Reference gene and primer pair for abiotic stress research of genuine medicinal material astragalus membranacus in Heilongjiang province and application of reference gene and primer pair

Abstract

The invention relates to the technical field of molecular biology, in particular to a group of reference genes and a primer pair for abiotic stress research of a genuine medicinal material astragalus membranacus in Heilongjiang province and application of the reference genes and the primer pair. According to the invention, eight candidate genes are screened out according to transcriptome sequencing data of astragalus membranaceus under low-temperature stress in different time periods, and the expression stability of the eight candidate genes in different tissues such as roots and leaves of astragalus membranaceus under low-temperature, lead and salt stress within 72 hours is analyzed by using BestKeeper, Normfinder, geNorm, Delta Ct and RefFinder analysis software. The result shows that the optimal reference genes in the root and the leaf of the astragalus membranaceus under the low-temperature stress are the UBQ-3 gene and the CYP-2 gene; the optimal reference gene in the root and the leaf of the astragalus membranaceus under lead stress is a GAPDH-1 gene; the optimal reference genes in the root and the leaf of the astragalus membranaceus under salt stress are a GAPDH-3 gene and a CYP-1 gene.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and particularly relates to a set of reference genes, primer pairs and their applications for the study of abiotic stress of the authentic medicinal material Astragalus membranaceus in Heilongjiang Province. Background Art

[0002] Astragalus membranaceus (Fisch.) Bunge is an important medicinal plant with a history of application for more than 2,000 years. It is recorded in traditional Chinese medicine herb classics and classic famous prescriptions of past dynasties. It has a faint smell, a warm nature, a slightly sweet taste, and belongs to the lung and spleen meridians. It has the functions of invigorating qi and consolidating the exterior, inducing diuresis and detoxifying, astringing sores and promoting granulation, and tonifying the middle-jiao with qi. Modern research shows that it has the effects of preventing and treating hepatitis, diabetes, coronary heart disease, bronchitis, and viral myocarditis, etc. The active ingredients that play pharmacological roles in Astragalus membranaceus mainly include flavonoids, saponins, and polysaccharides, etc. Among them, flavonoid components show significant anti-tumor, antioxidant, and anti-inflammatory effects. In 2020, the National Health Commission included Astragalus membranaceus in the list of homologous medicines and foods. Heilongjiang Province formulated local food standards for "Dried Astragalus membranaceus Flowers" and "Dried Astragalus membranaceus Stems and Leaves", which greatly improved the development value of Astragalus membranaceus in the fields of medicine and food, and also received extensive attention at home and abroad. At present, the relevant research at home and abroad mainly focuses on the agronomic traits, cultivation techniques, development and utilization, extraction of active ingredients, and function evaluation of Astragalus membranaceus, etc., while there is less research on the molecular mechanism of its resistance to low-temperature stress, in vitro regeneration culture, biological contract pathway of flavonoids, and functional analysis of key enzyme genes, etc.

[0003] The wild resources of Astragalus membranaceus are mainly distributed in the Greater and Lesser Hinggan Mountains in China, and the cultivated resources are mainly distributed in the northern low-temperature provinces such as Heilongjiang, Hebei, and Liaoning. In these regions, abiotic stresses such as low temperature, drought, and salinity are important factors affecting the growth of Astragalus membranaceus and limiting its yield and quality. Therefore, preventing the damage caused by low temperature to the growth of Astragalus membranaceus and how to improve its cold tolerance have attracted increasing attention. Under low temperature stress, plants make complex responses in multiple aspects such as endogenous hormones, membrane lipid composition, antioxidant components, gene transcription levels, and specific protein expression. Studies have shown that low temperature stress can promote the accumulation of the content of plant secondary metabolites, such as terpenoids, alkaloids, and flavonoids, etc., especially the accumulation of secondary metabolites in medicinal plants is more obvious. Flavonoids are an important secondary metabolite in plants to cope with abiotic stresses. When plants are subjected to chilling stress, the concentration of flavonoids will increase to eliminate the damage of free radicals. In addition, when plants are at sub-zero temperatures, flavonoids can aggregate in the lipid part of the cell membrane to maintain the stability of the cell membrane. It shows that flavonoids not only play an important role in resisting plant low temperature stress, but also can be used as active ingredients. Therefore, screening the key enzyme genes in the biosynthesis pathway of active ingredients by modern molecular biology methods, clarifying its biosynthesis mechanism and its molecular mechanism for coping with abiotic stresses are of great significance for the molecular breeding of medicinal plants and the research of plant genetic metabolism engineering.

