DsRNA / fused dsRNA for RNAi to target multiple aphids and application of dsRNA / fused dsRNA
By designing a fusion dsRNA targeting the aphid Actin and ELAV-like protein genes, the problem of difficulty in preventing and controlling multiple aphids at the same time in the existing technology is solved, and efficient and safe aphid control effects are achieved, which meets the development needs of green agriculture.
Patent Information
- Application Number
- CN202510357960.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-25
- Publication Date
- 2025-06-27
AI Technical Summary
The prior art is difficult to effectively prevent and control multiple aphids at the same time, and the effects of traditional chemical control methods are weakened, which has negative impacts on the environment and non-target organisms.
A new fusion dsRNA for RNAi targeting a variety of aphids is designed to achieve lethal effects of aphids by targeting the actin Actin gene and ELAV-like protein gene of aphids.
This fusion dsRNA significantly improves the lethality rate for a variety of aphids, and because the target genes are highly conserved in aphids, the sequence differences are large in non-target organisms, achieving safety for the environment and natural enemy insects.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, relates to the field of pest control technology, and particularly relates to a dsRNA / fusion dsRNA targeting multiple aphids by RNAi and its application. Background Art
[0002] Aphids belong to the family Aphididae of the order Hemiptera and are one of the important pests in global agricultural production, especially widely distributed in temperate and subtropical regions. They suck the sap of plants with their piercing-sucking mouthparts, directly causing plant growth retardation and yield reduction. According to statistics, aphids cause economic losses of up to billions of dollars to crops such as wheat, corn, and vegetables every year. In addition, aphids can secrete honeydew, induce sooty mold, hinder plant photosynthesis, and further reduce crop quality. More seriously, aphids are vectors of various plant viruses, such as cucumber mosaic virus (CMV), potato virus Y (PVY), etc., and the indirect losses caused by the viruses they transmit far exceed the direct damage caused by aphids. In recent years, with the changes in global climate and farming systems, the reproductive ability, adaptability, and drug resistance of aphids have been continuously enhanced, the effects of traditional chemical control methods have gradually weakened, and they have caused serious negative impacts on the environment and non-target organisms.
[0003] RNA interference (RNAi) is a molecular biology technique that induces gene silencing through double-stranded RNA (dsRNA). The mechanism is that dsRNA is cleaved by Dicer enzyme in vivo into small interfering RNAs (siRNAs) of 20-23 nt. Subsequently, siRNAs bind to the RNA-induced silencing complex (RISC), specifically recognize and degrade the complementary target mRNA, thereby inhibiting the expression of the target gene. In recent years, RNAi technology has shown great application potential in the agricultural field, especially in pest control. Through plant-mediated RNAi technology, dsRNAs of insect-specific genes can be expressed in host plants. When pests feed on these plants, the target genes in their bodies are silenced, resulting in inhibited growth and development, decreased reproductive ability, and even death. RNAi technology has high target specificity, environmental friendliness, and simplicity of operation, and has been successfully applied to the control research of various pests, such as Helicoverpa armigera, Nilaparvata lugens, and Diabrotica virgifera virgifera. In addition, there are two commercial RNAi products in the field of pest control. First, the first transgenic maize (MON87411) expressing dsRNA of the DvSnf7 gene of Diabrotica virgifera virgifera from Bayer obtained the planting permission from the U.S. Environmental Protection Agency (EPA) in 2017 and the transgenic safety permission certificate from the Ministry of Agriculture and Rural Affairs of China (No. 197 (2020), for processing raw material use) in 2020. In December 2023, the product Ledprona for controlling Leptinotarsa decemlineata from Greenlight Bioscience passed the registration of the EPA. This biopesticide targeting the proteasome β5 gene (PSMB5) of Leptinotarsa decemlineata has become the world's first commercial sprayable RNA biopesticide.
