco leaf fermentation method according to claim 5, characterized in that: The concentration of the forage yeast S. sampayo in the bacterial solution is 10 6 ~10 8 Pieces / mL.

8. The tobacco leaf fermentation method according to any one of claims 5 to 7, characterized in that: The mass ratio of the bacterial liquid to the tobacco leaves is (10-20):

100.

9. A fermented tobacco leaf, characterized in that: The method is prepared by the fermentation method according to any one of claims 3 to 8.

10. A method for preparing a cigarette product, characterized in that: The preparation method comprises the following steps: The method according to any one of claims 3 to 8 is used to prepare fermented tobacco leaves; and The fermented tobacco leaves are used to prepare cigarette products.