DsRNA capable of simultaneously preventing and treating various spider mites and application of dsRNA

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) capable of simultaneously preventing and treating various spider mites and application of the dsRNA. The dsRNA disclosed by the invention can be used for simultaneously preventing and treating various spider mites, and the design thought of the dsRNA disclosed by the invention is to simultaneously analyze beneficial organisms such as neoseiulus barkeri and apis cerana so as to control the risk of the dsRNA aiming at tetranychus ilsi and tetranychus urticae. The dsRNA disclosed by the invention is safe and harmless to natural enemy insects while effectively preventing and treating various pest mites, so that the dsRNA has relatively high safety to the environment and non-target organisms. The dsRNA provides an efficient, safe and environment-friendly solution for preventing and treating various pest mites, has important application prospects and popularization values, is expected to be applied to preparation of biopesticides for preventing and treating spider mites, reduces the use of chemical pesticides, protects the environment, and reduces the damage of the chemical pesticides.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, relates to the field of pest control technology, and particularly relates to a dsRNA for simultaneously controlling multiple spider mites and its application. Background Art

[0002] Spider mites belong to the phylum Arthropoda, class Arachnida, superfamily Tetranychidae, and genus Tetranychus. They are one of the important groups of agricultural and forestry pests, extremely destructive, and have characteristics such as small body size, a wide variety of hosts, strong adaptability, and high reproductive capacity. Spider mites are piercing-sucking mouthpart insects that suck the contents of plant mesophyll cells through their stylets. After being damaged, white spots appear on the leaves. Spider mites usually secrete salivary proteins to inhibit the defense of host plants and increase the adaptability of other harmful organisms in the same ecological niche, resulting in very serious losses. Biological invasion is an important ecological and economic challenge currently faced by China. Due to their unique growth, development, and reproductive characteristics, alien invasive organisms can quickly spread and replace local populations, making the prevention and control work time-consuming and laborious, with high economic costs. Since it is difficult to take effective control measures in the early stage of invasion, invasive organisms often cause serious harm to agricultural production. Among invasive mites, Tetranychus evansi and Tetranychus urticae are typical representatives.

[0003] Tetranychus evansi, also known as the tomato red mite, originated in South America and has a wide host range, covering 138 plant species in 37 families, especially preferring Solanaceae plants. Tetranychus urticae, as a polyphagous insect, has a miscellaneous diet and more than 800 host plant species in more than 50 families. Its strong adaptability and lack of natural enemies are gradually replacing local spider mite populations, becoming the main pest mites and causing huge losses to local agricultural production. At present, the control of spider mites mainly relies on chemical pesticides, but unreasonable use has led to problems such as drug resistance, resurgence, and residues, seriously threatening human health and quality of life. With global climate change and the change of crop cultivation methods, single chemical control can no longer meet the food security needs, and it is urgent to find green and effective control means.

[0004] RNAi (RNA interference) technology is an important new technical means for controlling pests and diseases. The core concept of the RNAi green prevention and control technology is to inject exogenous (artificial) dsRNA into insects to inhibit the expression of target genes, resulting in the growth and development disorders or death of pests, thereby reducing the damage of pests to crops and achieving the prevention and control of pests and diseases. RNAi technology has many advantages in controlling pests and diseases, such as specificity of control target, convenience of target development, convenient application, simple operation, and green and pollution-free, meeting the public's demand for green pesticides. At present, in the field of R & D of RNAi biological pesticides, products have been launched on the market.

[0005] The process of the growth and development of spider mites is a process of coordinated expression and inhibition of many genes. With the in-depth study, a large number of RNAi target genes have been discovered. By interfering with the RNAi target genes of spider mites, such as VATPase, COPB2, AQP9, Rpt3, COPE, Rop, GARP1d, etc., the survival rate of spider mites can be significantly reduced, and some genes can simultaneously significantly inhibit the fecundity of spider mites. At present, the research on controlling spider mites by RNAi technology mostly focuses on the genes of single pests, while there are many pests in the field. It is difficult to comprehensively control with dsRNA targeting only a single organism, resulting in poor effect and low efficiency. In addition, the lack of target genes makes the control more difficult. Summary of the Invention

[0006] The object of the present invention is to provide a dsRNA for simultaneously controlling multiple spider mites and its application in view of the above problems.

