Gene for regulating skeletal muscle differentiation and muscle fiber type conversion and application thereof

Abstract

The invention discloses a gene for regulating skeletal muscle differentiation and muscle fiber type conversion and application thereof, and relates to the technical field of biology. The nucleotide sequence of the gene is as shown in SEQ ID NO. 1. Experiments prove that the MSS51 gene promotes skeletal muscle differentiation and accelerates conversion from rapid glycolytic muscle fibers to slow oxidation muscle fibers. In addition, the YTHDF2 and the IGF2BP2 are remarkably and highly expressed in the solefish muscle tissue. Therefore, YTHDF2 or IGF2BP2 is supposed to be combined with the m6A peak of the MSS513 '-UTR region in a targeted manner and promote the stability of MSS51, and finally the differentiation and muscle fiber transformation of skeletal muscles are regulated and controlled. The invention provides a new insight for gene epigenetics in muscle fiber type conversion, and preliminarily reveals the meat yield and the genetic and regulation mechanism of the meat quality.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and particularly to genes for regulating skeletal muscle differentiation and muscle fiber type conversion and their applications. Background Art

[0002] Skeletal muscle is an important organ for maintaining the body's energy metabolism and movement, and is composed of muscle fibers with different metabolic characteristics and contraction speeds. According to the contraction speed and metabolic characteristics, muscle fibers can be divided into slow oxidative type and fast glycolytic type. Based on myosin heavy chain (MyHC), muscle fibers are divided into four types, including type I, type IIa, type IIx, and type IIb. Beef is rich in nutrition and delicious, and its quality and flavor determine consumers' purchasing decisions. Therefore, improving beef quality is an important goal in meat production. Factors affecting meat quality include breed, age, feed, and slaughter conditions. In addition, different muscle fiber types also determine muscle quality, including tenderness, pH value, water-holding capacity, and intramuscular fat content. It has been found that after slaughter, the glycolysis rate of type I muscle fibers is slower, and the pH value drops less, which increases the stability of myogenin in beef, improves the water-holding capacity, and ultimately makes the beef of type I muscle fibers have better tenderness and juiciness. In chicken, the contraction speed and glycolysis rate of type IIb muscle fibers are faster, resulting in higher shear force and water loss ability than type I muscle fibers, and thus poorer redness and tenderness. Therefore, studying the regulatory mechanism of muscle fiber type conversion during skeletal muscle development will help improve meat quality.

[0003] RNAm 6 A methylation is a common epigenetic modification in eukaryotes. m 6 A methylation has a highly conserved motif sequence (RRACH: R = A, G or U; R = A or G; H = A, C or U), and is mainly enriched in the 3'-UTR and CDS regions of mRNA. m 6 A modification is related to RNA metabolic processes, including RNA transcription, processing, translation, and stability. Research has shown that m 6 A methylation is involved in disease occurrence and embryonic development. For example, METTL3 mediates the m 6 A modification of the PDE3A gene by activating YTHDF3, accelerating the inactivation of the AKT / mTOR signaling pathway, and thus inhibiting the proliferation and metastasis of human cervical cancer cells. METTL5 regulates porcine early embryonic development by regulating CDX2 translation. In addition, m 6 A methylation modification also plays a key role in skeletal muscle development. For example, FTO regulates the expression of the DAG1 gene through m 6 A modification, thereby promoting the proliferation of goat skeletal muscle satellite cells. Knockdown of FTO and METTL3 promotes the proliferation of bovine myoblasts and inhibits differentiation, while knockdown of ALKBH5 inhibits the proliferation of bovine myoblasts and promotes differentiation and apoptosis.

[0004] With the development of sequencing technology, MeRIP-seq has been gradually applied to the research of slow oxidative and fast glycolytic muscle fibers. For example, MeRIP-seq and RNA-seq analyses have revealed that alternative splicing of pre-mRNA in different muscle fiber types is regulated by m 6 A methylation. Studying the regulatory mechanism of m 6 A modification on lncRNA in oxidative and glycolytic muscle fibers, the results show that 305 m 6 A-modified lncRNAs are differentially expressed in type I and type IIb muscle fibers, and lncRNA MSTRG.14200.1 promotes satellite cell differentiation and stimulates the transformation of muscle fibers from slow type to fast type. However, the research on m 6 A modification in the type conversion of bovine slow oxidative and fast glycolytic muscle fibers is still lacking. Summary of the Invention

[0005] The object of the present invention is to provide genes for regulating skeletal muscle differentiation and muscle fiber type conversion and their applications to solve the problems existing in the above-mentioned prior art. The gene has the function of regulating bovine skeletal muscle differentiation and / or muscle fiber type conversion.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a gene for regulating bovine skeletal muscle differentiation and muscle fiber type conversion, and the nucleotide sequence of the gene is shown as SEQ ID NO.1.

[0008] The present invention also provides the application of the above gene in regulating bovine skeletal muscle differentiation and / or muscle fiber type conversion, and by up-regulating the expression level of the gene, to promote bovine skeletal muscle differentiation and / or accelerate the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers.

