Promoter mutant of bacillus subtilis and application

Abstract

The invention discloses a promoter mutant of bacillus subtilis and application thereof, and belongs to the technical field of biotechnology and genetic engineering. The invention aims to improve the activity of a promoter of bacillus subtilis. The invention provides a promoter mutant of bacillus subtilis, and the mutant is obtained by taking a promoter gene as shown in SEQ ID NO.1 as a starting gene and carrying out site single-base or multi-base mutation. When the high-activity promoter Psrf mutant is used for mediating alpha-amylase expression, the enzyme activity is greatly improved, and the promoter Psrf mutant has excellent performance in a heterologous expression system, has certain universality and has a wide application prospect in the field of industrial production.

Description

Technical Field

[0001] The present invention belongs to the technical fields of biotechnology and genetic engineering, and particularly relates to a promoter mutant of Bacillus subtilis and its application. Background Art

[0002] As a Gram-positive bacterium, Bacillus subtilis has become a preferred strain for microbial cell factories due to its excellent extracellular protein secretion ability and widely recognized safety. It plays an important role in many fields such as agriculture, industrial food, and medicine. Especially in the prokaryotic expression system, Bacillus subtilis is an ideal host for expressing and secreting foreign proteins and is regarded as an important model strain.

[0003] A promoter is a specific DNA sequence recognized, bound, and initiated by RNA polymerase, which plays a decisive role in the intensity and timing of gene expression. In Bacillus subtilis, as a key regulatory element for gene expression, the activity of the promoter directly affects the expression efficiency of foreign proteins. At present, the research mainly focuses on the rational modification of the -35 and -10 regions of the promoter in order to obtain a promoter with high activity. However, the effect of this modification method in other regions is limited. The self-inducible promoter Psrf in Bacillus subtilis is a promoter activated under the quorum sensing (QS) mechanism and is widely used in gene expression regulation. There are relatively few studies on the irrational screening to obtain high-activity mutants. In addition, compared with Gram-negative Escherichia coli, it is more difficult to establish a system for screening expression elements such as promoters in Gram-positive Bacillus subtilis. Summary of the Invention

[0004] The purpose of the present invention is to improve the activity of the promoter of Bacillus subtilis.

[0005] The present invention provides a promoter mutant of Bacillus subtilis, which is obtained by mutating at positions 20, 25, 37, 40, 57, 116, 216, 217, 250, 281, 282, 286, 295, 296, 304, 323, 385, 424, or 546 of the promoter gene shown in SEQ ID NO.1 or adding a base at position 385.

[0006] Further defined, the sequence of the mutant is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, or SEQ ID NO.7.

[0007] The present invention provides a recombinant vector containing the above promoter mutant.

[0008] The present invention provides a recombinant host cell containing the above-mentioned promoter mutant.

[0009] The present invention provides an application of the above-mentioned promoter mutant, the above-mentioned recombinant vector or the above-mentioned recombinant host cell in any one of the following:

[0010] (a) Enhancing the transcriptional level of a gene, or preparing a reagent or kit for enhancing the transcriptional level of a gene;

[0011] (b) Preparing a protein, or preparing a reagent or kit for preparing a protein;

[0012] (c) Producing a target compound, or preparing a reagent or kit for producing a target compound.

[0013] Further defined, the protein is selected from at least one of a gene expression regulatory protein, a protein related to the synthesis of a target compound, and a protein related to membrane transport.

[0014] The present invention provides a nucleic acid molecule, which contains the above-mentioned promoter mutant.

[0015] Further defined, it also includes the coding gene of α-amylase or the coding gene of arginine transiminase.

[0016] The present invention provides a recombinant vector or a recombinant host cell containing the above-mentioned nucleic acid molecule.

[0017] The present invention provides an application of the above-mentioned nucleic acid molecule, the above-mentioned recombinant vector or the above-mentioned recombinant host cell in improving the enzyme activity of an expressed protein.