[0007] In order to achieve its object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a dsRNA for simultaneously controlling multiple spider mites, the dsRNA targets the common target genes of spider mites, and the nucleotide sequence of one strand of the dsRNA is shown as any one of the sequences of SEQ ID NO.1 - 10.

[0009] The second aspect of the present invention provides another dsRNA for simultaneously controlling multiple spider mites, the dsRNA targets the common target genes of spider mites, and the common target genes are selected from plasma membrane calcium-transporting ATPase 1, dynamin protein, and CCR4-NOT transcription complex subunit 3 gene.

[0010] Preferably, the dsRNA is dsC-ATP1 targeting the plasma membrane calcium-transporting ATPase 1 gene, or dsDynamin targeting the dynamin protein gene, or dsCCR4 targeting the CCR4-NOT transcription complex subunit 3 gene. The nucleotide sequences of one strand of dsCCR4, dsC-ATP1, and dsDynamin are shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.9, respectively.

[0011] The third aspect of the present invention provides the encoding genes of the above dsRNAs. The nucleotide sequences of the encoding genes of the dsRNAs shown in SEQ ID NO.1 to 10 are shown in SEQ ID NO.12 to 21, respectively.

[0012] The fourth aspect of the present invention provides any one of the following applications of the above dsRNA or encoding gene:

[0013] 1) Application in preventing and controlling spider mites or in preparing products for preventing and controlling spider mites;

[0014] 2) Application in promoting the death of spider mites or in preparing products for promoting the death of spider mites;

[0015] 3) Application in inhibiting the growth of spider mites or in preparing products for inhibiting the growth of spider mites;

[0016] 4) Application in inhibiting the expression of the gene corresponding to the dsRNA in spider mites, or in preparing products for inhibiting the expression of the gene corresponding to the dsRNA in spider mites.

[0017] The above application is to introduce the above dsRNA into spider mites to inhibit the growth of spider mites and reduce the survival rate of spider mites, thereby achieving the prevention and control of spider mites.

[0018] The introduction method of the dsRNA is to feed spider mites with the dsRNA; preferably, the working concentration of the dsRNA is 800 - 1200 ng / μL.

[0019] The fifth aspect of the present invention provides a recombinant expression vector, recombinant bacterium, or expression cassette of the above dsRNA or the above encoding gene.

[0020] The sixth aspect of the present invention provides any one of the following applications of the above recombinant expression vector, recombinant bacterium, or expression cassette:

[0021] 1) Application in preventing and controlling spider mites or in preparing products for preventing and controlling spider mites;

[0022] 2) Application in promoting the death of spider mites or in preparing products for promoting the death of spider mites;

[0023] 3) Use in inhibiting the growth of spider mites or in preparing a product for inhibiting the growth of spider mites;

[0024] 4) Use in inhibiting the expression of the gene corresponding to dsRNA in spider mites, or in preparing a product for inhibiting the expression of the gene corresponding to dsRNA in spider mites.

[0025] The above applications, wherein the spider mites include Tetranychus evansi and Tetranychus urticae.

[0026] The beneficial effects of the present invention are:

[0027] The dsRNA of the present invention can control multiple spider mites simultaneously. The design idea of the dsRNA of the present invention is aimed at Tetranychus evansi and Tetranychus urticae. The gene sequence of Tetranychus evansi with the highest similarity of gene fragments is selected as dsRNA through dsRNA-Engineer. At the same time, beneficial organisms such as Neoseiulus barkeri and Apis cerana are analyzed to control the risk of dsRNA. In the present invention, the conserved region of the gene is selected for the design of the dsRNA fragment, which can target the homologous genes of Tetranychus evansi and Tetranychus urticae. Multiple dsRNA fragments are designed, and the number of off-target times of each dsRNA fragment is analyzed. The region with a low off-target rate for the genes of organisms such as Neoseiulus barkeri (a natural enemy of spider mites, playing an important role in controlling natural enemies) and Apis cerana (an important pollinating insect) is selected to protect Neoseiulus barkeri and maintain the population of beneficial organisms in the field. It is safe and harmless to natural enemy insects while effectively controlling harmful mites, so it has high safety for the environment and non-target organisms. The dsRNA of the present invention provides an efficient, safe and environmentally friendly solution for controlling multiple harmful mites, has important application prospects and promotion value, and is expected to be applied in the preparation of biological pesticides for controlling spider mites, reducing the use of chemical pesticides, protecting the environment and reducing the harm of chemical pesticides. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 It is a comparative analysis of the survival results of Tetranychus evansi after treatment with dsRNA.