[0009] The present invention also provides a biological material for promoting bovine skeletal muscle differentiation and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, and the biological material is a recombinant vector overexpressing the above gene.

[0010] Further, the recombinant vector is constructed by ligating the nucleotide sequence shown as SEQ ID NO.1 to the PMD 19-T Vector.

[0011] The present invention also provides a biological material for inhibiting bovine skeletal muscle differentiation and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, and the biological material is a recombinant vector inhibiting the expression of the above gene.

[0012] Further, the preparation method of the recombinant vector includes the following steps:

[0013] Anneal the forward oligonucleotide strand and the reverse oligonucleotide strand and insert them into the pRI vector to obtain the recombinant vector;

[0014] The nucleotide sequence of the forward oligonucleotide strand is shown in SEQ ID NO.4;

[0015] The nucleotide sequence of the reverse oligonucleotide strand is shown in SEQ ID NO.5.

[0016] The present invention also provides the application of a biomaterial for promoting bovine skeletal muscle differentiation and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers in promoting bovine skeletal muscle differentiation and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers.

[0017] The present invention also provides the application of a biomaterial for inhibiting bovine skeletal muscle differentiation and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers in inhibiting bovine skeletal muscle differentiation and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers.

[0018] The present invention also provides a method for promoting bovine skeletal muscle differentiation and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, including the step of introducing a biomaterial for promoting bovine skeletal muscle differentiation and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers into bovine skeletal muscle cells to overexpress the above-mentioned gene.

[0019] The present invention also provides a method for inhibiting bovine skeletal muscle differentiation and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, including the step of introducing a biomaterial for inhibiting bovine skeletal muscle differentiation and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers into bovine skeletal muscle cells to inhibit the expression of the above-mentioned gene.

[0020] The present invention discloses the following technical effects:

[0021] The present invention analyzed the meat quality and morphological characteristics of SOL and LG tissues. By RNA-seq and MeRIP-seq, the differentially expressed mRNAs and m 6 A methylation profiles in bovine slow oxidative and fast glycolytic skeletal muscles were constructed, and 20 m 6 A-modified mRNAs were identified to play a key role in skeletal muscle differentiation and muscle fiber type conversion. In addition, the present invention confirmed by experiments that the MSS51 gene promotes the differentiation of BSMSCs and accelerates the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers. In addition, YTHDF2 and IGF2BP2 were significantly highly expressed in the SOL tissue. Therefore, the present invention speculates that YTHDF2 or IGF2BP2 targets and binds to the m in the 3'-UTR region of MSS513'6 Peak A promotes the stability of MSS51, ultimately regulating the differentiation of BSMSCs and the transformation of muscle fiber types. The present invention provides new insights into gene epigenetics in muscle fiber type conversion and preliminarily reveals the genetic and regulatory mechanisms of meat yield and meat quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can be obtained based on these drawings.

[0023] Figure 1 Graphs of histomorphology and MyHC gene expression level analysis; among them, A is a representative image of immunofluorescence staining of MyHCI (green) and MyHCIIb (red) in LG and SOL muscle sections, scale bar: 100 μm; B is a statistical graph of the percentage of type I fibers in the LG and SOL tissue sections in Figure A; C is a statistical analysis graph of the cross-sectional area of muscle fibers; D is a statistical analysis graph of the diameter of muscle fibers; E is a statistical analysis graph of the density of muscle fibers; F is a statistical graph of the mRNA expression levels of MyHCI, MyHCIIa, and MyHCIIb in SOL and LG;

[0024] Figure 2 For m 6 A content and analysis results of the expression levels of m 6 A-related genes; among them, A is a statistical graph of the mRNA expression levels of m 6 A-related genes in LG and SOL; B is a WB detection result graph of m 6 A-related genes in LG and SOL; C is a statistical graph of the protein expression level in B; D is a colorimetric analysis of the m 6 A content of total RNA in LG and SOL; E is a dot blot analysis of the m 6 A content of total RNA in SOL and LG;

[0025] Figure 3 For the Venn diagram of m 6 A methylation genes in LG and SOL tissues;

[0026] Figure 4 For the distribution map of m 6 A peaks on transcripts in LG and SOL tissues;

[0027] Figure 5 For the statistical graph of the percentage of m 6 A peaks in transcripts in LG and SOL tissues;

[0028] Figure 6 Statistical chart of the number of peaks for each transcript;

[0029] Figure 7 For m in LG and SOL 6 Cumulative curve of A abundance;

[0030] Figure 8 For m in LG and SOL 6 Consensus motif of A peak;

[0031] Figure 9 For genes with or without m 6 Analysis chart of the expression abundance of A-modified genes in LG(A) and SOL(B);

[0032] Figure 10 Volcano plot of DMPs;

[0033] Figure 11 Volcano plot of DEGs annotated to DMPs;

[0034] Figure 12 Enrichment sites of DMPs on transcripts;

[0035] Figure 13 GO analysis chart of DEGs annotated to DMPs;