[0018] Advantageous effects: A highly active promoter Psrf mutant was screened, and the corresponding expression vector and recombinant expression strain were constructed. The nucleic acid molecule with enhanced promoter activity provided by the present invention exhibits higher promoter activity than the wild type and can be used for the expression of target genes. For example, when operably linked to the α-amylase gene, it can enhance the expression intensity of α-amylase, and when operably linked to the ADI gene, it can enhance the expression intensity of ADI, improving the amino acid production efficiency of the recombinant strain and the expression efficiency of foreign proteins. Description of the Drawings

[0019] Figure 1 : Nucleic acid electrophoresis diagram of obtaining the promoter Psrf fragment by PCR;

[0020] Figure 2 : Map of plasmid pBE-Psrf-SPapre-amyE;

[0021] Figure 3: α - starch plate screening diagram. Detailed implementation method

[0022] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used to implement or test the present invention, the methods and materials described herein are preferred.

[0023] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental techniques and methods used in this embodiment are all conventional technical methods without special instructions. For example, the experimental methods without specific conditions in the following embodiments are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the embodiments can be obtained through regular commercial channels without special instructions.

[0024] The culture media used in the embodiments are as follows:

[0025] LB culture medium: Yeast extract 5 g / L, Peptone 10 g / L, Nacl 10 g / L.

[0026] LB solid starch plate: Yeast extract 5 g / L, Peptone 10 g / L, Nacl 10 g / L, Agar powder 20 g / L, Soluble starch 20 g / L.

[0027] TB culture medium: Glycerol 5 g / L, Peptone 12 g / L, Yeast extract 24 g / L, Dipotassium hydrogen phosphate 12.54 g / L, Potassium dihydrogen phosphate 2.31 g / L.

[0028] RM culture medium: Mannitol 90 g / L, Sorbitol 90 g / L, Nacl 10 g / L, Peptone 10 g / L.

[0029] All culture media were sterilized at 121 °C for 20 min in an autoclave, and the corresponding antibiotics were added during the use of the culture media.

[0030] Example 1. Construction of recombinant plasmid

[0031] (1) Using the genome of Bacillus subtilis 168 as a template, the target promoter Psrf fragment was obtained by PCR technology. The specific nucleotide sequence is shown as SEQ ID NO: 1 below. The specific PCR reaction system is as follows: 2 μL of Bacillus subtilis 168 genomic template (110 ng / μL), 2 μL of upstream primer Psrf-kpnI-F: CGG GGTACC ATCGACAAAAATGTCATGA (SEQ ID NO.8) (the underlined bases are the kpnI restriction enzyme sites), 2 μL of downstream primer Psrf-xhoI-R CCG CTCGAG ATTGTCATACCTCCCCTAATC (SEQ ID NO.9) (the underlined bases are the xhoI restriction enzyme sites), 25 μL of 2×Prime STAR Max DNA polymerase, and sterile water was added to make up to 50 μL. The PCR reaction program is as follows: PCR amplification program: pre-denaturation at 98 °C for 3 min, denaturation at 98 °C for 10 s, annealing at 58 °C for 5 s, extension at 72 °C for 60 s, 30 cycles, and finally extension at 72 °C for 5 min. Take 3 μL of the Psrf promoter fragment PCR product for nucleic acid verification. The target band has a target size of 606 bp, and the size is correct as Figure 1 shown.

[0032] (2) Using pBE-kpnI-xhoI-SPapre-amyE

[0033] The commercial original plasmid pBE-S was purchased from B.subtilis Secretory Protein Expression; CAT#3380. The amyE gene was synthesized between the two restriction endonucleases HindIII and SaLI of the plasmid pBE-S by Sangon Biotech Co., Ltd. Thus, the initial plasmid pBE-kpnI-xhoI-SPapre-amyE was obtained. SPapre represents a signal peptide that can assist the mediated protein to be secreted extracellularly, and amyE represents an amylase gene, and amylase can hydrolyze starch. The initial plasmid was cut and linearized using the restriction endonucleases KpnI and xhoI. The specific double digestion system is as follows: 1 μL of KpnI, 1 μL of XhoI, 3 μL of 10×M buffer, 5 μL of the initial plasmid, and sterile water was added to make up the system to 30 μL, and incubated in a 37 °C water bath for 1 h. After double digestion of the plasmid, agarose gel electrophoresis verification was carried out, and the linearized plasmid fragment pBE-KpnI-XhoI-SPapre-amyE was recovered using the Omega agarose gel recovery kit.