[0029] Figure 2 It is a comparative analysis of the survival results of Tetranychus urticae after treatment with dsRNA. DETAILED DESCRIPTION OF THE INVENTION

[0030] The present invention will be further described below in conjunction with embodiments, but the present invention is not limited thereto.

[0031] The experimental methods in the following embodiments are all conventional methods unless otherwise specified.

[0032] The spider mites used in the following experimental examples were provided by the College of Plant Protection, Southwest University. The spider mites were reared on common cowpeas and tobacco in a climate chamber. The temperature condition in the artificial climate chamber was 24 ± 1°C, the relative humidity was 70% - 75%, and the photoperiod was 16 h of light: 8 h of darkness.

[0033] Example 1, Design and Preparation of dsRNA

[0034] 1. Design of dsRNA

[0035] Using the Screen-target analysis function of the dsRNAEngineer platform developed by the research group of this study

[0036] (https: / / dsrna-engineer.cn / target) Common target screening was carried out for two invasive pest mites, Tetranychus evansi and Tetranychus urticae. The candidate genes are shown in Table 1: lysine-specific demethylase 6A, calcium / calmodulin-dependent protein kinase type II alpha chain, ras-related protein Rab-8A, CCR4-NOT transcription complex subunit 3, plasma membrane calcium-transporting ATPase 1, SPRY domain-containing SOCS box protein 4, DNA-binding protein P3A2, protein split ends, dynamin, protein FAM102A. The relevant gene sequences of Tetranychus evansi used were the identified relevant gene sequences stored in the internal database of the research group of this study.

[0037] Then, using the On- / Off-target analysis function of the dsRNAEngineer platform (https: / / dsrna-engineer.cn / design), comprehensive transcriptomic big data analysis was performed on nine non-target organisms closely related to pest mites in the field, including two predatory mites, Neoseiulus barkeri and Neoseiulus californicus, and Mus musculus, Homo sapiens, Danio rerio, Eisenia fetida, Bombus terrestris, Vigna unguiculata, Apis cerana, Aphidius gifuensis, and Propylaea japonica, to design dsRNAs that precisely target invasive pest mites and are safe for non-target organisms. One strand sequence of the dsRNA is shown in SEQ ID NO.1 - 10 (the other strand is the reverse complementary sequence), and one strand sequence of the control dsGFP is shown in SEQ ID NO.11. The nucleotide sequences of the coding genes of the dsRNAs shown in SEQ ID NO.1 - 10 are shown in SEQ ID NO.12 - 21 in sequence.

[0038] Table 1 Tetranychus candidate genes

[0039]

[0040] 2. Preparation of dsRNA

[0041] Primers were designed based on the sequences of the dsRNAs shown in SEQ ID NO.1 - 10 designed above. Using Tetranychus evansi cDNA as a template, the dsRNA sequences were amplified with the primers in Table 2. After sequencing verification, the sequences were purified, and the purified cDNA sequence fragments were used as templates for synthesizing dsRNAs. The corresponding dsRNAs were synthesized using the TranscriptAid T7 HighYield Transcription Kit (Thermo Scientific, USA). The dsRNA synthesis system was 4 μL of 10×Transcription Buffer, 2 μL of 20×Ribonucleotide Solution Mix, the cDNA purified above (1 μg), 2 μL of 20×HMW Mix, and T7 RNA Polymerase (500 units / μL -1) 2 μL, make up to 40 μL with RNase-Free ddH2O, incubate overnight at 37°C. After the reaction, purify the reaction product using the Min Elute PCR Cleaning Kit (Qiagen, Germany). The operation process refers to the kit instructions. Finally, dissolve the dsRNA with nuclease-free water, detect the concentration and purity of dsRNA using a Nanodrop one spectrophotometer, and detect the integrity of dsRNA by 1% agarose gel electrophoresis.