[0036] Figure 14 KEGG analysis chart of DEGs annotated to DMPs;

[0037] Figure 15 mRNA distribution chart of LG and SOL samples;

[0038] Figure 16 mRNA abundance chart of LG and SOL samples;

[0039] Figure 17 Volcano plot of DEGs;

[0040] Figure 18 Clustering chart of DEGs;

[0041] Figure 19 GO analysis chart of DEGs;

[0042] Figure 20 KEGG analysis chart of DEGs;

[0043] Figure 21 Venn diagram of DMGs and DEGs;

[0044] Figure 22 For genes with differential m 6 Quadrant chart of genes with A methylation and differential mRNA expression levels;

[0045] Figure 23 Distribution map of m 6 A peak in the CBR3 and MSS51 transcripts in the LG and SOL groups for IGV trajectory display;

[0046] Figure 24 For m 6 Results map of m 6 A enrichment verified by A-IP-qPCR;

[0047] Figure 25 Results map of RT-qPCR verification of DEGs in the LG and SOL groups;

[0048] Figure 26 Results map of the experiment on the differentiation of BSMSCs and the transformation of muscle fiber types by MSS51; among them, A is the expression level of MSS51 on the 2nd, 4th, 6th, and 8th days of BSMSC differentiation; B is the results map of the transfection efficiency analysis of MSS51; C is the mRNA expression level of differentiation and muscle fiber marker genes after transfection with OE-MSS51; D is the mRNA expression level of differentiation and muscle fiber marker genes after transfection with si-MSS51; E is the WB detection results after transfection with OE-MSS51 and si-MSS51; F is the protein expression level of differentiation marker genes after transfection with OE-MSS51; G is the protein expression level of differentiation marker genes after transfection with si-MSS51. Detailed implementation manners

[0049] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0050] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded from the range.

[0051] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although this invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of this invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the said documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0052] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific embodiments of the specification of the present invention, which will be obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention will be obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0053] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.

[0054] Term Explanation:

[0055] m 6 A, N6-methyladenosine; SOL, soleus muscle; LG, longissimus dorsi muscle; MeRIP-seq, methylated RNA immunoprecipitation sequencing; RNA-seq, RNA sequencing; DMGs, differentially methylated genes; DEGs, differentially expressed genes; DMPs, differentially methylated peaks; BSMSCs, bovine skeletal muscle satellite cells; MyHC, myosin heavy chain; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

[0056] Example 1

[0057] 1. Materials and Methods

[0058] 1.1 Ethical Statement

[0059] Animal experiments followed the guidelines established by the Chinese Animal Protection Committee, and the experimental procedures followed the standards of the Laboratory Animal Protection Association of Ningxia University (License No.: NXUC20230309).

[0060] 1.2 Tissue Collection

[0061] Randomly select 5 healthy castrated Simmental cattle with similar body weights (758.82 kg ± 24.57 kg) and similar ages (28 - 30 months) from the farm, and keep the feeding and management conditions consistent. After the cattle are fasted for 12 hours, electric shock and humane slaughter are carried out according to the cattle slaughtering procedure of GBT19477 - 2018. Immediately separate the soleus muscle (SOL, type I fiber) and the longissimus dorsi muscle (LG, type IIb fiber) tissues and wash them with PBS. Some tissue samples are immediately frozen in liquid nitrogen and stored at -80 °C for sequencing, and the other part is fixed with 4% paraformaldehyde for muscle tissue morphological analysis. In addition, the SOL and LG tissues are vacuum-packed and transported back to the laboratory within 2 hours for measuring shear force, water loss rate, pH 24h and meat color.

[0062] 1.3 Determination of beef quality traits

[0063] 1.3.1 Shear force analysis

[0064] Trim the SOL and LG tissues into dimensions of 6 cm × 3 cm × 3 cm (length × width × height), and remove the surface fascia and fat. The meat samples are first put into self-sealing bags, marked, and placed in a -80 °C constant temperature water bath. When the central temperature reaches 75 °C, take out the meat samples and cool them to a central temperature of 0 - 4 °C. Use a circular sampler with a diameter of 1.27 cm to cut the meat samples along the fiber direction, and repeat 5 times for each sample. Use an RH-N50 analyzer (Runhu Instrument Company, Guangzhou, China) to measure the shear force at a speed of 5 mm / min.

[0065] 1.3.2 Water loss rate analysis

[0066] Cut 1 cm thick meat samples from the central part of the SOL and LG tissues, and cut them with a circular sampler with a diameter of 2.532 cm. The meat samples are immediately weighed on a balance with a sensitivity of 0.0001 g and recorded as W1. Subsequently, clamp the meat samples between two layers of gauze and place them on the pressure gauge platform covered with multiple layers of qualitative medium-speed filter paper. After the water in the meat samples is absorbed, use an RH-1000 water pressure gauge (Runhu Instrument Company, Guangzhou, China) to apply pressure up to 35 kg for 5 minutes, and immediately weigh after releasing the pressure and record as W2. The water loss rate is calculated according to the following formula: Water loss rate = (W1 - W2) / W1 × 100%.

