Alkaline xylanase mutant with improved specific activity

Abstract

The invention relates to the technical field of genetic engineering and protein engineering modification, in particular to an alkaline xylanase mutant with improved specific activity. Compared with a wild type, the specific activity of the xylanase mutant is improved by 32.83% and reaches 1574 U / mg, the production cost is reduced, and wide application of the xylanase mutant in the industrial field is promoted.

Description

Technical Field

[0001] The present invention relates to the technical fields of genetic engineering and protein engineering modification, and particularly relates to an alkaline xylanase mutant with improved specific activity. Background Art

[0002] Xylan is a poly-pentose and an important component of plant hemicellulose. It accounts for one-third of the total plant carbohydrates and is the second most abundant renewable biomass resource in nature after cellulose. It exists in the cell walls of plants and almost all parts.

[0003] Xylanase is a general term for a class of enzymes that can degrade xylan into oligosaccharides or xylose. The complete enzymatic hydrolysis of a xylan molecule requires several enzymatic reactions. There are two enzymes acting on the main chain: β-1,4-xylanase (1,4-β-D-xylanohydrolase: EC3.1.2.8) and β-xylosidase (1,4-β-D-xylanxylohydrolase: EC3.2.1.37). Generally speaking, the former acts on the xyloside bond inside the main chain and decomposes xylan into oligosaccharides, while the latter acts on the end of the xylo-oligosaccharide to release xylose.

[0004] Many microorganisms can produce xylanase. The biochemical properties of xylanase are mainly obtained from the research on bacterial and fungal xylanases. Xylanases produced by bacteria can be generally divided into two categories: high molecular weight acid-tolerant xylanases and low molecular weight alkali-tolerant xylanases. However, there is no such difference in fungi. Nevertheless, the alkali tolerance of low molecular weight xylanases is common.

[0005] Xylan in feed is difficult to be digested by monogastric animals itself. At the same time, it binds a large amount of water, increasing the volume and viscosity of the chyme in the digestive tract of the fed animals and reducing the action of nutrients and endogenous enzymes in the digestive tract, thus hindering the digestion and absorption of nutrients, especially fats and proteins, and reducing the utilization rate of feed. Research results show that if xylanase is added to feed, the molecular size of arabinoxylan can be significantly reduced, and it can be decomposed into xylo-oligosaccharides with a smaller degree of polymerization, thereby improving feed performance and eliminating or reducing the anti-nutritional effect caused by increased viscosity.

[0006] Xylanase can be used as a biological bleaching agent in the paper industry. The importance of xylanase in the paper and pulp industry lies in that it replaces toxic chemicals, and at the same time, useful by-products in this industry can be recovered through enzymatic pretreatment. Its bleaching effect lies in cutting the bond between lignin and sugar and relaxing the pulp structure. Scanning electron microscopy studies show that the porosity of the pulp pretreated with xylanase is increased on the pulp fibers, which helps its affinity with the bleaching compounds.

[0007] In the production of wine and Japanese barley shochu, research on the application of xylanase has been carried out. Japanese researchers applied the acid-resistant xylanase Xy1C to the brewing of Japanese barley shochu and found that this enzyme helps to improve the fermentation efficiency and increase the alcohol yield.

[0008] At present, a large number of studies have been carried out to modify the enzymatic properties of xylanase to adapt to different application scenarios, but the specific activity is also a key index restricting the application of xylanase. The higher the specific activity of xylanase itself, the lower its production cost, the lower the price of the enzyme, and it will be more conducive to promoting its wide application in industrial fields such as textile and paper-making. Summary of the Invention

[0009] The present invention provides an alkaline xylanase mutant with improved specific activity to solve the problems of the prior art. The specific activity of the mutant is significantly improved compared with that of the wild type, which is beneficial to its wide application in the industrial field.

[0010] On the one hand, the present invention relates to a xylanase mutant, which is obtained by mutating the 149th amino acid of xylanase with the amino acid sequence of SEQ ID NO:1 from Thr to Gln.

[0011] The present invention also relates to a DNA molecule encoding the above mutant.

[0012] The present invention also relates to a recombinant expression plasmid containing the above DNA molecule.

[0013] The present invention also relates to a host cell containing the above recombinant expression plasmid.

[0014] When the above plasmid is transferred into the host cell, the specific activity of the recombinantly expressed xylanase mutant is significantly improved.

[0015] In some embodiments of the present invention, the host cell is Pichia pastoris ( Pichia pastoris )

[0016] Based on the wild-type xylanase H1, the present invention provides a xylanase mutant containing a single-point mutation of T149Q, whose specific activity is increased by 32.83% and reaches 1574 U / mg, achieving an unexpected technical effect.