[0034] (3) The Psrf promoter fragment obtained by the above PCR was digested with the same restriction enzymes KpnI and XhoI. The specific process was the same as the linearization digestion of plasmid pBE-KpnI-XhoI-SPapre-amyE. The plasmid fragment and the promoter Psrf fragment were ligated. The specific ligation system was as follows: 3 μL of plasmid pBE-kpnI-xhoI-SPapre-amyE fragment, 3 μL of promoter Psrf fragment, 1 μL of T4 ligase, 1 μL of T4 ligase buffer, and 2 μL of sterile water. Ligation was carried out at 16 °C for 2 h. Subsequently, the ligation product of the promoter Psrf fragment and the plasmid pBE-kpnI-xhoI-SPapre-amyE fragment was transformed into DH5α competent cells. After heat shock at 42 °C for 60 s, 1 mL of LB liquid medium was added and cultured in a shaker at 37 °C and 200 rpm for 45 min. It was evenly spread on an LB solid medium containing 50 μg / mL ampicillin and cultured overnight in an inverted position in a 37 °C incubator. Single colonies were picked, verified by colony PCR and sent to the company for sequencing. The strains with correct sequencing were picked for culture, and plasmids were extracted to obtain the recombinant plasmid pBE-kpnI-Psrf-xhoI-SPapre-amyE. The map is as Figure 2 shown.

[0035] Example 2. Establishment of a promoter Psrf mutant library

[0036] Introducing manganese ions into the PCR system can increase the mutation rate of PCR products. Therefore, manganese ions were added to the reaction system for obtaining the promoter Psrf fragment by PCR to obtain the promoter Psrf mutants. The specific process was as follows: 2 μL of Bacillus subtilis 168 genomic template (110 ng / μL), 2 μL of upstream primer Psrf-kpnI-F CGG GGTACC ATCGACAAAAAT GTCATGA, 2 μL of downstream primer Psrf-xhoI-R CCG CTCGAG ATTGTCATACCTCCCCTAATC, 25 μL of DNA polymerase 2×Prime STARMax DNA, 2 μL of manganese ion solution (the final concentration of manganese ions in the reaction system was 0.1 mM), and sterile water was added to make up to 50 μL. The PCR reaction program was as follows: PCR amplification program: pre-denaturation at 98 °C for 3 min, denaturation at 98 °C for 10 s, annealing at 58 °C for 5 s, extension at 72 °C for 60 s, 30 cycles, and finally extension at 72 °C for 5 min to obtain a randomly mutated promoter Psrf nucleotide sequence fragment.

[0037] The plasmid pBE-kpnI-xhoI-SPapre-amyE and the randomly mutated promoter Psrf nucleotide sequence fragment were double-digested with KpnI and XhoI. Subsequently, these two fragments were ligated with T4 ligase, and then the ligation product was transformed into DH5α competent cells. After heat shock, it was spread on an LB solid plate containing 50 μg / mL kanamycin to obtain different monoclonal strains. These operating steps refer to the process of constructing the recombinant plasmid pBE-kpnI-Psrf-xhoI-SPapre-amyE in Case 1. Finally, the monoclonal bacteria on the solid plate were washed off with liquid LB and cultured in a shaker at 37 °C and 200 rpm for 2 h, and then the plasmid was extracted to obtain the mixed recombinant plasmid pBE-kpnI-Psrf*-xhoI-SPapre-amyE containing the mutated promoter Psrf nucleotide sequence (Psrf* represents the mutant of Psrf), which served as the promoter Psrf mutant library to prepare for screening a promoter Psrf with strong activity in the later stage.