[0067] 1.3.3 pH 24h Analysis

[0068] Refrigerate the SOL and LG tissues at 4 °C for 24 hours. Use a portable pH meter (Seven2Go-S2, Mettler-Toledo, Switzerland) to measure the pH value of the meat samples. Insert the electrode tip of the pH meter 2 cm deep into the meat samples and read the data after standing for 3 minutes. The pH of each sample 24h is measured three times.

[0069] 1.3.4 Analysis of meat color

[0070] The meat color was detected using a TC-P2A full-automatic colorimeter. First, the colorimeter was calibrated, and then the lens was placed vertically on the meat surface with the lens opening closely attached to the meat surface. The camera button was pressed to record the colorimetric parameters. Each measurement was taken on an area of approximately 1.5 cm² on the meat surface 2 , and 3 sites were randomly measured and the average value was calculated. a* represents redness, b* represents yellowness, and L* represents lightness.

[0071] 1.4 Histomorphological analysis of SOL and LG

[0072] The fixed SOL and LG samples were prepared into paraffin sections, and then immunofluorescence staining was performed by Servicebio Biotechnology Co., Ltd. (Wuhan, China). Antibodies of MyHCI (Cat. No. M8421, Sigma-Aldrich, St. Louis, USA) and MyHCIIb (Cat. No. M4276, Sigma-Aldrich, St. Louis, USA) were used to detect the expression levels of myosin heavy chain in the muscle. Images were collected using a panoramic slide scanner (3DHISTECH, Hungary), and the diameters of five muscle fibers in each section were measured using Image-Pro Plus 6.0 software. Then, the total number of muscle fibers, the area and density of individual muscle fibers in each section were calculated. The percentages of type IIb and type I muscle fibers in SOL and LG tissues were analyzed using Image J 2.1.0 software.

[0073] 1.5 RT-qPCR

[0074] Total RNA was extracted using Trizol (Takara, Kyoto, Japan), and then reverse transcribed into cDNA according to the PrimeScript TM RT reagent kit (Takara, Kyoto, Japan) for RT-qPCR detection.

[0075] 1.6 m 6 A-IP-qPCR

[0076] Poly(A)-containing RNA was isolated from SOL and LG tissues using Oligo(dT) (Thermo Fisher, CA, USA) magnetic beads, and then the RNA was fragmented into 150 - 200 nt fragments. The fragmented RNA was divided into two parts, one part as the input sample, and the other part was placed in an immunoprecipitation buffer containing m 6 A specific antibody (No. 202003, Synaptic Systems, Germany), mixed with immunomagnetic beads, and incubated for 2 hours to obtain m 6A-IP product. The input RNA and IP RNA were reverse transcribed into cDNA, and then through m 6 A-IP-qPCR was used to detect the expression levels of DMGs. Relative m 6 A expression levels were calculated using the 2 -ΔΔCt method, ΔCt = Ct IP -Ct Input .

[0077] 1.7 Western blot

[0078] Proteins were extracted from SOL and LG tissues using a whole protein extraction kit (KeyGEN, Jiangsu, China), and the protein concentration was determined using a BCA kit (KeyGEN, Jiangsu, China). 10 μg of protein samples were added to a 12% SDS polyacrylamide gel for electrophoresis and then transferred to a PVDF membrane (Millipore, Bedford, MA, USA). The membrane was blocked with 3% BSA for 1 hour and then incubated with the primary antibody overnight at 4°C. The next day, the membrane was incubated with the corresponding secondary antibody for 1 hour. ECL reagent was used for color development, and the gray value of the target band was quantified using ImageJ software. Antibodies included MYOD1 (1:1000, Abways, Shanghai, China), MYOG (1:1000; Abways, Shanghai, China), MYF6 (1:1000; Abways, Shanghai, China), mouse anti-fast myosin heavy chain (M4276, Sigma Aldrich, USA), mouse anti-slow myosin heavy chain (M8421, Sigma Aldrich, USA), and GAPDH (1:2000; Abways, Shanghai, China). In addition, METTL3, METTL14, WTAP, FTO, and ALKBH5 antibodies were purchased from ABclonal Biotechnology Co., Ltd. (Wuhan, China).

[0079] 1.8 Cell culture and transfection

[0080] The OE-MSS51 vector, si-MSS51 vector, and negative control were synthesized by Tsingke Biotechnology Co., Ltd. (Beijing, China).

[0081] Construction process of the overexpression vector (OE-MSS51):

[0082] Primers were designed and synthesized according to the nucleotide sequence of the bovine MSS51 gene (SEQ ID NO.1), and the primer sequences were: F: ATCAGTGGCTCCTGTGGTTG (SEQ ID NO.2), R: CCCGTCTAGCACCAACTTGT (SEQ ID NO.3).