[0004] When studying the growth adaptation mechanism and the change rules of active ingredients of Astragalus membranaceus in stress environments such as low temperature, heavy metals, and salts, selecting appropriate reference genes is crucial for accurately evaluating the expression level of target genes. Past studies have shown that the expression levels of different reference genes may vary in different plant species and treatment conditions. Therefore, it is necessary to screen and verify the reference genes suitable for use under specific conditions. In recent years, researchers have begun to systematically screen and verify the reference genes for Astragalus membranaceus to ensure the accuracy and reliability of experimental data. However, up to now, there has been no report on the research of reference genes of Astragalus membranaceus during low temperature, heavy metal lead, and salt stress. Therefore, studying the growth adaptation mechanism and the development of reference genes of Astragalus membranaceus in different stress environments not only helps to deeply understand the growth regulation mechanism and the change rules of active ingredients of plants under different environmental conditions, but also provides a scientific basis for the quality control, efficacy evaluation, and clinical application of traditional Chinese medicines. Summary of the Invention

[0005] The purpose of the present invention is to provide a group of reference genes, primer pairs and their applications for the study of abiotic stresses of the local medicinal material Astragalus membranaceus in Heilongjiang Province to solve the problems existing in the above-mentioned prior art.

[0006] To achieve the above purpose, the present invention provides the following solutions:

[0007] The present invention provides a set of reference genes of Astragalus membranaceus for abiotic stress, and the reference genes of Astragalus membranaceus include one or several of the UBQ-3 gene with a nucleotide as shown in SEQ ID NO.1, the CYP-2 gene with a nucleotide as shown in SEQ ID NO.2, the GAPDH-1 gene with a nucleotide sequence as shown in SEQ ID NO.3, the GAPDH-3 gene with a nucleotide sequence as shown in SEQ ID NO.4, and the CYP-1 gene with a nucleotide sequence as shown in SEQ ID NO.5. The Astragalus membranaceus described in the present invention is a local medicinal material in Heilongjiang Province.

[0008] Preferably, the abiotic stress includes low temperature stress, lead stress and salt stress.

[0009] Preferably, when the abiotic stress is low temperature stress, the reference genes of Astragalus membranaceus are the UBQ-3 gene and the CYP-2 gene;

[0010] When the abiotic stress is lead stress, the reference gene of Astragalus membranaceus is the GAPDH-1 gene;

[0011] When the abiotic stress is salt stress, the reference genes of Astragalus membranaceus are the GAPDH-3 gene and the CYP-1 gene.

[0012] The present invention provides a fluorescence quantitative PCR detection primer pair for the above-mentioned reference genes of Astragalus membranaceus, and the fluorescence quantitative PCR detection primer pair includes one or several pairs of primer pairs for amplifying the UBQ-3 gene, primer pairs for amplifying the CYP-2 gene, primer pairs for amplifying the GAPDH-1 gene, primer pairs for amplifying the GAPDH-3 gene, and primer pairs for amplifying the CYP-1 gene;

[0013] The primer pair for amplifying the UBQ-3 gene includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.14 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.15; the primer pair for amplifying the CYP-2 gene includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.8 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.9; the primer pair for amplifying the GAPDH-1 gene includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.16 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.17; the primer pair for amplifying the GAPDH-3 gene includes an upstream primer with a nucleotide sequence as shown in SEQ IDNO.20 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.21; the primer pair for amplifying the CYP-1 gene includes an upstream primer with a nucleotide sequence as shown in SEQ ID NO.6 and a downstream primer with a nucleotide sequence as shown in SEQ ID NO.7.

[0014] The present invention provides the application of the above-mentioned fluorescence quantitative PCR detection primer pair in the preparation of a product for quantitatively detecting genes under abiotic stress of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao.

[0015] Preferably, the abiotic stress includes low temperature stress, lead stress and salt stress; the product includes a reagent or a kit.

[0016] The present invention provides a product for assisting in detecting the expression level of a target gene under abiotic stress of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao, which contains one or several pairs of the primer pairs described above.

[0017] The present invention provides a method for assisting in detecting the expression level of a target gene under abiotic stress of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao, which includes the step of performing fluorescence quantitative PCR detection using the above product.