[0038] Example 3. Screening for mutants of promoter Psrf with strong activity

[0039] (1) Screening for mutants of the dominant promoter Psrf with strong activity using a starch plate. The mixed recombinant plasmid pBE-kpnI-Psrf*-xhoI-SPapre-amyE obtained in Case 2 was transformed into Bacillus subtilis WB600 competent cells. The process was as follows: Take the Bacillus subtilis WB600 competent cells from the -80 °C refrigerator and place them on ice for 10 min until they melted. At the same time, pre-cool the electroporated mixed plasmid on ice;

[0040] (2) Take an appropriate amount of plasmid (about 1 μg, and its volume does not exceed 10% of the volume of the competent cells), mix it well with the Bacillus subtilis WB600 competent cells, and let it stand on ice for 20 min;

[0041] (3) Transfer the mixture to a pre-cooled electrode cup with a diameter of 2 mm, adjust the electroporator equipment to 25 μF, 200 Ω, and 2400 v for electroshock to penetrate the cell membrane with high voltage, and the plasmid enters the competent cells. Immediately add 1 mL of RM medium, pipette and mix well, then transfer it to a 1.5 mL EP tube and culture it in a shaker at 37 °C and 200 rpm for 3 h; (4) Centrifuge the revived bacterial solution at 3000 - 4000 rpm for 3 - 5 min, discard part of the supernatant, resuspend it and spread it on an LB solid medium plate containing kanamycin antibiotic, and culture it in an incubator at 37 °C for 10 - 12 h to grow single colonies, which serve as the experimental group. The control experiment was to transform the recombinant plasmid pBE-KpnI-Psrf-XhoI-SPapre-amyE containing the wild-type promoter Psrf into Bacillus subtilis WB600, and the steps were the same as those of the above experimental group.

[0042] (4) Since Bacillus subtilis WB600 / pBE-KpnI-Psrf-XhoI-SPapre-amyE contains the amylase gene amyE (amyE is used as a reporter gene), it secretes amylase AmyE during the culture process. Amylase can hydrolyze starch. Therefore, according to the size of the clear zone around the monoclonal WB600 / pBE-KpnI-Psrf*-XhoI-SPapre-amyE on the starch plate (LB solid + 10% starch), the activity of the promoter Psrf mutants can be judged. Select the monoclonal on the experimental group starch plate with a larger clear zone than the control group, as Figure 3 shown. Ten mutant strains with a larger clear zone than the control group were screened out from about 2,000 monoclonal strains, numbered M1, M2, M3, M4, M5, and M6.

[0043] (5) Perform shake flask fermentation verification. First, the above-mentioned dominant mutant strains M1-M6 obtained by primary screening on the starch plate were transferred to 50 mL Erlenmeyer flasks containing 5 mL LB for activation and cultured in a shaker at 37 °C and 200 rpm for 10 h. Secondly, 1 mL of the bacterial solution was transferred to a 250 mL Erlenmeyer flask containing 50 mL of TB and cultured in a shaker at 37 °C and 200 rpm for 36 h. Detect OD 600 , centrifuge the fermentation broth to obtain the fermentation supernatant, and detect the amylase activity of amylase AmyE in the fermentation supernatant. Define the enzyme activity of the control strain D0 (WB600 / pBE-KpnI-Psrf-XhoI-SPapre-amyE) as 100%. The relative enzyme activity values corresponding to the other mutants are shown in Table 1. The relative enzyme activities of mutant strains M1, M2, M3, M4, M5, and M6 are 50.3%, 11.2%, 33.5%, 21.2%, 61.6%, and 13.6% higher than that of the control group D0, respectively. In addition, the enzyme activities per unit OD 600 of these mutant strains are 55.9%, 14.0%, 36.8%, 21.2%, 57.9%, and 11.0% higher than that of the control group, respectively.

[0044] Table 1 α-Amylase activity of different mutants verified by shake flask

[0045]

[0046] Extract the recombinant plasmids of strains M1-M6 and send them to Sangon for sequencing. The results are as follows. The corresponding nucleotide sequences of M1, M3, M4, and M5 are SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively.

[0047] Method for detecting amylase activity. Use 1% soluble starch solution as the substrate for α-amylase activity determination; use 20 mmol / L, pH 6.0 phosphate buffer as the buffer for enzyme activity measurement. Add 1 mL of the substrate and 900 μL of the buffer into a 15 mL stoppered test tube respectively, mix well and place in a water bath at 70 °C for 10 min. After appropriately diluting the enzyme solution to be tested with the buffer, take 100 μL of the diluted enzyme solution and add it to the stoppered test tube containing the substrate and the buffer, and immediately shake well. After reacting at 70 °C for 5 min, immediately add 3 mL of DNS (3,5-dinitrosalicylic acid reagent) and shake well. Place the stoppered test tube in a boiling water bath for 7 min and then immediately cool it in ice water. After ice-water bath for 3 - 5 min, add 10 mL of deionized water to the stoppered test tube and mix well. Use a spectrophotometer to measure the absorbance value of the reaction solution at a wavelength of 540 nm. Under the above conditions, the amount of enzyme required to release 1 μL of glucose equivalent reducing sugar per minute is 1 enzyme activity unit (U).