[0004] ELAV - like proteins (Embryonic Lethal Abnormal Vision - like protein) are a class of mRNA - binding proteins initially discovered in Drosophila, and their name is derived from the phenotypes of mutants: Embryonic Lethal and Abnormal Vision. ELAV - like proteins contain three RNA recognition motifs (RNA recognition motif, RRM), and play important roles in mRNA transcription and translation by binding to the AU - rich element (ARE) in the 3′ untranslated region (3′ untranslated element, 3′UTR). For example, in Drosophila melanogaster, ELAV - like proteins mainly function in the nervous system. By binding to the 3′UTR region of specific mRNAs, they regulate the stability, localization, and translation efficiency of these mRNAs, thereby affecting the differentiation, development, and function of neurons. Knocking out the ELAV - like protein genes (Bmel - 1 and Bmel - 2) in Bombyx mori will lead to a decrease in the weight of silkworms and cocoons, an increase in the cocoon layer rate, and a decrease in the expression level of fibroin genes.
[0005] Currently, there have been reports on dsRNAs for aphid control, but usually they target only one gene or a certain type of aphid. There is a need for an efficient dsRNA insecticide that can kill multiple aphids simultaneously. Summary of the Invention
[0006] In view of the above problems, the present invention provides a novel fusion dsRNA targeting multiple aphids by RNAi and its applications.
[0007] To achieve its objectives, the technical solution adopted by the present invention is as follows:
[0008] In a first aspect of the present invention, there is provided a dsRNA for controlling aphids, wherein the dsRNA targets the Actin gene and / or the ELAV - like protein gene of aphids and is transcribed using the Actin gene and / or the ELAV - like protein gene of aphids as templates.
[0009] Preferably, the dsRNA is selected from dsActin, dsELAV, and fusion dsRNA, and the fusion dsRNA is a dsRNA that simultaneously targets the Actin gene and the ELAV - like protein gene;
[0010] The nucleotide sequence of the dsELAV is as shown in SEQ ID NO.15;
[0011] The dsActin nucleotide sequence is as shown in SEQ ID NO.24;
[0012] The fused dsRNA nucleotide sequence is as shown in SEQ ID NO.26.
[0013] The second aspect of the present invention provides the encoding gene of the above dsRNA:
[0014] The nucleotide sequence of the encoding gene of dsELAV as shown in SEQ ID NO.15 is as shown in SEQ ID NO.16;
[0015] The nucleotide sequence of the encoding gene of dsActin as shown in SEQ ID NO.24 is as shown in SEQ ID NO.25;
[0016] The nucleotide sequence of the encoding gene of the fused dsRNA as shown in SEQ ID NO.26 is as shown in SEQ ID NO.27.
[0017] The third aspect of the present invention provides any one of the following applications of the above dsRNA or the encoding gene of dsRNA:
[0018] 1) Application in controlling aphids or in preparing products for controlling aphids;
[0019] 2) Application in promoting aphid death or in preparing products for promoting aphid death;
[0020] 3) Application in inhibiting aphid growth or in preparing products for inhibiting aphid growth;
[0021] 4) Application in inhibiting the expression of the gene corresponding to dsRNA in aphids, or in preparing products for inhibiting the expression of the gene corresponding to dsRNA in aphids.
[0022] Preferably, the application is to introduce the above dsRNA into aphids to inhibit aphid growth and reduce aphid survival rate, thereby achieving control of aphids.
[0023] Preferably, the introduction method of the dsRNA is to feed aphids with dsRNA.
[0024] Preferably, dsRNA is mixed with liquid feed until the concentration of the fused dsRNA is 300 - 1000 ng / μL (preferably 400 - 600 ng / μL), and then aphids are fed.
[0025] The fourth aspect of the present invention provides a recombinant expression vector, recombinant bacterium or expression cassette of the above dsRNA or the encoding gene of dsRNA.
[0026] The fifth aspect of the present invention provides any one of the following applications of the above-mentioned recombinant expression vector, recombinant bacterium or expression cassette:
[0027] 1) Application in controlling aphids or in preparing products for controlling aphids;
[0028] 2) Application in promoting aphid death or in preparing products for promoting aphid death;
[0029] 3) Application in inhibiting aphid growth or in preparing products for inhibiting aphid growth;
[0030] 4) Application in inhibiting the expression of the gene corresponding to dsRNA in aphids, or in preparing products for inhibiting the expression of the gene corresponding to dsRNA in aphids.
[0031] In the above application technical solutions, the aphids include Megoura crassicauda, Aphis spiraecola, Aphis craccivora, Aphis citricidus, Myzus persicae, Acyrthosiphon pisum, Melanaphis sacchari, Diuraphis noxia, Rhopalosiphum padi, Metopolophium dirhodum, Sitobion avenae, Schizaphis graminum, Aphis gossypii, Rhopalosiphum maidis and Lipaphis erysimi;
[0032] Preferably, the aphids are Megoura crassicauda, Acyrthosiphon pisum, Aphis craccivora and Myzus persicae.