[0018] The present invention provides the application of the above-mentioned internal reference gene of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao, the above-mentioned fluorescence quantitative PCR detection primer pair or the above-mentioned product in any one of the following:

[0019] (1) Detecting the expression level of a target gene in the roots of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0020] (2) Screening or identifying resistance genes in the roots of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0021] (3) Preparing a product for detecting the expression level of a target gene in the roots of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0022] (4) Preparing a product for screening or identifying resistance genes in the roots of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0023] (5) Preparing a product for screening or identifying flavonoid synthesis genes in the roots of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0024] (6) Detecting the expression level of a target gene in the leaves of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0025] (7) Screening or identifying resistance genes in the leaves of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0026] (8) Preparing a product for detecting the expression level of a target gene in the leaves of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0027] (9) Preparing a product for screening or identifying resistance genes in the leaves of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0028] (10) Preparing a product for screening or identifying flavonoid synthesis genes in the leaves of Astragalus membranaceus (Fisch.) Bunge var. mongholicus (Bunge) Hsiao under abiotic stress conditions;

[0029] (11) Application in detecting the transcriptional expression level of genes in the roots and / or leaves of Astragalus membranaceus by qRT-PCR;

[0030] (12) Application in fluorescence quantitative PCR detection of the roots and / or leaves of Astragalus membranaceus under abiotic stress.

[0031] Preferably, the abiotic stress includes low temperature stress, lead stress and salt stress.

[0032] As an additional aspect, the present invention provides the application of the UBQ-3 gene as an internal reference gene in any of the following:

[0033] (1) Fluorescence quantitative PCR detection of the roots of Astragalus membranaceus under low temperature stress;

[0034] (2) Screening or identifying low temperature resistance genes and flavonoid synthesis genes in the roots of Astragalus membranaceus;

[0035] The nucleotide sequence of the UBQ-3 is shown as SEQ ID NO.1.

[0036] As an additional aspect, the present invention provides the application of the fluorescence quantitative PCR detection primer pair of the UBQ-3 gene in any of the following:

[0037] (1) Fluorescence quantitative PCR detection of the roots of Astragalus membranaceus under low temperature stress;

[0038] (2) Screening or identifying low temperature resistance genes and flavonoid synthesis genes in the roots of Astragalus membranaceus;

[0039] (3) Preparing a fluorescence quantitative PCR detection reagent or kit for the roots of Astragalus membranaceus under low temperature stress;

[0040] (4) Preparing a screening or identification product for low temperature resistance genes and flavonoid synthesis genes in the roots of Astragalus membranaceus;

[0041] The nucleotide sequence of the fluorescence quantitative PCR detection primer pair is as follows:

[0042] The forward primer is 5’-GATTACGCTTGAGGTGGAGTCTTCG-3’, and the reverse primer is 5’-TGGATGTTGTAGTCGGCAAGAGTG-3’.

[0043] As an additional aspect, the present invention provides the application of the CYP-2 gene as an internal reference gene in any of the following:

[0044] (1) Fluorescence quantitative PCR detection of the leaves of Astragalus membranaceus under low temperature stress;

[0045] (2) Screening or identifying low temperature resistance genes and flavonoid synthesis genes in the leaves of Astragalus membranaceus;

[0046] The nucleotide sequence of CYP-2 is shown in SEQ ID NO.2.

[0047] As an additional aspect, the present invention provides the use of the fluorescence quantitative PCR detection primer pair of the CYP-2 gene in any one of the following:

[0048] (1) Fluorescence quantitative PCR detection of Astragalus membranaceus leaves under low temperature stress;

[0049] (2) Screening or identifying low temperature resistance genes and flavonoid synthesis genes in Astragalus membranaceus leaves;

[0050] (3) Preparing a fluorescence quantitative PCR detection reagent or kit for Astragalus membranaceus leaves under low temperature stress;

[0051] (4) Preparing a screening or identification product for low temperature resistance genes and flavonoid synthesis genes of Astragalus membranaceus leaves;

[0052] The nucleotide sequence of the fluorescence quantitative PCR detection primer pair is as follows:

[0053] The forward primer is 5’-ACCTATTACAACACGACCTGCTTCC-3’, and the reverse primer is 5’-TCGTTGCTGCTAACTGTACTGGTTC-3’.

[0054] As an additional aspect, the present invention provides the use of the GAPDH-1 gene as an internal reference gene in any one of the following:

[0055] (1) Fluorescence quantitative PCR detection of the roots and / or leaves of Astragalus membranaceus under lead stress;

[0056] (2) Screening or identifying heavy metal resistance genes and flavonoid synthesis genes in the roots and / or leaves of Astragalus membranaceus;

[0057] The nucleotide sequence of GAPDH-1 is shown in SEQ ID NO.3.