[0083] Using the cDNA of bovine longissimus dorsi muscle tissue as a template, PCR amplification was performed using TaKaRa amplification enzyme. The amplification system was 50 μL: 2 μL of 500 ng / μL cDNA template, 25 μL of Premix Taq enzyme, 2 μL each of 10 nmol / L upstream and downstream primers, and 19 μL of ddH2O. Reaction conditions: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 60 °C for 30 s, 40 cycles; extension at 72 °C for 2 min, and preservation at 4 °C.

[0084] After detection by 1% agarose gel electrophoresis, the product was recovered and ligated to the PMD 19-T Vector according to the instructions of the TaKaRa PMD 19-T Vector Cloning Kit, then ligated and transformed into Escherichia coli DH5α, plated, and positive colonies were screened and sequenced.

[0085] Construction process of the inhibitory expression vector (si-MSS51):

[0086] Forward and reverse oligonucleotide strands of the bovine MSS51 gene were designed (forward: GAUUCUGUGCUUACUGUAA (SEQ ID NO.4), reverse: UUACAGUAAGCACAGAAUC (SEQ ID NO.5)). Then, the forward and reverse oligonucleotides were annealed and inserted between the Bg1II and XhoI restriction sites of the pRI vector. The annealed oligonucleotide strands were ligated to the digested linear vector, and finally, the ligation product was purified by high-performance liquid chromatography to obtain the interfering fragment.

[0087] BSMSCs were seeded into 6-well plates. When the cell density reached approximately 80%, the vector was transfected into BSMSCs according to the Lip3000 instructions (Invitrogen, Carlsbad, CA, USA).

[0088] SEQ ID NO.1:

[0089]

[0090] 1.9 m 6 Analysis of A content

[0091] Detect m using dot blot and colorimetric kit 6 A content. First, extract RNA from SOL and LG tissues, then add the RNA to a nylon membrane (Merck Millipore, Germany), crosslink with ultraviolet light for 10 minutes, and then incubate the membrane in 5% non-fat milk for 1 hour. The membrane was incubated overnight with an anti-m 6 A antibody (202003, Synaptic Systems, Germany). The next day, wash the membrane with TBST and incubate it with goat anti-rabbit IgG-HRP (1:5000, Abways, Shanghai, China) for 1 hour. Place the gel in ECL luminescent solution and record the dot blot using a luminescent image analysis system. After incubation, stain the membrane in methylene blue staining solution (0.2% methylene blue, 0.4 M sodium acetate and 0.4 M acetic acid) for 30 minutes, wash with DEPC buffer and take pictures. In addition, according to the m 6 ARNA methylation detection kit (Abcam, ab185912) instructions, detect the m in SOL and LG tissues 6 A content. Record the absorbance of each well at 450 nm using a microplate reader (Molecular Devices, USA) and analyze the relative level of RNAm 6 A.

[0092] 1.10 MeRIP-seq and RNA-seq analysis

[0093] 1.10.1 cDNA library preparation

[0094] Extract total RNA from SOL and LG tissues (n = 5) according to Trizol reagent. First, use Dynabeads Oligo(dT) (Thermo Fisher, Waltham, MA) to isolate poly(A)-containing RNA from total RNA and break it into 200 nt short fragments under high temperature and magnesium ion conditions. Subsequently, reverse transcribe a portion of the fragmented input RNA into cDNA for RNA-seq library construction, and another portion of the fragmented RNA is incubated with m 6 A-specific antibody (202003, Synaptic Systems, Germany) at 4 °C for 2 hours. Then incubate the fragmented RNA with IP buffer (50 mM Tris-HCl, 750 mM NaCl and 0.5%) for 2 hours, then elute the above mixture with IP buffer and precipitate with ethanol. Reverse transcribe the IP RNA into cDNA for MeRIP-seq library construction. Input sample library and m 6All IP sample libraries were sequenced on an Illumina Novaseq TM 6000 (LC-BioTechnology CO., Ltd., Hangzhou, China) to generate 150-bp paired-end reads.

[0095] 1.10.2 Sequencing data analysis

[0096] Raw data were filtered from IP and input samples using FastQc software (v0.11.7, https: / / www.bioinformatics.babraham.ac.uk / projects / fastqc / ). High-quality clean data were obtained by removing adapters, duplicates, and low-quality sequences. Then, the clean data were mapped to the bovine reference genome (Bos_taurus.ARS_UCD1.2.new.genome.fa) using Hisat2 (v2.2.1, http: / / daehwankimlab.github.io / hisat2 / ). Subsequently, exomePeak2 (https: / / bioconductor.org / packages / exomePeak) was used to identify m 6 A peaks. The peaks in bam format were visualized using IGV software (http: / / www.igv.org / ). The m 6 A peaks were annotated using ANNOVAR. Motifs associated with the peaks in each sample were identified using MEME2 (v1.0, http: / / meme-suite.org) and HOMER (v4.1; http: / / homer.ucsd.edu / homer / motif). Then, StringTie (v1.0, https: / / ccb.jhu.edu / software / stringtie) software was used to calculate FPKM to quantify gene expression levels. DEGs with |Log2FC| ≥ 0.585 and *P-value <* 0.05 were selected using DESeq2 (v1.20, https: / / bioconductor.org / packages / release / bioc / html / DESeq2.html). The functions and pathway enrichments of the DEGs were analyzed using Gene Ontology (GO) (https: / / www.geneontology.org / ) and Kyoto Encyclopedia of Genes and Genomes (KEGG) (https: / / www.kegg.jp / ).