[0048] Example 4. Verification of the universality of the dominant mutant promoter Psrf and its application in citrulline production

[0049] To verify the universality of the promoters corresponding to the above mutants M1, M2, M3, M4, M5 and M6 and their application in citrulline production, the ADI gene (accession number: A0A7C9JRK1) from Muribaculaceae bacterium Z82 was constructed by double digestion with HindⅢ and SalI and ligation with T4 ligase, and the recombinant plasmids pBE-kpnI-m1Psrf-xhoI-SPapre-HindⅢ-ADI-SalIpBE-kpnI-m3Psrf-xhoI-SPapre-HindⅢ-ADI-Sal I, pBE-kpnI-m4Psrf-xhoI-SPapre-HindⅢ-ADI-SalI,

[0050] pBE-kpnI-m5Psrf-xhoI-SPapre-HindⅢ-ADI-SalI, where m1Psrf, m2Psrf, m3Psrf, m4Psrf, m5Psrf and m6Psrf represent the promoter Psrf mutant sequences corresponding to strains M1, M2, M3, M4, M5 and M6 respectively. The plasmid was transformed into Bacillus subtilis WB600 [Bacillus subtilis WB600 is a defective strain obtained by genetic engineering transformation of wild-type Bacillus subtilis. Bacillus subtilis WB600, which precisely knocked out 6 protease genes (aprE, nprE, epr, mpr, bpr, vpr) from the genome of Bacillus subtilis 168, significantly reduced extracellular protease activity and is a commercial strain. It is recorded in the literature Engineering a Bacillus subtilis Expression-Secretion System with a Strain Deficient in Six Extracellular Proteases], and they are the recombinant strains of experimental groups 1, 2, 3, 4, 5 and 6 respectively; the plasmid pBE-kpnI-Psrf-xhoI-SPapre-HindⅢ-ADI-SalI was transformed into Bacillus subtilis WB600 as the control strain. Verified by shake-flask fermentation, the results are shown in Table 2. The relative enzyme activity / OD in experimental groups 1-6 600 was increased by 36.4%, 11.1%, 25.6%, 18.4%, 28.6% and 8.9% compared with the control group, indicating that the promoter Psrf mutant is beneficial to the recombinant expression of the ADI enzyme gene. At the same time, it shows that the promoter Psrf mutant has a certain generality and can be used for the efficient production of citrulline. The host cells of the mutated promoter were verified on Bacillus licheniformis and it can also be achieved.

[0051] Definition of ADI enzyme activity: Using the crude enzyme solution or purified protease, under the conditions of pH 6.0, 37 °C, and arginine concentration of 100 g / L, the conversion of 1.0 μmol L arginine into 1.0 μmol L citrulline within 1 minute is defined as one enzyme activity unit U; Enzyme activity assay method: In a sodium phosphate buffer (0.2 mol / L, pH 6.0) with an arginine concentration of 100 g / L, at 37 °C and 200 rpm, add 1 mL of the crude enzyme solution and react for 10 min. After the reaction is completed, terminate the reaction in a boiling water bath for 5 min, centrifuge to remove the precipitate, and take the reaction solution for liquid phase detection.

[0052] Calculation of enzyme activity: According to the liquid phase detection results, use the following formula to calculate the enzyme activity:

[0053] X = (W1 × S × (A1 - A0) × n × 1000 × V) / (W2 × A × M × 175.19 × 10) Where: W1 represents the mass (mg) of the citrulline reference substance; S represents the content of the citrulline reference substance; A1 represents the area of citrulline after 10 minutes of reaction; A0 represents the area of citrulline after 5 minutes of reaction; n represents the dilution factor of the reaction solution; V represents the final volume of the reaction system; W2 represents the weight (g) of the protein in the purified liquid enzyme; A represents the area of the citrulline reference substance; M represents the dilution factor of the reference substance citrulline; 175.19 represents the molecular weight of citrulline; 10 represents the time interval (min) between two samplings; 1000 represents the conversion coefficient for μM.