[0058] As an additional aspect, the present invention provides the use of the fluorescence quantitative PCR detection primer pair of the GAPDH-1 gene in any one of the following:

[0059] (1) Fluorescence quantitative PCR detection of the roots and / or leaves of Astragalus membranaceus under lead stress;

[0060] (2) Screening or identifying heavy metal resistance genes and flavonoid synthesis genes in the roots and / or leaves of Astragalus membranaceus;

[0061] (3) Preparing a fluorescence quantitative PCR detection reagent or kit for the roots and / or leaves of Astragalus membranaceus under lead stress;

[0062] (4) Products for screening or identifying heavy metal resistance genes and flavonoid synthesis genes in the roots and / or leaves of Astragalus membranaceus

[0063] The nucleotide sequences of the fluorescence quantitative PCR detection primer pairs are as follows:

[0064] The forward primer is 5'-CTGTCCATTCCATCACTGCCACTC-3', and the reverse primer is 5'-TCTTCCACCTCTCCAGTCCTTGC-3'.

[0065] As an additional aspect, the present invention provides the application of the GAPDH-3 gene as an internal reference gene in any of the following:

[0066] (1) Fluorescence quantitative PCR detection of the roots of Astragalus membranaceus under salt stress;

[0067] (2) Screening or identifying salt resistance genes and flavonoid synthesis genes in the roots of Astragalus membranaceus;

[0068] The nucleotide sequence of the GAPDH-3 is as shown in SEQ ID NO.4.

[0069] As an additional aspect, the present invention provides the application of the fluorescence quantitative PCR detection primer pair of the GAPDH-3 gene in any of the following:

[0070] (1) Fluorescence quantitative PCR detection of the roots of Astragalus membranaceus under salt stress;

[0071] (2) Screening or identifying salt resistance genes and flavonoid synthesis genes in the roots of Astragalus membranaceus;

[0072] (3) Preparing a fluorescence quantitative PCR detection reagent or kit for the roots of Astragalus membranaceus under salt stress;

[0073] (4) Preparing products for screening or identifying salt resistance genes and flavonoid synthesis genes in the roots of Astragalus membranaceus;

[0074] The nucleotide sequences of the fluorescence quantitative PCR detection primer pairs are as follows:

[0075] The forward primer is 5'-GCTCTACCACCTCTCCAGTCCTTG-3', and the reverse primer is 5'-AACCAACTGCCTTGCTCCACTTG-3'.

[0076] As an additional aspect, the present invention provides the application of the CYP-1 gene as an internal reference gene in any of the following:

[0077] (1) Fluorescence quantitative PCR detection of the leaves of Astragalus membranaceus under salt stress;

[0078] (2) Screen or identify the salt resistance genes and flavonoid synthesis genes in Astragalus membranaceus leaves;

[0079] The nucleotide sequence of the CYP-1 is shown as SEQ ID NO.5.

[0080] As an additional aspect, the present invention provides the application of the fluorescence quantitative PCR detection primer pair of the CYP-1 gene in any of the following:

[0081] (1) Fluorescence quantitative PCR detection of Astragalus membranaceus leaves under salt stress;

[0082] (2) Screen or identify the salt resistance genes and flavonoid synthesis genes in Astragalus membranaceus leaves;

[0083] (3) Prepare a fluorescence quantitative PCR detection reagent or kit for Astragalus membranaceus leaves under salt stress;

[0084] (4) Prepare a product for screening or identifying the salt resistance genes and flavonoid synthesis genes in Astragalus membranaceus leaves;

[0085] The nucleotide sequence of the fluorescence quantitative PCR detection primer pair is as follows:

[0086] The forward primer is 5’-TTCCGTCAAGCCAATCAGTCTTAGC-3’, and the reverse primer is 5’-AGCACACTGGTCCTGGAATCCTC-3’.

[0087] As an additional aspect, the present invention provides a product for assisting in analyzing the gene expression levels of Astragalus membranaceus under low temperature, lead, and salt stresses. The product contains one or several pairs of fluorescence quantitative PCR detection primer pairs of the UBQ-3 gene, the CYP-2 gene, the GAPDH-1 gene, the GAPDH-3 gene, and the CYP-1 gene.