[0097] 1.11 Statistical analysis

[0098] Use 2 -ΔΔCtThe relative expression levels of genes were calculated, and the data were analyzed by one-way ANOVA using SAS 9.4 software. Protein blots were quantified using Image J software. Bar graphs were generated using GraphPad Prism 8.0.2 software (San Diego, CA, USA). Each data included three biological replicates and was expressed as mean ± standard error of the mean (SEM). **P < 0.01, *P < 0.05, ns P > 0.05.

[0099] 2. Results

[0100] 2.1 Analysis of meat quality traits

[0101] The meat quality characteristics of SOL and LG are shown in Table 1. The shear force and water loss rate of LG tissues were significantly higher than those of SOL tissues, while the pH 24h was significantly lower than that of SOL tissues (P < 0.01). In terms of meat color, the L* of LG tissues was higher than that of SOL tissues, while a* and b* were significantly lower than those of SOL tissues (P < 0.01). The above results indicate that after slaughter, the SOL tissues had less shear force, better water-holding capacity, and slower pH decline, which contributed to improving the tenderness and juiciness of the meat.

[0102] Table 1 Analysis of meat quality traits

[0103]

[0104]

[0105] Note: Different capital letters indicate significant differences (P < 0.01); a* represents redness; b* represents yellowness; L* represents lightness.

[0106] 2.2 Histomorphological analysis of SOL and LG

[0107] To study the histomorphological differences between SOL and LG, the present invention analyzed the myofiber diameter, cross-sectional area, density, and the percentage of different types of myofibers. The results showed that the percentage of type I fibers in SOL (88.75%) was approximately 3.5 times that in LG (24.58%) ( Figure 1 A and B in). In addition, the diameter and cross-sectional area of myofibers in SOL were significantly lower than those in LG ( Figure 1 C and D in), and the density of myofibers was significantly higher than that in LG ( Figure 1 E in). RT-qPCR results showed that compared with LG, the mRNA expression of MyHCI in SOL was significantly higher, while the mRNA expressions of MyHCIIa and MyHCIIb were significantly lower ( Figure 1 F in).

[0108] 2.3 Analysis of m 6 A content in SOL and LG tissues

[0109] To clarify the differences in m 6 A modification between type I and type IIb muscle fibers, the present invention detected the expression levels of m 6 A enzymes in SOL and LG. The RT-qPCR results showed that compared with LG, the expression of FTO was significantly down-regulated in SOL, while the expression levels of METTL14, YTHDF2, and IGF2BP2 were significantly higher in SOL than in LG( Figure 2 in A). At the protein expression level, METTL3 and METTL14 were significantly up-regulated in SOL, while FTO was significantly down-regulated in SOL tissues, and there was no significant difference in the expression levels of WTAP and ALKBH5 between LG and SOL tissues( Figure 2 in B-C). In addition, Dot blot and m 6 A colorimetric method were used to detect the m 6 A content in SOL and LG tissues. The results showed that the m 6 A content of total RNA in SOL was significantly higher than that in LG( Figure 2 in D-E). These results preliminarily revealed that m 6 A methylation modification regulates the transformation of slow oxidative and fast glycolytic muscle fibers.

[0110] 2.4 m 6 A methylation modification analysis of mRNA in SOL and LG tissues

[0111] To clarify the regulatory role of m 6 A modification in oxidative and glycolytic muscle fibers, the present invention extracted mRNA from SOL and LG tissues for MeRIP-seq analysis. The results showed that after deleting low-quality reads, the IP group and the Input group generated 72,534,092 - 91,350,172 clean reads respectively, and more than 95% of the clean reads were mapped to the bovine reference genome. The quality control analysis of GC content and base quality showed that the filtered GC content exceeded 47% and Q30 was greater than 95% (Table 2). These data indicate that the sequencing data of the present invention meet the requirements of subsequent analysis.

[0112] Table 2 Statistical and mapping results of MeRIP-seq data

[0113]

[0114]