[0033] The beneficial effects of the present invention are:
[0034] Compared with the traditional design idea that most dsRNAs of current pests are targeted at a single pest and a single gene, the present invention changes the strategy. Starting from the idea that one dsRNA can control multiple aphids, by searching for highly conserved genes of multiple aphids and designing dsRNAs against them, it is found that among multiple candidate genes, the dsRNAs against the actin Actin gene and the ELAV-like protein gene have significant lethality to multiple aphids and have good application prospects. Moreover, the effect of the fusion dsRNA targeting these two genes simultaneously is further improved, and it has been experimentally verified that it has a significant insecticidal effect on multiple aphids.
[0035] Since the target genes of the dsRNA / fused dsRNA of the present invention are highly conserved in aphids, but do not exist or have large sequence differences in non-target organisms (such as natural enemy insects and pollinating insects), it can effectively control aphids while being safe and harmless to natural enemy insects. Therefore, it has high safety for the environment and non-target organisms. Compared with traditional chemical pesticides, the RNAi technology interferes with the physiological functions of pests through the gene silencing mechanism, and the risk of aphids developing resistance to it is relatively low, which can effectively extend the service life of control measures. At the same time, this technology meets the development needs of green agriculture. Its application does not require a large amount of chemical pesticides, reduces environmental pollution, and helps to achieve the sustainable development of agriculture.
[0036] The dsRNA / fused dsRNA of the present invention provides an efficient, safe and environmentally friendly solution for controlling various aphids, and has important application prospects and promotion value. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] Figure 1 It is the evaluation of the potential of five highly homologous genes of aphids to control aphids.
[0038] Figure 2 It is the evaluation of the control effect of the fused dsRNA of the present invention on Megoura japonica.
[0039] Figure 3 It is the evaluation of the control effect of the fused dsRNA of the present invention on Acyrthosiphon pisum.
[0040] Figure 4 It is the evaluation of the control effect of the fused dsRNA of the present invention on Aphis craccivora.
[0041] Figure 5 It is the evaluation of the control effect of the fused dsRNA of the present invention on Myzus persicae. DETAILED DESCRIPTION OF THE INVENTION
[0042] The present invention will be further described below in conjunction with examples, but the present invention is not limited thereby.
[0043] The experimental methods used in the following examples are all conventional methods unless otherwise specified.
[0044] The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.
[0045] The Megoura japonica, Acyrthosiphon pisum, Aphis craccivora, and Myzus persicae used in the following experimental examples were all provided by the College of Plant Protection, Southwest University, and were reared on broad beans or tobacco in a climate chamber. The temperature condition in the artificial climate chamber was 24±1°C, the relative humidity was 70-75%, and the photoperiod was 16 h of light: 8 h of darkness.
[0046] Example 1: Screening of Highly Homologous Genes of Aphids and Evaluation of Aphid Control Potential
[0047] 1. Screening of highly homologous genes in aphids
[0048] First, based on transcriptomic data of multiple aphid species, five target genes with high conservation (homology > 97%) and the potential for co-targeting aphids were identified by BLAST in 15 aphid species, namely Megoura crassicauda, Aphis spiraecola, Aphis craccivora, Aphis citricidus, Myzus persicae, Acyrthosiphon pisum, Melanaphis sacchari, Diuraphis noxia, Rhopalosiphum padi, Metopolophium dirhodum, Sitobion avenae, Schizaphis graminum, Aphis gossypii, Rhopalosiphum maidis, and Lipaphis erysimi, as shown in Table 1 below.
[0049] Table 1. Highly homologous genes in aphids
[0050]
[0051] 2. Design and preparation of dsRNA
[0052] Using the online platform dsRNAEngineer for precise design of RNA pesticides (access address: https: / / dsrna-engineer.cn / ), dsRNA fragments that precisely target 15 aphid species and are safe for 7 non-target organisms closely related to aphids in the field, such as Aphidius gifuensis, Arabidopsis thaliana, Homo sapiens, Apis mellifera, Coccinella septempunctata, Harmonia axyridis, and Episyrphus balteatus, were designed. The dsRNA primers for interfering with individual genes are shown in Table 2 below.