[0054] Table 2: Effects of Promoter Psrf Mutants on the Recombinant Expression of ADI Enzyme Activity in Strains

[0055]

[0056] SEQ ID NO: 1

[0057] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0058] SEQ ID NO: 2

[0059] ATCGACAAAAATGTCATGA G AGAA C CGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATT CA TTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0060] SEQ ID NO: 3

[0061] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTG TATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGC C TCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAG T TAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0062] SEQ ID NO:4

[0063] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGAC T CT A TTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGAT TAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0064] SEQ ID NO: 5ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTT A TTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTC AC TGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTC CC GCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0065] SEQ ID NO: 6

[0066] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAAAAATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATT A AAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTG G CTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATAAGAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT;

[0067] SEQ ID NO: 7

[0068] ATCGACAAAAATGTCATGAAAGAATCGTTGTAAGACGCTCTTCGCAAGGGTGTCTTTTTTTGCCTTTTTTTCGGTTTTTGCGCGGTACACATAGTCATGTAAAGATTGTAAATTGCATTCAGCAATAAAAAAAGATTGAACGCAGCAGTTTGGTTTAAAAATTTTTATTTTTCTGTAAATAATGTTTAGTGGAAATGATTGCGGCATCCCGCAAA GCATATTGCTGTAAATAAACTGGAATCTTTCGGCATCCCGCATGAAACTTTTCACCCATTTTTCGGTGATAAAAACATTTTTTTCATTTAAACTGAACGGTAGAAAGATAAAAAATATTGAAAACAATGAATAAATAGCCAAAATTGGTTTCTTATTAGGGTGGGGTCTTGCGGTCTTTATCCGCTTATGTTAAACGCCGCAATGCTGACTGACGGCAGCCTGCTTTAATAGCGGCCATCTGTTTTTTGATTGGAAGCACTGCTTTTTAAGTGTAGTACTTTGGGCTATTTCGGCTGTTAGTTCATAAGAATTAAAAGCTGATATGGATA T GAAAGAGAAAATGCGTTGCACATGTTCACTGCTTATAAAGATTAGGGGAGGTATGACAAT。

Claims

1. A promoter mutant of Bacillus subtilis, characterized in that: The mutant is obtained by using the promoter gene shown in SEQ ID NO.1 as the starting gene, and mutating at position 20, 25, 37, 40, 57, 116, 216, 217, 250, 281, 282, 286, 295, 296, 304, 323, 385, 424 or 546 or adding a base at position 385.

2. The promoter mutant according to claim 1, characterized in that The sequence of the mutant is shown in SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO.

7.

3. A recombinant vector containing the promoter mutant according to claim 1 or 2.

4. A recombinant host cell containing the promoter mutant according to claim 1 or 2.

5. Use of the promoter mutant according to claim 1 or 2, the recombinant vector according to claim 3 or the recombinant host cell according to claim 4 in any of the following: (a) enhancing the transcription level of a gene, or preparing a reagent or kit for enhancing the transcription level of a gene; (b) preparing a protein, or preparing a reagent or kit for preparing a protein; (c) producing a target compound, or preparing a reagent or kit for producing a target compound.

6. The use according to claim 5, characterized in that: The protein is selected from at least one of a gene expression regulatory protein, a protein related to the synthesis of a target compound, and a protein related to membrane transport.

7. A nucleic acid molecule, characterized in that The nucleic acid molecule comprises the promoter mutant according to claim 1 or 2.

8. The nucleic acid molecule according to claim 7, characterized in that Also included are genes encoding α-amylase or arginine transiminase.

9. A recombinant vector or recombinant host cell containing the nucleic acid molecule according to claim 8.

10. Use of the nucleic acid molecule according to claim 7 or the recombinant vector or recombinant host cell according to claim 8 in improving the enzyme activity of expressed proteins.

Images