[0115] ExomePeak (v1.8, P<0.05) was used to compare the m 6Peak A. In the present invention, 15,508 m were identified in LG 6 Peak A, and 14,996 m were identified in SOL 6 Peak A. 8,558 and 8,435 m were respectively identified in LG and SOL 6 methylated genes, and there were 7,571 common methylated genes between the two groups ( Figure 3 ). The distribution of m 6 Peak A in the LG and SOL groups showed that mRNA m 6 methylation mainly occurred in the CDS and 3'-UTR regions ( Figure 4 ). In addition, about 48% of the m 6 Peak A was distributed in the CDS region, and 22% was distributed in the 3'-UTR region ( Figure 5 ). In addition, there were about 4,000 genes with independent m 6 Peak A in the SOL and LG groups, and the topological patterns of gene distribution were highly similar in the two tissues ( Figure 6 ). The cumulative curve showed that there was no significant difference in the m 6 abundance between SOL and LG ( Figure 7 ). The most significant mRNA methylation occurred on the RRACH motif, which was consistent with the general motif in mammals ( Figure 8 ). To study whether gene expression was related to m 6 A modification, the present invention compared the gene expression abundances after non-m 6 A modification and m 6 A modification. The results showed that in LG and SOL, the expression levels of m 6 A-modified genes were significantly higher than those of non-m 6 A-modified genes, while there was no significant difference in the expression levels between highly m 6 A-modified genes and lowly m 6 A-modified genes ( Figure 9 ).

[0116] 2.5 Differential Methylated Genes and Their Signaling Pathway Analysis

[0117] To study the differences in methylation peak abundances between LG and SOL tissues, the present invention screened out 214 differential methylation peaks (DMPs) between the two groups (155 up-regulated and 59 down-regulated) based on the criteria of |log2FC| > 0.585 and P < 0.05 ( Figure 10 ). These DMPs were annotated as 211 differential methylated genes (DMGs) (154 up-regulated and 57 down-regulated) ( Figure 11 ). To clarify the potential functions of m 6 A-modified genes in type I and type IIb muscle fibers, the present invention performed functional enrichment analysis on 211 DMGsFigure 12 ) GO analysis showed that DMGs mainly regulated biological processes such as organism growth, development, metabolism, and immune system regulation. Figure 13 ) In addition, DMGs were also involved in transcriptional regulatory activity, ATP-dependent activity, and cytoskeletal activity. KEGG enrichment analysis indicated that DMGs were involved in acid metabolism and disease formation, and also regulated signaling pathways related to skeletal muscle generation, including osteoclast differentiation, apoptosis, and sphingolipid signaling pathways. Figure 14 ) These results suggested that DMGs were related to gene transcriptional regulation and cell metabolism during skeletal muscle cell differentiation.

[0118] 2.6 mRNA Expression and Differentially Expressed Gene Analysis in LG and SOL Tissues

[0119] To evaluate the potential correlation between mRNA m 6 A methylation and gene transcription levels in slow oxidative and fast glycolytic muscle fibers, the present invention performed RNA-seq analysis on all samples. Figure 15 - Figure 16 showed the mRNA distribution and abundance of LG and SOL samples. Figure 17 showed similar results, indicating that there was no significant difference in the gene density distribution between the LG and SOL groups. In addition, using |log2FC| > 0.585 and P < 0.05 as the screening criteria, the present invention identified 682 differentially expressed genes (DEGs) in the LG and SOL groups, including 279 upregulated DEGs and 403 downregulated DEGs. Figure 17 ) Cluster analysis of DEGs showed that the consistency and gene expression correlation of the five biological replicates were significantly different. Figure 18 ) In addition, GO analysis showed that DEGs were mainly enriched in biological processes closely related to organism development, such as growth, development, metabolism, etc. Figure 19 ) KEGG analysis showed that DEGs were mainly enriched in the PI3K-Akt signaling pathway, MAPK signaling pathway, NF-κB signaling pathway, and calcium signaling pathway, and were involved in the contraction of the heart and vascular smooth muscle, the regulation of the actin cytoskeleton, and osteoclast differentiation. Figure 20 )

[0120] 2.7 Correlation Analysis of MeRIP-seq and RNA-seq

[0121] To clarify the regulatory role of m 6 A-modified genes in the LG and SOL groups, the present invention screened and verified genes with significant differences at both the mRNA and m 6 A levels. The Venn diagram of DMGs and DEGs showed that a total of 20 genes had significant differences at both the m 6 A level and the mRNA level.Figure 21 ) including 3 m 6 A hypermethylation-upregulated (Hyper-up) genes (MSS51, PALMD, and LRRN1), 4 m 6 A hypomethylation-upregulated (Hypo-up) genes (GPR85, PCED1B, PROSER3, and SHROOM3), 10 m 6 A hypermethylation-downregulated (Hyper-down) genes (SDC2, WBP1L, PTGS2, and LRRC1, etc.) and 3 m 6 A hypomethylation-downregulated (Hypo-down) genes (VPS72, CBR3, and BTBD11)( Figure 22 ). In addition, the present invention used IGV software to generate m 6 A peaks of MSS51 and CBR3 genes closely related to muscle differentiation and muscle fiber type conversion 6 . The results showed that in the LG and SOL groups, the m 6 A peaks of MSS51 were mainly enriched in exon 5, while the m 6 A peaks of CBR3 were mainly enriched in exon 1. The m 6 A methylation level of MSS51 was higher in LG, while the m Figure 23 A methylation level of CBR3 was higher in SOL( 6 ). In addition, the m 6 A-IP-qPCR results showed that the m 6 A levels of MSS51 and PALMD were significantly higher in the LG group than in the SOL group, while the m Figure 24 A levels of CBR3 and BTBD11 were significantly decreased in the SOL group( Figure 25 ). Meanwhile, the RT-qPCR results showed that compared with SOL, the mRNA levels of MSS51, PALMD, and CCDC112 were significantly upregulated in LG, while the mRNA levels of CBR3, BTBD11, VPS72, HOXA7, and NYAP1 were significantly downregulated in LG(