[0053] Table 2. dsRNA synthesis primers
[0054]
[0055]
[0056] Among them, dsMST was used as a control, and dsMST is the dsRNA of the mouse toxin protein gene (Muslta).
[0057] The steps for cloning and sequencing the dsRNA sequence are as follows: First, total RNA was extracted from Myzus persicae and genomic DNA was removed, and then the first-strand cDNA was synthesized using reverse transcriptase as a template. Next, specific primers were designed according to the target gene sequence, and these primers and the cDNA template were used for PCR amplification to obtain the dsRNA fragment of the target gene. After the PCR products were separated by agarose gel electrophoresis, the target band was cut out and recovered, and purified using a commercial kit. Subsequently, the purified PCR product was ligated to the pGEM-T Easy vector, and the ligation product was transformed into competent cells. After incubation in an ice box, heat shock, and cold shock treatments, the cells were spread on an LB solid plate containing antibiotics, and single white colonies were selected for culture and PCR identification. Finally, the monoclonal bacterial solution with a positive band detected was sent to a sequencing company for sequencing, and the sequencing results were analyzed to confirm whether the dsRNA sequence of the target gene was correct.
[0058] The steps for dsRNA synthesis are as follows: First, specific primers containing the T7 promoter sequence were designed and synthesized according to the target gene sequence for subsequent in vitro transcription. Next, using the cDNA as a template, the designed primers were used for PCR amplification to obtain the DNA fragment of the target gene. After the PCR product was purified, an in vitro transcription reaction was carried out using T7 RNA polymerase to synthesize dsRNA. The reaction system included a T7 enzyme mixture, reaction buffer, four nucleotides (ATP, CTP, GTP, UTP), and the purified PCR product. After the reaction was completed, the DNA template was degraded by adding DNase I, and the dsRNA was purified using the method of phenol-chloroform extraction and ethanol precipitation. Finally, the integrity and concentration of the dsRNA were detected by agarose gel electrophoresis, and it was stored in a -20 °C refrigerator for later use.
[0059] The dsRNA sequence is as follows:
[0060] dsMST (SEQ ID NO.13):
[0061] CACCCUCUCCACGAAUUGCUCGGCCGUUCACUGGAACUCCUGGGCCUGACCCAGC
[0062] UCCCUGCUAGUCCCUGCGGCCCACAGUUCCCCGGACCCGACUCCCUUUCCCAGAA
[0063] CGCAGUAGUCUAAGCCCUUAGCCUGCGGUUCUCUCCUAGGCCCCAGCCUUUCCUGCCUUCGACUGAAACAGCAGCAUCUUCUA。
[0064] dsCAS(SEQ ID NO.14):
[0065] GCUGCUGAUCGUGCUCCUAUGGCGGUUCUUCGCGUUCCUGUUCACGCGCAAGCA
[0066] GCCCGCCGAGCUCGCGGCGCCCGGUUGCCCGAACAGCGAGCCCAAAAAAGAGCC
[0067] GAAGCGGCAGGGCAAACAGGAGUUCGAGGGAACGUUCAUGACAGAGGCCAAAGA
[0068] CUGGGCGGGCGAACUGAUAUCCGGACAGACCACUACCGGGCGGAUAUUGGUGGU
[0069] GCUUGUGUUCAUUUUAAGUAUAGCAUCUCUAAUUAUAUAUUUUAUCGACGCCUC
[0070] CAACGAGGAGGUUGAACGAUGCCAAAAGUGGAGUCACAAUGUUACUCAACAAGU
[0071] AGAUUUAGCGUUCAAUAUUUUUUUUAUGGUUUACUAUUUUAUAAGAUUUAUAGCCGCCAGUGAUAAGUUAUG。