[0088] More preferably, use the fluorescence quantitative PCR detection primer pair of the UBQ-3 gene to assist in analyzing the gene expression level of Astragalus membranaceus roots under low temperature stress; use the fluorescence quantitative PCR detection primer pair of the CYP-2 gene to assist in analyzing the gene expression level of Astragalus membranaceus leaves under low temperature stress; use the fluorescence quantitative PCR detection primer pair of the GAPDH-1 gene to assist in analyzing the gene expression levels of Astragalus membranaceus roots and leaves under lead stress; use the fluorescence quantitative PCR detection primer pair of the GAPDH-3 gene to assist in analyzing the gene expression level of Astragalus membranaceus roots under salt stress; use the fluorescence quantitative PCR detection primer pair of the CYP-1 gene to assist in analyzing the gene expression level of Astragalus membranaceus leaves under salt stress.

[0089] Further preferably, the product comprises a reagent, a kit or a chip.

[0090] As an additional aspect, the present invention provides a method for assisting in analyzing the gene expression levels in the roots and leaves of Astragalus membranaceus under low temperature, lead, and salt stresses, comprising the step of using the above product for assisting in the analysis.

[0091] The present invention discloses the following technical effects:

[0092] Based on the transcriptome sequencing data of Astragalus membranaceus at different time periods under low temperature stress, the present invention screened out 8 candidate genes, and used BestKeeper, Normfinder, geNorm, Delta Ct, and RefFinder analysis software to analyze the expression stability of the 8 candidate genes in different tissues such as the roots and leaves of Astragalus membranaceus within 72 hours under low temperature, lead, and salt stresses. The results showed that the most suitable reference genes in the roots and leaves of Astragalus membranaceus under low temperature stress were the UBQ-3 gene and the CYP-2 gene; the most suitable reference gene in the roots and leaves of Astragalus membranaceus under lead stress was the GAPDH-1 gene; the most suitable reference genes in the roots and leaves of Astragalus membranaceus under salt stress were the GAPDH-3 gene and the CYP-1 gene. The present invention first proposed using the UBQ-3 gene, the CYP-2 gene, the GAPDH-1 gene, the GAPDH-3 gene, and the CYP-1 gene as reference genes for qRT-PCR of Astragalus membranaceus to normalize the expression levels of target genes, solving the current situation that there is no reference gene for qRT-PCR of Astragalus membranaceus under low temperature, lead, and salt stresses.

[0093] The present invention also provides the application of the UBQ-3 gene, the CYP-2 gene, the GAPDH-1 gene, the GAPDH-3 gene, and the CYP-1 gene as reference genes in qRT-PCR for detecting the gene transcriptional expression levels in the roots and leaves of Astragalus membranaceus. The results of the specific embodiments of the present invention show that: the reference genes of Astragalus membranaceus provided by the present invention can be used to study the expression of key resistance genes in Astragalus membranaceus during the process of resisting low temperature, lead, and salt stresses. The proposal of the present invention improves the credibility of the detection results and the stability, reliability, and repeatability of gene expression analysis research. It can be seen that the present invention lays an important foundation for the expression research of resistance genes and flavonoid synthesis genes of Astragalus membranaceus under various stresses. BRIEF DESCRIPTION OF THE DRAWINGS

[0094] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the following drawings are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0095] Figure 1 It is the amplification melting curve of the CYP-1 gene;

[0096] Figure 2 It is the amplification melting curve of the CYP-2 gene;

[0097] Figure 3 It is the amplification melting curve of the UBQ-1 gene;

[0098] Figure 4 It is the amplification melting curve of the UBQ-2 gene;

[0099] Figure 5 It is the amplification melting curve of the UBQ-3 gene;

[0100] Figure 6 It is the amplification melting curve of the GAPDH-1 gene;

[0101] Figure 7 It is the amplification melting curve of the GAPDH-2 gene;

[0102] Figure 8 It is the amplification melting curve of the GAPDH-3 gene;

[0103] Figure 9 It is the result diagram of the expression stability analysis of each candidate reference gene in the roots and leaves of Astragalus membranaceus under different stresses by geNorm analysis; among them, A and B are the results of the stability analysis of each gene in the roots and leaves of Astragalus membranaceus under low temperature stress; C and D are the results of the stability analysis of each gene in the roots and leaves of Astragalus membranaceus under lead stress; E and F are the results of the stability analysis of each gene in the roots and leaves of Astragalus membranaceus under salt stress;