[0122] 2.8 MSS51 promotes the differentiation of BSMSCs and the conversion of type IIb to type I fibers

[0123] To further explore the role of m 6 A methylation modification in the differentiation of BSMSCs and the conversion of muscle fiber types, the present invention performed on mRNA and m 6Preliminary verification was carried out on the MSS51 gene that was significantly upregulated at the A level. RT-qPCR results showed that the mRNA expression level of MSS51 was significantly downregulated on the 2nd, 4th, 6th, and 8th days of BSMSCs differentiation ( Figure 26 in A). OE-MSS51, si-MSS51, and their respective controls were transfected into BSMSCs. The results showed that the mRNA expression level of MSS51 was significantly upregulated or downregulated, indicating a high transfection efficiency ( Figure 26 in B). In addition, overexpression of MSS51 significantly promoted the mRNA expression levels of MYOD1 and MYF6, and significantly upregulated the mRNA expression level of MyHCI, while the mRNA expression levels of MyHCIIa and MyHCIIb were significantly downregulated ( Figure 26 in C). In contrast, si-MSS51 significantly downregulated the mRNA expression levels of MYOG, MYOD1, MYF6, and MyHCI, while the mRNA expression level of MyHCIIa was significantly upregulated ( Figure 26 in D). At the protein level, overexpression of MSS51 significantly increased the expression levels of MYOG and MYF6. In contrast, after si-MSS51, the protein expression levels of MYOG and MYOD1 were significantly decreased, while there was no significant difference in the protein expression of MYF6 ( Figure 26 in E-G). These results indicate that overexpression of MSS51 promotes the differentiation of BSMSCs and accelerates the conversion of type IIb to type I muscle fibers.

[0124] In summary, the present invention analyzed the meat quality and tissue morphological characteristics of SOL and LG tissues. By RNA-seq and MeRIP-seq, the differentially expressed mRNAs and m 6 A methylation profiles in bovine slow oxidative and fast glycolytic skeletal muscles were constructed, and 20 m 6 A-modified mRNAs were identified to play a key role in skeletal muscle differentiation and muscle fiber type conversion. In addition, the present invention preliminarily verified that MSS51 promotes the differentiation of BSMSCs and accelerates the transformation of fast glycolytic muscle fibers into slow oxidative muscle fibers. The present invention provides new insights into RNA epigenetics in muscle fiber type conversion and preliminarily reveals the genetic and regulatory mechanisms of meat production and meat quality.

[0125] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A gene that regulates bovine skeletal muscle differentiation and muscle fiber type conversion, characterized in that: The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

2. Use of the gene according to claim 1 in regulating cattle skeletal muscle differentiation and / or muscle fiber type conversion, characterized in that: By up-regulating the expression level of the gene, the differentiation of bovine skeletal muscle and / or the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers are promoted.

3. A biomaterial for promoting the differentiation of bovine skeletal muscle and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, characterized in that: The biological material is a recombinant vector that overexpresses the gene according to claim 1.

4. The biomaterial according to claim 3, characterized in that The recombinant vector is constructed by connecting the nucleotide sequence shown in SEQ ID NO.1 to the PMD 19-TVector vector.

5. A biomaterial for inhibiting the differentiation of bovine skeletal muscle and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, characterized in that: The biological material is a recombinant vector that inhibits the expression of the gene according to claim 1.

6. The biomaterial according to claim 5, characterized in that The method for preparing the recombinant vector comprises the following steps: The forward oligonucleotide chain and the reverse oligonucleotide chain are annealed and then inserted into the pRI vector to obtain the recombinant vector; The nucleotide sequence of the forward oligonucleotide chain is shown in SEQ ID NO.4; The nucleotide sequence of the reverse oligonucleotide chain is shown in SEQ ID NO.

5.

7. Use of the biomaterial as claimed in claim 3 or 4 in promoting the differentiation of bovine skeletal muscle and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers.

8. Use of the biomaterial according to claim 5 or 6 in inhibiting the differentiation of bovine skeletal muscle and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers.

9. A method for promoting the differentiation of bovine skeletal muscle and / or accelerating the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, characterized in that: The method comprises the steps of introducing the biomaterial according to claim 3 or 4 into bovine skeletal muscle cells to overexpress the gene according to claim 1.

10. A method for inhibiting the differentiation of bovine skeletal muscle and / or inhibiting the conversion of fast glycolytic muscle fibers to slow oxidative muscle fibers, characterized in that: The method comprises the steps of introducing the biomaterial according to claim 5 or 6 into bovine skeletal muscle cells to inhibit the expression of the gene according to claim 1.

Images