[0072] dsELAV(SEQ ID NO.15):
[0073] UGCAAGACCUAGUAGUGAAGCAAUUAAAGGGGCUAAUUUAUAUGUCAGUGGUC
[0074] UUCCAAAACAUAUGACUCAACAAGACCUUGAAAAUUUAUUUAGUCCUUAUGGUC
[0075] GUAUAAUAACAUCAAGAAUUUUAUGUGAUAAUAUGACUGAUAUGUUCACAGUA
[0076] CGACAAUUUGUGGGAAAUACUGGAGGAGAUCAUUCGCCGUCAAUUUCAAAAGG
[0077] UGUUGGUUUUAUAAGAUUUGAUCAAAGAAUUGAAGCCGAACGAGCAAUUCAAG
[0078] AAUUAAAUGGAACUGUUCCCAAAGGUUCAACAGAAUCAAUUACUGUGAAGUUC
[0079] GCCAAUAAUCCUAGUAGCAAUAAAGCAGUACCUGCAUUAGCAGCUUAUUUAACUCCUCAAGGAGCUC。
[0080] The coding gene sequence of dsELAV (SEQ ID NO.16):
[0081] TGCAAGACCTAGTAGTGAAGCAATTAAAGGGGCTAATTTATATGTCAGTGGTCTTCC
[0082] AAAACATATGACTCAACAAGACCTTGAAAATTTATTTAGTCCTTATGGTCGTATAATA
[0083] ACATCAAGAATTTTATGTGATAATATGACTGATATGTTCACAGTACGACAATTTGTGG
[0084] GAAATACTGGAGGAGATCATTCGCCGTCAATTTCAAAAGGTGTTGGTTTTATAAGATT
[0085] TGATCAAAGAATTGAAGCCGAACGAGCAATTCAAGAATTAAATGGAACTGTTCCCA
[0086] AAGGTTCAACAGAATCAATTACTGTGAAGTTCGCCAATAATCCTAGTAGCAATAAAGCAGTACCTGCATTAGCAGCTTATTTAACTCCTCAAGGAGCTC。
[0087] dsPbp6 (SEQ ID NO.17):
[0088] UUUCAAGUGAUGAGCAAUUACCACCAUCAGGCAGCCGCGGUCGCCGCACAAGGU
[0089] UUCGGGCCACCAGCGUCGCCGCACACCGGCGGCCCCGGCAACCCGCGGGCCGCCG
[0090] CGUUCCCGCCGGCCACGUCGCCCGGCCCCGGCGCCCCGUCCACCAUGGACAUGUA
[0091] CAGCUCGAACCCGGCCGAUUACGUGCAAGCAGCGUCACCGCAACCGUCCGCGUU
[0092] CCCCGCGAUCGCCGUCUCACGUGCGCCCAUUAAUUACAAUCCUGUAGGGGCCUU
[0093] UGAUUCCGGCCGCUUUUACCAAUGGGUACCACUGAACAACGCAAGAGUCAAUAA
[0094] AUUUCUUCCAUCGUAAGGUUGACCGAUAUUAGUCGCCCCUAUGCGUGUGAUUGACUCAA。
[0095] dsZF (SEQ ID NO.18):
[0096] GACCAACCACAUCCGUCAGCACACUGGUGAGUCACCACACCGAUGUCAUUUUUG
[0097] UCCUAAAACGUUUACGCGCAAAGAACAUCUUACUUGUCAUAUUCGUAUUCACAC
[0098] AGGCGAGUCGCCACACGCUUGCGAAUUCUGUAAUCGAACCUUUGCACGCAAAGA
[0099] ACAUCUGAAACGUCACGUGCGCCAGCACGCGCCGGGGGCAGAGUACAAUUGUAU
[0100] CAUCUGCUCCGAGGUGUUCUCUGCCAAGGAACCGUUGCUCGAACACAUGUUGAC
[0101] CCAUCCCCGCGAUUGUCCGUACGUGUGCACCGACUGCGGCAAGGCGUUCCGCCU
[0102] CAAGGGCAACCUCCUGUUCCAUCAGAGGUCCCAUCAGAAGGGCAUGCCGGCCGAUCGUCCGUUCCGGU。
[0103] dsCCCH(SEQ ID NO.19):
[0104] CGCAGACGCUUUGAUUAUGAUGAAGAGCCCGAUCCCAAGCGUAGGCGCUACGAA
[0105] UUUGACAACAGAAUGCCGCUAGGGCGCCCAUUCCCCAAUCGCGACAUGGACUUU
[0106] UCUGCGCCACCUGGGCCUGUGCAUCAACAGCCAUAUUGGUUGUUGCAAGAUGAG
[0107] GUGGAAAUGUUGCGCAAGCGUGUGGCUGAGUUGAAAAAGCGCAAUGAGGAAUU
[0108] GCAAGCGACUAAUGAAUUCUUGUUGGAACAAAACGCACAGCUGCGCAUAAAUGA
[0109] ACAAGCGCCCCUGCGCAGCACCCAGCAAAUGGUGAGCGCUAUACGCACCGUGAC
[0110] CACAGUCCCAGUCAGCUUGGCGGCGGUGGCUGCGGCCGGCACACCCGUGUCCAUAGCUACCGUC。
[0111] 3. Verification of dsRNA in controlling aphids
[0112] The preparation process of the artificial diet formulation and feeding device was carried out according to the reference (Li Caixia, Gao Lifeng, Gao Lingling, Li Runzhi. Study on rearing aphids with a completely artificial nutrient solution. Journal of Shanxi Agricultural University, 1997, 17(3): 225-228). The artificial diet was filtered through a 0.2 μm bacterial filter, aliquoted into 2.0 mL nuclease-free centrifuge tubes and stored in a -20 °C refrigerator to avoid repeated freezing and thawing. The method for feeding aphids was referred to the following literature: Jiu Min, Liu Shusheng. Techniques for rearing aphids with artificial diets [J]. East China Entomological Journal, 2004(02): 102-109.