[0017] In summary, the specific activity of the alkaline xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost and promoting its wide application in industrial fields such as paper-making. Detailed Embodiments

[0018] The present invention uses conventional techniques and methods in the fields of genetic engineering and molecular biology, such as the methods described in MOLECΜLAR CLONING: A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN MOLECΜLAR BIOLOGY (Ausubel, 2003). These general references provide definitions and methods known to those skilled in the art. However, those skilled in the art can, based on the technical solutions described in the present invention, adopt other conventional methods, experimental protocols, and reagents in the art, without being limited to the specific embodiments of the present invention. For example, the following experimental materials and reagents can be selected for the present invention: Strains and vectors: Escherichia coli DH5α, Pichia pastoris GS115, vector pPIC9k, Amp, and G418 were purchased from Invitrogen.

[0019] Enzymes and kits: PCR enzymes and ligases were purchased from Takara, restriction endonucleases were purchased from Fermentas, plasmid extraction kits and gel purification and recovery kits were purchased from Omega, and the GeneMorph II random mutagenesis kit was purchased from Beijing Bomes Biotechnology Co., Ltd.

[0020] Medium formulations: BMGY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 1% glycerol; BMMY medium: 2% peptone, 1% yeast extract, 100 mM potassium phosphate buffer (pH 6.0), 1.34% YNB, 4×10 -5 % biotin, 0.5% methanol; LB-AMP medium: 0.5% yeast extract, 1% peptone, 1% NaCl, 100 μg / mL ampicillin, pH 7.0; LB-AMP plate: 0.5% yeast extract, 1% peptone, 1% NaCl, 1.5% agar, 100 μg / mL ampicillin, pH 7.0.

[0021] The present invention will be further described below in conjunction with examples: Example 1 Construction of expression plasmid Derived from Paecilomyces Paecilomyces. spThe xylanase gene ( ) was codon-optimized according to the codon preference of Pichia pastoris, and 6 bases GAATTC (EcoR I restriction site) were added before its start codon ATG, and GCGGCCGC (Not I restriction site) was added after its stop codon TAA. The optimized nucleotide sequence was synthesized by Shanghai Jierui Biotechnology Co., Ltd. The xylanase was named H1, its amino acid sequence was SEQ ID NO: 1, and the coding nucleotide sequence was SEQ ID NO: 2.

[0022] The xylanase gene was digested with restriction endonucleases EcoR I and Not I (Fermentas); meanwhile, the plasmid pPIC9K was digested with restriction endonucleases EcoR I and Not I. The digested products were purified using a gel purification kit, and the above two digested products were ligated with T4 DNA ligase (Fermentas). The ligation product was transformed into DH5α Escherichia coli (Invitrogen), and selection was carried out with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen).

[0023] The plasmid was purified from the Escherichia coli clone with correct sequencing results using a plasmid miniprep kit (Omega) to obtain 1 expression plasmid, which was named pPIC9K-PSL.

[0024] Example 2 Screening of High-Specific-Activity Xylanase Mutants In order to further improve the enzyme activity of xylanase H1, the applicant analyzed its protein structure. This protein is a G11 family xylanase with a β-jelly roll structure. The applicant screened a large number of mutations of this enzyme through directed evolution technology.

[0025] 1.1 Design PCR primers H1-F1, H1-R: H1-F1: GGC GAATTC ATGATGATTGGTATCACTTCTTTTGC (as shown in SEQ ID NO: 3, the underlined part is the recognition site of restriction endonuclease EcoRI); H1-R1: ATA GCGGCCGC TTAACCGACGTCTGCAACGGTAATTC (as shown in SEQ ID NO: 4, the underlined part is the recognition site of restriction endonuclease NotI).

[0026] Using the H1 gene (SEQ ID NO: 2) as a template, PCR amplification was performed with the above primers using the GeneMorph II Random Mutagenesis PCR Kit. The PCR products were recovered by gel electrophoresis, digested with EcoRI and NotI, and then ligated to the pET21a vector digested with the same enzymes. The ligation products were transformed into Escherichia coli BL21(DE3), and spread on LB-Amp plates. The plates were incubated at 37 °C in an inverted position. After the appearance of transformants, individual colonies were picked with toothpicks and transferred to 96-well plates. 150 μL of LB-Amp medium containing 0.1 mM IPTG was added to each well, and the plates were incubated at 37 °C and 220 rpm for about 6 h. The supernatant was discarded by centrifugation, and the cells were resuspended in buffer. The cells were lysed by repeated freezing and thawing to obtain an Escherichia coli cell lysate containing xylanase.