[0042] The names of the dsRNAs in Table 2 correspond to the gene abbreviations in Table 1.

[0043] Table 2 dsRNA synthesis primers

[0044]

[0045]

[0046] * The 5' ends of the primers in Table 2 are all linked with T7 promoter sequences (i.e., the lowercase letter parts of the sequences in Table 2).

[0047] Example 2, Application of dsRNA in Inhibiting the Growth of Spider Mites

[0048] 1. Preparation of spider mites and devices

[0049] Starvation device: Take a petri dish with a diameter of 10 cm, tear the moist cotton into thin strips, surround the inside of the petri dish, and seal the petri dish tightly with plastic wrap.

[0050] Feeding device: Take a petri dish with a diameter of 3.5 cm, cover the small petri dish with parafilm, press it firmly, cut a 1 cm × 1 cm gauze and place it in the middle of the petri dish, add 40 μL of 1000 ng / μL dsRNA aqueous solution, stretch the parafilm more than 4 times, cover the petri dish, and gently press with fingers to make the dsRNA solution evenly distributed on the gauze. Surround the feeding device with lens cleaning paper to prevent the test mites from escaping.

[0051] 2. Application of dsRNA in controlling spider mites

[0052] Test mites: Tetranychus urticae and Tetranychus evansi.

[0053] Pick female adult spider mites of the same instar and place them in the starvation device. After 12 h, transfer the spider mites to the feeding device (containing 1000 ng / μL dsRNA). After 24 h, transfer the spider mites to the leaves to feed (transfer Tetranychus urticae to cowpea leaves and Tetranychus evansi to tobacco leaves). Count the number of surviving spider mites every 24 h for a total of 10 days. Each treatment contains 3 biological replicates, and a dsGFP control group is set up simultaneously.

[0054] Survival curves were analyzed using the log-rank test (Mantel-Cox) with GraphPad Prism 8.0.2.

[0055] After feeding female adult spider mites with dsRNA for 24 h, the spider mites were transferred to plant leaves to count their mortality rates, and the results are as Figure 1 、 Figure 2 shown. Among the 10 common target genes of invasive spider mites mined through the dsRNA Engineer platform, except that dsCDP only caused significant lethality to *Tetranychus urticae*, the other nine dsRNAs all had significant lethality to the two tested spider mites. Among the two tested spider mites, dsC-ATP1, dsDynamin, and dsCCR4 all had good lethal effects. The 10-day mortality rates in *T. urticae* were 46.44%, 47.71%, and 48.65% respectively, and the 10-day mortality rates in *Tetranychus evansi* were 52.87%, 43.37%, and 48.03% respectively.

[0056] The dsRNA sequence is as follows :

[0057] SEQ ID NO.1:

[0058] UUUGGCCAUCAAAGCAUUCCGCCAAAUACUUUAUUUUAAUCCAUCUUUUUAUCCAUCCAAUGAACUACAUAUUAGAUUAGGAGUUAUUUUUAAGAUUUUAUGUGAUUAUAAUUCAUCUCUUAAACAUUUUCAAAUUGCCUUGGCCGAUAGUCGUCCAUCAACUCUUAGUAAAGUUCAAAUUAAAUUUCAUAUUGCUCAUUUAUAUGAAGUCCAAGGGAAACAUAAAUUAGCUAAAGAAUGUUAUGAAAAAUUAUUAUCGGAUAAAACUGUUACCGGUGAAUUAAGGUCUGAUGUGCAAAAGCAAUUAGGAUGGAUGUACCAUAUUGUGGAUUCAUUUGGUGAUAAACAUACGAGGCAAUCAUUGGCCAUAAGUUAUCUGGAAUCAGCGUCAAAAGGAGAAUUUAGUUCAAGACAAAGUUCCUAUUUUCUUGGUCGAUGUUACUCAAGUCUAGGUCAUGUACAUGAAGCAUUUAAAUCUUACAGAGCAUGUGUUGAUAAAAAUGAUCUUGAUGCUGAUACAUGGUGCUCAAUAGGGGUUCUUUAUCAGCAG。