[0113] The dsRNA was dissolved in ddH2O and mixed with the liquid artificial diet at a volume ratio of 1:3, so that the concentration of dsRNA in it was 500 ng / μL. Adult aphids (20 aphids of Myzus persicae, Aphis craccivora, and Myzus persicae were picked for each device; 15 aphids of Acyrthosiphon pisum were picked for each device) were selected and placed in the feeding device to feed. The mortality rate was counted every 12 hours, and the mortality rate for a total of 72 hours was counted. There were 6 biological replicates for each treatment.
[0114] All statistical analyses were performed using SPSS 22.0 for Windows (SPSS Inc., USA). The Shapiro-Wilk test was used for the normality test of aphid mortality rate, and ANOWA was used to analyze the significant differences between each treatment.
[0115] After interfering with 5 genes by the dsRNA delivery method mediated by the artificial diet method, the survival rates of Myzus persicae all showed significant decreases to varying degrees ( Figure 1 ), among which the ELAV gene had the best lethal effect, and the mortality rate at 72 hours reached 56.667%, showing great potential as an RNAi target for field control of aphids.
[0116] Example 2: Fusion of dsRNA
[0117] In order to further enhance the aphid control potential of dsRNA, based on the ELAV gene sequence of Megoura crassicauda, the Actin gene sequence was added to form a novel fusion dsRNA (dsFusion-Actin+ELAV), targeting two lethal genes in aphids simultaneously to enhance the insect control ability. The sequence of the fusion dsRNA was mainly composed of the sequence of the 200 bp ELAV-like protein gene, and at the same time, the 200 bp actin Actin gene sequence was integrated, and these two sequences were highly conserved in aphids.
[0118] Using the online platform dsRNAEngineer for precise design of RNA pesticides (access address: https: / / dsrna-engineer.cn / ), dsRNA fragments that are precisely targeted at 15 aphid species and safe for 7 non-target organisms closely related to aphids in the field described in Example 1 were designed. A 200-bp conserved fragment was selected from each of the ELAV gene and the Actin gene and integrated into the sequence of a novel fusion dsRNA (dsFusion-Actin+ELAV). The novel fusion dsRNA and dsActin primers are shown in Table 3 below.
[0119] Table 3. Synthetic primers for novel dsRNA design combinations and dsActin
[0120]
[0121]
[0122] The fusion dsRNA and dsActin were prepared according to the method in Example 1, and the sequences are as follows:
[0123] dsActin (SEQ ID NO.24):
[0124] CCAGGUAUUGCCGACAGAAUGCAAAAGGAAAUCACCGCCUUGGCUCCAAGCACAAUCAAGAUCAAGAUCAUUGCCCCACCAGAACGUAAAUACUCCGUAUGGAUCGGUGGUUCCAUCUUGGCUUCUCUGUCCACCUUCCAACAGAUGUGGAUCUCCAAACAAGAAUACGACGAAUCCGGCCCAGGCAUUGUCCACCGUAAAUGCUUCUAAGUCAUCACCUCCCACAACAUACAAAAUCAAAAUUACAAUCACGCUUUAUGUUCAUUUAUACUGAAGAAAACCUAUGUGUUUUUUCUUUUUGUACAUAUCGAGACGAUUUUUGCGUCGUUUUACACGGGGAUAAAAUAACAGUUCGAUUUUUGAAAUAAAAAAAUGUAUUUAUUAGCGCGUUAAUCGUUU.