[0027] 30 μL of the lysate was taken out and transferred to two new 96-well plates respectively. 30 μL of substrate was added to one of the 96-well plates, and after reacting at 37 °C for 30 min, the reducing sugar produced was determined by the DNS method. 150 μL of Coomassie Brilliant Blue solution was added to the other plate, and after standing for 10 min, the protein content was determined by the Coomassie Brilliant Blue (Bradford) binding method. The enzyme activity levels and protein contents of different mutants were calculated respectively. Finally, the applicant screened out a single-point mutation site T149Q with significantly improved specific activity of xylanase from more than twenty thousand transformants.

[0028] Example 3 Expression of Xylanase in Pichia pastoris 3.1 Construction of Expression Plasmid According to the codon preference of Pichia pastoris, the gene sequences of xylanase H1 and its mutants were optimized respectively, synthesized by Shanghai Jierui Biotechnology Co., Ltd., and two restriction enzyme sites, EcoRI and NotI, were added to the 5' and 3' ends of the synthesized sequences respectively.

[0029] According to the method described in Example 1, the synthesized gene sequences of xylanase H1 and its mutants were digested with EcoRI and NotI double enzymes respectively, and then ligated overnight at 16 °C with the pPIC-9K vector digested with the same enzymes. The ligation products were transformed into Escherichia coli DH5α, and spread on LB-Amp plates. The plates were incubated at 37 °C in an inverted position. After the appearance of transformants, colony PCR was performed (reaction system: monoclonal colony picked as template, 0.5 μL of rTaq DNA polymerase, 2.0 μL of 10× Buffer, 2.0 μL of dNTPs (2.5 mM), 0.5 μL of 5'AOX primer (10 mM), 0.5 μL of 3'AOX primer, 14.5 μL of ddH2O; reaction program: pre-denaturation at 95 °C for 5 min, 30 cycles: 94 °C for 30 sec, 55 °C for 30 sec, 72 °C for 2 min, 72 °C for 10 min). Positive clones were verified, and the correct recombinant expression plasmids were obtained after sequencing verification.

[0030] 3.2 Construction of Pichia pastoris engineering strains 3.2.1 Preparation of yeast competent cells Activate the Pichia pastoris GS115 strain on a YPD plate and incubate at 30 °C for 48 h. Then inoculate the activated GS115 monoclonal into 6 mL of YPD liquid medium and culture at 30 °C, 220 rpm for about 12 h. Transfer the bacterial solution to a triangular flask containing 30 mL of YPD liquid medium and culture at 30 °C, 220 rpm for about 5 h. Detect the cell density with an ultraviolet spectrophotometer. After the OD600 value is in the range of 1.1–1.3, centrifuge at 4 °C, 9000 rpm for 2 min to collect 4 mL of cells into a sterilized EP tube. Gently discard the supernatant, dry the residual supernatant with a sterilized filter paper, and resuspend the cells with 1 mL of pre-cooled sterilized water. Centrifuge at 4 °C, 9000 rpm for 2 min, gently discard the supernatant, repeat washing once with 1 mL of sterilized water, then centrifuge at 4 °C, 9000 rpm for 2 min, gently discard the supernatant, and resuspend the cells with 1 mL of pre-cooled sorbitol (1 mol / L); centrifuge at 4 °C, 9000 rpm for 2 min, gently discard the supernatant, and gently resuspend the cells with 100 - 150 μL of pre-cooled sorbitol (1 mol / L).

[0031] 3.2.2 Transformation and screening Linearize the recombinant expression plasmids constructed in 3.1 with Sac I respectively. After purifying and recovering the linearized fragments, transform Pichia pastoris GS115 by electroporation respectively. Screen for Pichia pastoris recombinant strains on an MD plate, and then screen for multi-copy transformants on YPD plates containing different concentrations of geneticin (0.5 mg / mL - 8 mg / mL).

[0032] Transfer the obtained transformants to BMGY medium respectively and culture with shaking at 30 °C, 250 rpm for 1 d; then transfer to BMMY medium and culture with shaking at 30 °C, 250 rpm; add 0.5% methanol every day to induce expression for 4 d; centrifuge at 9000 rpm for 10 min to remove the cells, and the fermentation supernatants containing xylanase H1 and its single-point mutants are obtained respectively. Detect the xylanase activity and protein content in the fermentation supernatants respectively according to the following methods, and calculate the specific activity.

[0033] 1. Method for determining xylanase activity (1)Definition of xylanase activity unit Under the conditions of a temperature of 50 °C and a pH of 8.0, the amount of enzyme required to release 1 μmol of reducing sugar from a xylan solution with a concentration of 5 mg / mL per minute is defined as one enzyme activity unit, denoted by U.