[0059] SEQ ID NO.2:

[0060] AUGACAGUAUUCAAGAGGAAGGUUAUCAUUACUUAAUUUUCGACUUGGUAACUGGCGGUGAAUUGUUUGAAGAUAUAGUAGCUCGUGAAUACUAUUCAGAAGCUGAUGCCUCCCACUGUAUUCAACAAAUUUUGGAAUCAGUUAAUCAUUGUCACAUGAAUAAUGUUGUACAUAGAGAUCUGAAACCAGAAAACCUUUUACUUGCUAGUAAACAAAAAGGUGCUGCCGUUAAACUAGCUGAUUUUGGUCUUGCCAUUGAGGUCAGUGGUGAUCGUUCAGCAUGGUUUGGUUUUGCCGGAACACCUGGUUAUCUAUCACCUGAAGUACUUCGUAAAGAACCUUAUAGUAAACCUGUUGACAUAUGGGCUUGUGGAGUAAUUUUGUACAUACUUUUGGUUGGUUAUCCGCCUUUUUGGGACGAAGAUCAGCAUCGUCUCUAUGCACAAAUCAAGGCAGGAGCUUACGAUUAUCCAUCACCUGAAUGGGAUACAGUAACACCAGAAGCCAAAAAUUUGAUCAACUCAAUGUUAACAAUUAACCCUGAUAAACGGAUUACCGCUGCCGAAGCUCUUAAACACCCAUGGAUCUGCCAACGAGAGC。

[0061] SEQ ID NO.3:

[0062] GUCAAGAACGAUUUAGAACUAUAACCACAGCAUAUUACCGGGGUGCCAUGGGAAUCAUGCUUGUCUAUGACGUUACAAAUGAGAAAUCAUUUGAAAACAUCAAAAAUUGGGUUAGAAAUAUUGAAGAGCAUGCUGCCUCAGAUGUUGAAAAAAUGAUCCUUGGUAAUAAAUGUGACAUUGAAGAUAAAAGACAAGUUACAAAGGAGAGAGGAGAACAAUUAGCCAUUGAAUAUGGCAUCAAAUUCAUGGAGACCAGUGCAAAAACAAGUAUCAACGUUGAAGAAGCCUUCAUCACUUUGACUAGAGAUAUAAAGAGAAAGAUGGAGAAAAAGUUGAAGGAUGCAGCAAAUCCAAUGAGAACAGGGCAACAGGUUAGAGUUAGUGAACCCUACUACAAGAAAAGUCGUUGGUUUUGCCUGUUAGUAUGAAGUUAUCCUUUAUAUGGAUAAAUUUCUCCAACCAGUGAUCAAAUCUAUUUUCAAUUUUACUCUGAUAUUUUUUAAUAUCAACUUUGCAAUCUAUUUACACCAUUAUAUUGGUUACGAUGGUA。

[0063] SEQ ID NO.4:

[0064] CACCUCCAAUACCAGCAGCAACAACAGUAGUAGUAACACAAUCACCACCAACAAUAACAAUAACAAUAAUAAUAAUAACCCUUUGAUAAUGAAUGGACCAUCCGUACCUGGGGGCCUUGGUGUUAAAGUACCUUCCCAGUUACAACAACCACAAUCUCAACAACAGUCAAGCAACACAGGACCUGGGCAAGGUUUAGGAACAACUUCUGCGCCCGUGAACCAAUUAACAUCCAUGUCCUCACUUAAAUCAAUAGCCCAACAAGCUGUUGCUAGUGCAGGUUUGGAGAAUUCUACGAACGAUGCUACUUCUUUAUCUACUUCAAAUCUUUUUGAGACAAGCACAUCCAUGUCAGGAGCUGCCACAAACUCAAUGAACAGUAAUGCCUCAGUUACAUCAACAACAUCAACAGUGAUAGGUUUAUUAAGUGGUAAUAGUAAGUCCCUGGUUAUGCCUUCGUGUGUUUCCUCAACAGUAUCAAAUUUAACCUCCUCUGCGGCAACGUCAGCCGUUAGUCCUGCCAGUUCAAUCGGGAUGCAUCAGUCAGAAGCC。