[0125] Nucleotide sequence of the coding gene of dsActin (SEQ ID NO.25):
[0126] CCAGGTATTGCCGACAGAATGCAAAAGGAAATCACCGCCTTGGCTCCAAGCACAATCAAGATCAAGATCATTGCCCCACCAGAACGTAAATACTCCGTATGGATCGGTGGTTCCATCTTGGCTTCTCTGTCCACCTTCCAACAGATGTGGATCTCCAAACAAGAATACGACGAATCCGGCCCAGGCATTGTCCACCGTAAATGCTTCTAAGTCATCACCTCCCACAACATACAAAATCAAAATTACAATCACGCTTTATGTTCATTTATACTGAAGAAAACCTATGTGTTTTTTCTTTTTGTACATATCGAGACGATTTTTGCGTCGTTTTACACGGGGATAAAATAACAGTTCGATTTTTGAAATAAAAAAATGTATTTATTAGCGCGTTAATCGTTT。
[0127] Fusion dsRNA (i.e., dsFusion-Actin + ELAV, SEQ ID NO.26):
[0128] UCCCGUUUAUAAAACCGCCGGUACCGACCAGCAGAACGUUCAUUAGCACAUCCACAGCGGAUCAGCAGCCACACACUAGCCGCAGACCCGCCGCAGUCGUACAGAUUUCCUUCGUCGUAAACCGGUUCAAAAACCCAAACCAGCAAAAUGUGUGACGAUGAUGUAGCAGCUUUGGUAGUCGACAAUGGCUCCGGUAUGUGCAAUUUGUGGGAAAUACUGGAGGAGAUCAUUCGCCGUCAAUUUCAAAAGGUGUUGGUUUUAUAAGAUUUGAUCAAAGAAUUGAAGCCGAACGAGCAAUUCAAGAAUUAAAUGGAACUGUUCCCAAAGGUUCAACAGAAUCAAUUACUGUGAAGUUCGCCAAUAAUCCUAGUAGCAAUAAAGCAGUACCUGCAUUAGCAGC。
[0129] Nucleotide sequence of the coding gene of the fusion dsRNA (SEQ ID NO.27):
[0130] TCCCGTTTATAAAACCGCCGGTACCGACCAGCAGAACGTTCATTAGCACATCCACAGCGGATCAGCAGCCACACACTAGCCGCAGACCCGCCGCAGTCGTACAGATTTCCTTCGTCGTAAACCGGTTCAAAAACCCAAACCAGCAAAATGTGTGACGATGATGTAGCAGCTTTGGTAGTCGACAATGGCTCCGGTATGTGCAATTTGTGGGAAATACTGGAGGAGATCATTCGCCGTCAATTTCAAAAGGTGTTGGTTTTATAAGATTTGATCAAAGAATTGAAGCCGAACGAGCAATTCAAGAATTAAATGGAACTGTTCCCAAAGGTTCAACAGAATCAATTACTGTGAAGTTCGCCAATAATCCTAGTAGCAATAAAGCAGTACCTGCATTAGCAGC。
[0131] After dissolving dsRNA in ddH2O, it was mixed with the liquid artificial diet at a volume ratio of 1:3, so that the concentration of dsRNA in it was 500 ng / ul. Adult aphids were picked (20 aphids of Megoura crassicauda, Aphis craccivora and Myzus persicae were picked for each device; 15 aphids of Acyrthosiphon pisum were picked for each device) and placed in the feeding device to feed. The mortality rate was counted every 12 hours, and the mortality rate for a total of 72 hours was counted. There were 6 biological replicates for each treatment.