[0034] (2)Method for determining xylanase activity Absorb 10.0 mL of xylan solution and equilibrate at 50 °C for 20 min.

[0035] Absorb 10.0 mL of appropriately diluted enzyme solution and equilibrate at 50 °C for 5 min.

[0036] Blank sample determination: Absorb 2.00 mL of appropriately diluted enzyme solution (which has been equilibrated at 50 °C), add it to a graduated test tube, then add 5 mL of DNS reagent and oscillate magnetically for 3 s. Then add 2.0 mL of xylan solution and equilibrate at 50 °C for 30 min, and heat in a boiling water bath for 5 min. Cool to room temperature with tap water, add water to make up the volume to 25 mL, and oscillate magnetically for 3 s to 5 s. Use the standard blank sample as the blank control and measure the absorbance A at 540 nm. B 。

[0037] Sample determination: Absorb 2.00 mL of appropriately diluted enzyme solution (which has been equilibrated at 50 °C), add it to a graduated test tube, then add 2.0 mL of xylan solution (which has been equilibrated at 50 °C), oscillate magnetically for 3 s, and incubate precisely at 50 °C for 30 min. Add 5.0 mL of DNS reagent and oscillate magnetically for 3 s to terminate the enzymatic reaction. Heat in a boiling water bath for 5 min, cool to room temperature with tap water, add water to make up the volume to 25 mL, and oscillate magnetically for 3 s. Use the standard blank sample as the blank control and measure the absorbance A at 540 nm. E 。

[0038] Formula (1): X D =[(A E - A B ) × K + C0] × 1000 / (M × t).

[0039] In the formula: X D — The activity of xylanase in the sample dilution, U / mL; A E — The absorbance of the enzyme reaction solution; A B — The absorbance of the enzyme blank sample; K — The slope of the standard curve; C0 — The intercept of the standard curve; M — The molar mass of xylose M(C5XYN 110 O5) = 150.2 g / mol; t — The enzymatic reaction time, min; 1000 — The conversion factor, 1 mmol = 1000 μmol; X DThe value should be between 0.04 - 0.10 U / mL. If it is not within this range, the dilution factor of the enzyme solution should be reselected and then the analysis and determination should be carried out again.

[0040] Formula (2): X = X D ×D f .

[0041] Where: X — The activity of xylanase in the sample, U / mL; D f — The dilution factor of the sample.

[0042] The calculated value of the enzyme activity is retained to three significant figures.

[0043] (3) Measurement results Detect the enzyme activity of xylanase according to the above method.

[0044] 2. Protein content determination method The Bradford method for determining protein content is a composite method combining colorimetry and pigment method. Coomassie Brilliant Blue G-250 is brownish-red in acidic solution and turns blue when combined with protein, and it conforms to Beer's law within a certain protein concentration range. It can be colorimetrically determined at 595 nm. A large amount of absorption occurs within 3 - 5 minutes and remains stable for at least 1 hour. Within the range of 10 - 1000 μg / mL, the absorbance value is proportional to the protein concentration.

[0045] Mix according to the volume ratio of 1:5 of the enzyme solution and Coomassie Brilliant Blue solution, and let it stand for 10 mim. Determine the protein content by the Bradford method 3. Specific activity calculation "Specific Activity" refers to: the number of enzyme activity units per unit weight of protein, generally expressed as U / mg protein.

[0046] Specific activity calculation formula: Specific activity (U / mg) = Enzyme activity (U / mL) / Protein content (mg / mL).

[0047] The specific results are shown in Table 1.

[0048] Table 1 Comparison of specific activities of xylanase mutants Xylanase Specific activity (U / mg) Wild-type H1 1185 T149Q single-point mutant 1574 As can be seen from the results in Table 1, compared with the wild-type xylanase H1, the specific activity of the xylanase mutant containing the single-point mutation T149Q provided by the present invention has increased by 32.83% and reached 1574 U / mg, achieving an unexpected technical effect.

[0049] In summary, the specific activity of the xylanase mutant provided by the present invention is significantly improved, which is beneficial to reducing the production cost of the enzyme and promoting its wide application in the industrial field.

Claims

1. A xylanase mutant, characterized in that, The mutant is obtained by mutating the 149th amino acid of the xylanase with the amino acid sequence of SEQ ID NO:1 from Thr to Gln.

2. A DNA molecule encoding the xylanase mutant according to claim 1.

3. A recombinant expression plasmid containing the DNA molecule according to claim 2.

4. A host cell, characterized in that, The host cell described above contains the recombinant expression plasmid according to claim 3.

5. The host cell according to claim 4, characterized in that, The host cell described above is Pichia pastoris ( Pichia pastoris ).