[0065] SEQ ID NO.5:

[0066] GUUCCACUUCCCCAUGUAAAUUUUUUCGGUAUCCUUUUGGUUGGCAGGGUUGUAAUCAAUUGACCCCAAACAAGGACGCCAACUCCGAAAAAUAUGCACCAAAGCCAUUGUUCUAAUGAUAACCUUGCUGUAGAAAAAGCUCGUCCACCGAACUGUACAAUUAUUAUCUGAGCACCCGCGGUGAUGAAUAAAAUGGAAUAGAAUAUGGGAUUGGUGAAAAGACCUUCAAAGAUGUUUCGUUCCCCAUGAAUUUUACGGGAAUUGAUCUCAUUGAAUAAUGUCAUCAUUACGAAAGUAUUGAAAAUGAUAGUAAAAUGUUGCGAUGGUGGCGCAUUCAAUGGAGCAUACAUUCCAGAGUCAAUAUCAAAAAAUUUAUCACCUCCAAAUAAAAGAAAAAAGAUUAUAAUUAAUUGAUAAAUAGCAUGGCCUAGAAUAUUUUUAAACAUAGUUCUCGAUAUGAGAGGUUUAGUCCGUCCAUAGGGCUUACGUAAGAGCAAGGCUGGUGUUGGCAUUUCCGUUGCUAGUGCUAAAGAGGCUAAAGUAUCCAUAA。

[0067] SEQ ID NO.6:

[0068] CACUGGUCGGUUCCAAUACAGAAUCUUGGGGCUGGGACUUGGGCCGUAGUUUGUUGUAUCAUGAUUCCAAAAAUAACACCACCGGACGAACCUAUCCUGCUUACCUUAGACCGGACGAAACUUUUAAUGUUCCAGAUAGUUUUCUUACUGUUCUUGAUAUGGAUGAGGGAACACUUUCAUUUAUCGUUGACAAUCAAUACCUUGGAGUUGCCUUCAGUGGACUUAAAGGAAAAAAAUUAUAUCCCAUUGUUAGUGCCGUUUGGGGACAUUGUGAGAUUACUAUGAAAUACCUUGGAGGACUUGACCCGGAACCGUUACCUCUCAAAGAUAUAUGUCGACGAGUCAUUAGGAAGCAGAUAGGGAAACAGCGUCUUCAUAGACUGCAAACAGAACUAACAUUACCUAAUACUCUUAAAUCCUAUUUAUUGUAUCAAAAAUCAUUAAUACUGUAAAGGAUCCAACCAAGAGCUUUUUAAUAAAAAAAAAUGGACAAUAUUUCUUACAUUAUAAAUCAACAAGUAAAUAGUACAAUUGCAAAUCUCAAAUUAAC。

[0069] SEQ ID NO.7:

[0070] UAGGUCCACAAAAGUUAAUUGUAUUCAAUCAGAUGAAAAUUGAUUCUUCUCCCUCAAAUAAUAUCAUGAACCAUAGUGAUAUUACUGAUUGCGAUGAUCUCAGUGACGAUGAUUCAAAUUUUGACGAUAACGACCUAUUAUCAUCAUCCUGCCAAGAUGAAGUCACAGCCCAGCUUGCUGCAGCAGGCCCGAUUGGUGUUGCUGCGGCUGCAGCCAUAGUUACCGCCAAGAAAAGAAAAAGACCCCAUUCUUUUGAAACUAAUCCUUCUAUCAGAAAGCGGCAACAAACAAGAUUAUCGAGAAAAUUGAAAGCAACAAUCGACGAGUACACUACGCGGGUUGGUCAACAAGCGGUAGUCCUCAUAGUCACACCCGGGAAACCUCAAAAUAAUUACAAAGUAUUUGGUGCUAGACCUUUGGAAAAUGUGGUUCGUAAUUGUAGAAAUAUUAUAAUGCAAGAGCUUGAAGCCGCUCUGGCACAACAGGCACCACCUCAAGUCAAAGAAGAUCCUUCUCGUCAUGAAUUACCUCCUCUAGUCGUAGAUGGUAU。