[0132] The results are as Figures 2-5 shown. After treating Megoura crassicauda, Acyrthosiphon pisum, Aphis craccivora and Myzus persicae with the dsRNA fusion ( Figures 2-5 labeled as dsFusion in
[0133] by the dsRNA delivery method mediated by the artificial diet method, the mortality rates were 72.500%, 87.778%, 70.833%, 69.167%, and the corrected mortality rates reached 50.000%, 48.891%, 46.667% and 54.167%. Moreover, the mortality rates of aphids treated with the dsRNA fusion were all higher than those treated with the dsRNA targeting a single gene (dsELAV and dsActin). The dsRNA fusion of the present invention can control multiple different aphids simultaneously, has a high lethality rate, and has good application prospects.
Claims
1. A dsRNA for controlling aphids, characterized in that: The dsRNA targets the aphid Actin gene and / or the ELAV-like protein gene and is obtained by transcription using the aphid actin Actin gene and / or the ELAV-like protein gene as a template.
2. The dsRNA for controlling aphids according to claim 1, characterized in that: The dsRNA is selected from dsActin, dsELAV, and fusion dsRNA, wherein the fusion dsRNA is a dsRNA that simultaneously targets the actin gene and the ELAV-like protein gene; The dsELAV nucleotide sequence is shown in SEQ ID NO.15; The dsActin nucleotide sequence is shown in SEQ ID NO.24; The fusion dsRNA nucleotide sequence is shown in SEQ ID NO.
26.
3. A gene encoding the dsRNA according to claim 2, characterized in that: The nucleotide sequence of the gene encoding dsELAV as shown in SEQ ID NO.15 is shown in SEQ ID NO.16; The nucleotide sequence of the gene encoding dsActin as shown in SEQ ID NO.24 is shown in SEQ ID NO.25; The nucleotide sequence of the gene encoding the fusion dsRNA shown in SEQ ID NO.26 is shown in SEQ ID NO.
27.
4. Any of the following uses of the dsRNA according to claim 1 or 2 or the gene encoding the dsRNA according to claim 3: 1) Use in controlling aphids or in preparing aphid controlling products; 2) Use in promoting the death of aphids or in preparing products promoting the death of aphids; 3) Use in inhibiting the growth of aphids or in preparing products for inhibiting the growth of aphids; 4) Use in inhibiting the expression of genes corresponding to dsRNA in aphids, or use in preparing products for inhibiting the expression of genes corresponding to dsRNA in aphids.
5. The use according to claim 4, characterized in that: The application is to introduce the dsRNA described in claim 1 or 2 into aphids to inhibit the growth of aphids and reduce the survival rate of aphids, thereby achieving the prevention and control of aphids.
6. The use according to claim 5, characterized in that: The dsRNA is introduced by feeding aphids with dsRNA.
7. The use according to claim 6, characterized in that: The dsRNA is mixed with liquid feed until the concentration of the fused dsRNA is 300 to 1000 ng / μL, and then the mixture is fed to aphids.
8. A recombinant expression vector, recombinant bacterium or expression cassette containing the gene encoding the dsRNA according to claim 1 or 2 or the dsRNA according to claim 3.
9. Any of the following uses of the recombinant expression vector, recombinant bacteria or expression cassette according to claim 8: 1) Use in controlling aphids or in preparing aphid controlling products; 2) Use in promoting the death of aphids or in preparing products promoting the death of aphids; 3) Use in inhibiting the growth of aphids or in preparing products for inhibiting the growth of aphids; 4) Use in inhibiting the expression of genes corresponding to dsRNA in aphids, or use in preparing products for inhibiting the expression of genes corresponding to dsRNA in aphids.
10. The use according to claim 4 or 9, characterized in that: The aphids include Megoura crassicauda, Aphis spiraecola, Aphis craccivora, Aphis citricidus, Myzus persicae, Acyrthosiphonpisum, Melanaphis sacchari, Diuraphis noxia, Rhopalosiphumpadi, Metopolophium dirhodum, Sitobion avenae, Schizaphis graminum, Aphis gossypii, Rhopalosiphum maidis and Lipaphis erysimi. Preferably, the aphids are Pseudocerus pisum, Pseudocerus pea, Pseudocerus persicae and Pseudocerus junceus.
Citation Information
Cited By
Method for preventing and treating aphis citricola by dsRNA fusion fragment
CN120665872A
DsRNA targeting multiple aphids, hydrotalcite nano preparation thereof and application of dsRNA and hydrotalcite nano preparation
CN122278845A