[0071] SEQ ID NO.8:

[0072] UCGCAAAGUAAAGGAAAACCAGAAAACCAACUAAAACAACAUACAGCAAAAAAUAAUGUUGAAACCUUAAGCUAAAUAAUAAGAAAACUAUGUCCUUAGCUUGUAUCUUUUUUUUAAUAGUAAUCAAUUACGUUAUUUAAUUUUUUUUUUCUCUGCUUGUGUAAAUGGUUCGUGAGACUCGACAUCUGCAGAUCGGCAAUUUGCCGGAUAAUAUCUCGGAAUCUAAAAUUGUGGACCAUUUUAGCAGAUAUGGAACAGUACAACGUGUAAAGAUAUUGAGUGGAAAAUGUGAUAAUUUAAGUGCAACCGUAUCUUUCAUUGAUAUCCGAGCAGCCUCCAAAGCCCAUAAUUCGGAAAAUAGAUUGGAGAACAGAAAUUUGUGGACAAAAUAUUAUGAGCCACCUUUUUCUUCGUCGACAACAACCUCAUCAUCUAACAUUGUUCAACAGCAGCAACCCUUGCCUACACCAGGAUCUGAUUCUUCAGCAACAUUUAAGGAUGAUCGUCCACUUGGUAUUUGUAUAAGAAAUUUACCCAUCAGAUCCACA。

[0073] SEQ ID NO.9:

[0074] CGGAGGAAAGAGGCUUUCCAUGAUUCAACAUCCUCCUGUGAUUCACAGGAUAAUUCAAGAUAUUUGAAGUCUUUGUAGACGUUUCUUCCAUCAGGAUUGAAAAGAGCGAAGGUAUGUCUUCGAGACAUGAAACCGCUUUCAAUAUCUCGAAGUUUGAGACCAUCCAAAGGUAACAUAUACUUUUUGUCCUUUUCUUCCUCAUCUUUAAACCAAGAUAGGCUGUCACUUGUUAAAACAAACCAAUAAUCUCUUGAACCUCCUUUCAUUAUGCCAAGGUUGUGUAUACACAUGUAACCUUUGCGGAUAACUUGAUUCCCAAGUUUUCUCUUUGGAUUAGAAGUGUCAGCACUUUGUUGUGCAUUGGUGAAGCCAAUGAAGUCUUCAUGAUUGGUAUUCAUAUAAGCCAACUCGACAUCUACCAAUAACAACAAUUGCUCCUUGGUCUUUUGUUCACGUUCCCUUACAUGAGUAGUAAUUAUUCGUUCAGUUUCCUCUCUGAGUCUUGGAUAUUUCUUCAUUCGUUCAGUAACCCUACGUACAACAUUACCAA。

[0075] SEQ ID NO.10:

[0076] GAAGAGGUAAAAGAUCAUCAAGUUAAAUGGAGAUGUAGCUCUAGUUUCAUUUGUAAAAUGAGUGCUAACCCGUCUAAUGGUGUUCUUGACUCGACUAUUCUUAGAUUAUCCGUACGUAAGGAAGUUAAAGGAGGUCGCUCAUCUCAAAAGCUAGGCUUUGUCGAACUGGACCUAGCAGAAUUCGCAGGCUCUGGGCAAAUAACCAAAAGAUAUUUACUGGAAGGUUAUGACAACAAAAAUUAUAGGCAAGAUAAUUCAACACUCAAGGUGACCAUAGGAAUGACCCUACUCUUUGGCGAUCCACUAUUUAAAAGACCAUCUUCCAAUAUUCCGAUUCAUCCUCCACCUCAAAAUAAUUCAUUGUCCGAUUUAUCAACAGCUUUAGUUGGUAGAGAGGGUAAAACAAGCAACCUGGAUGGUGAUGGUUCAUCAUCUUUAGCCGACGGGUGUCCUAAUAGUGCCAUUGAUGAUGAAAAAACAACUCAAUUGAAACUUGAUAUUAGAGACAUACCUGCAGAUAAUGGUUGUUACUCAACUCGUAUAGAUUCUGUUCAAUUAAUUAAUCAAUUAGUCGAAGAAACAAAUCUGGAAAAAUUUGAU。

[0077] SEQ ID NO.11:

[0078] AGGAGCUGUUCACCGGGGUGGUGCCCAUCCUGGUCGAGCUGGACGGCGACGUAAACGGCCACAAGUUCAGCGUGUCCGGCGAGGGCGAGGGCGAUGCCACCUACGGCAAGCUGACCCUGAAGUUCAUCUGCACCACCGGCAAGCUGCCCGUGCCCUGGCCCACCCUCGUGACCACCCUGACCUACGGCGUGCAGUGCUUCAGCCGCUACCCCGACCACAUGAAGCAGCACGACUUCUUCAAGUCCGCCAUGCCCGAAGGCUACGUCCAGGAGCGCACCAUCUUCUUCAAGGACGACGGCAACUACAAGACCCGCGCCGAGGUGAAGUUCGAGGGCGACACCCUGGUGAACCGCAUCGAGCUGAAGGGCAUCGACUUCAAGGAGGACGGCAACAUCCUGGG。

Claims

1. A dsRNA for simultaneously controlling multiple spider mites, characterized in that: The dsRNA targets a common target gene of spider mites, and the nucleotide sequence of one chain of the dsRNA is shown in any sequence of SEQ ID NO. 1-10.

2. A dsRNA for simultaneously controlling multiple spider mites, characterized in that: The dsRNA targets the common target gene of spider mites, and the common target gene is selected from the plasma membrane calcium ion transport ATPase 1, dynamin protein, and CCR4-NOT transcription complex subunit 3 gene.

3. The dsRNA according to claim 2, characterized in that: The dsRNA is dsC-ATP1 targeting the plasma membrane calcium ion transport ATPase1 gene, or dsDynamin targeting the dynamin protein gene, or dsCCR4 targeting the CCR4-NOT transcription complex subunit 3 gene. The nucleotide sequence of one of the chains of dsCCR4, dsC-ATP1, and dsDynamin is shown in SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.9 respectively.

4. The dsRNA encoding gene according to claim 1, characterized in that: The nucleotide sequences of the genes encoding the dsRNAs shown in SEQ ID NOs. 1 to 10 are shown in SEQ ID NOs. 12 to 21, respectively.

5. Any of the following uses of the dsRNA of claim 1 or claim 2 or the encoding gene of claim 4: 1) Application in controlling spider mites or in preparing products for controlling spider mites; 2) Use in promoting the death of spider mites or in preparing products that promote the death of spider mites; 3) Use in inhibiting the growth of spider mites or in preparing products for inhibiting the growth of spider mites; 4) Use in inhibiting the expression of genes corresponding to dsRNA in spider mites, or in preparing products for inhibiting the expression of genes corresponding to dsRNA in spider mites.

6. The use according to claim 5, characterized in that: The application is to introduce the dsRNA described in claim 1 into spider mites to inhibit the growth of spider mites and reduce the survival rate of spider mites, thereby achieving the prevention and control of spider mites.

7. The use according to claim 4, characterized in that: The dsRNA is introduced by feeding spider mites with dsRNA; preferably, the working concentration of the dsRNA is 800-1200 ng / μL.

8. A recombinant expression vector, recombinant bacteria or expression cassette containing the dsRNA according to claim 1 or 2 or the encoding gene according to claim 4.

9. Any of the following uses of the recombinant expression vector, recombinant bacteria or expression cassette according to claim 8: 1) Application in controlling spider mites or in preparing products for controlling spider mites; 2) Use in promoting the death of spider mites or in preparing products that promote the death of spider mites; 3) Use in inhibiting the growth of spider mites or in preparing products for inhibiting the growth of spider mites; 4) Use in inhibiting the expression of genes corresponding to dsRNA in spider mites, or in preparing products for inhibiting the expression of genes corresponding to dsRNA in spider mites.

10. The use according to claim 5 or claim 9, characterized in that: The spider mites include Tetranychus irritans and Tetranychus urticae.

Images