[0104] Figure 10 It is the change diagram of the FPKM value of the CHS gene in Astragalus membranaceus under low temperature stress and the relative expression level changes of CHS at different time periods under each stress by analyzing the most stable and most unstable candidate genes in the roots and leaves of Astragalus membranaceus under different stresses as reference genes by RefFinder; among them, A is the change of the FPKM value of the CHS gene in the sequencing data of Astragalus membranaceus under low temperature stress; B is the change diagram of the expression level of CHS analyzed by using the most stable and most unstable candidate genes in the roots and leaves of Astragalus membranaceus analyzed by RefFinder as reference genes under low temperature stress; C is the change diagram of the expression level of the CHS gene analyzed by using the most stable and most unstable candidate genes in the roots and leaves of Astragalus membranaceus analyzed by RefFinder as reference genes under lead stress; D is the change diagram of the expression level of the CHS gene analyzed by using the most stable and most unstable candidate genes in the roots and leaves of Astragalus membranaceus analyzed by RefFinder as reference genes under salt stress. Detailed implementation methods

[0105] A detailed description of various exemplary embodiments of the present invention will now be given. This detailed description should not be construed as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0106] It should be understood that the terms used in the present invention are merely for describing particular embodiments and are not intended to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0107] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0108] Without departing from the scope or spirit of the present invention, various modifications and variations can be made to the specific embodiments of the present invention specification, which are obvious to those skilled in the art. Other embodiments obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are merely exemplary.

[0109] Regarding the use of "comprising", "including", "having", "containing", etc. in this article, they are all open-ended terms, meaning including but not limited to.

[0110] In the early stage of the present invention, 8 candidate genes were screened based on the transcriptome sequencing data of Astragalus membranaceus at different time periods under low temperature stress, namely CYP-1 gene, CYP-2 gene, UBQ-1 gene, UBQ-2 gene, UBQ-3 gene, GAPDH-1 gene, GAPDH-2 gene and GAPDH-3 gene. The expression stability of the 8 candidate genes in different tissues such as roots and leaves of Astragalus membranaceus at different time periods under low temperature, lead and salt stresses was analyzed using BestKeeper, Normfinder, geNorm, Delta Ct and RefFinder analysis software. The results showed that the optimal reference gene in the roots of Astragalus membranaceus under low temperature stress was the UBQ-3 gene, and the optimal reference gene in the leaves was the CYP-2 gene; the optimal reference gene in both the roots and leaves of Astragalus membranaceus under lead stress was the GAPDH-1 gene; the optimal reference gene in the roots of Astragalus membranaceus under salt stress was the GAPDH-3 gene, and the optimal reference gene in the leaves was the CYP-1 gene.

[0111] Among them, the nucleotide sequence of the UBQ-3 gene is shown in SEQ ID NO.1; the nucleotide sequence of the CYP-2 gene is shown in SEQ ID NO.2; the nucleotide sequence of the GAPDH-1 gene is shown in SEQ ID NO.3; the nucleotide sequence of the GAPDH-3 gene is shown in SEQ ID NO.4; the nucleotide sequence of the CYP-1 gene is shown in SEQ ID NO.5.

[0112] The nucleotide sequence of the UBQ-3 gene (SEQ ID NO.1) is as follows:

[0113] TCTGTTCTCGAAGATGCAGATCTTCGTGAAAACCCTAACGGGGAAGACGATTACGCTTGAGGTGGAGTCTTCGGACACCATCGACAATGTGAAGTCGAAGATCCAAGACAAGGAGGGAATCCCACCGGACCAGCAGCGTCTCATCTTCGCCGGAAAGCAATTGGAGGATGGCCGCACTCTTGCCGACTACAACATCCAGAAGGAATCAACTCTTCACCTTGTCCTCCG;

[0114] The nucleotide sequence of the CYP-2 gene (SEQ ID NO.2) is as follows:

[0115]

[0116] The nucleotide sequence of the GAPDH-1 gene (SEQ ID NO.3) is shown below:

[0117]

[0118] The nucleotide sequence of the GAPDH-3 gene (SEQ ID NO.4) is as follows:

[0119] TCCAGTCAACTTTCCATTCAAAGCAGGAAGGACCTTCCCAACAGCCTTAGCAGCTCCAGTACTGCTAGGAATGATGTTAAATGAAGCAGCTCTACCACCTCTCCAGTCCTTGCTGGATGGCCCATCAACAGTTTTCTGTGTGGCAGTGATGGAATGAACGGTGGTCATCAAACCCTCAACAATGCCAAACCTTTCATGAATAACCTTTGCAAGTGGAGCAAGGCAGTTGGTTGTGCAGCTAGCATTAGAAATAATATCAAGCTCTGGCTTGTATTCATGCTCATTGACACCAACCACAAACATTGGAGCATCTTTACT;

[0120] The nucleotide sequence of the CYP-1 gene (SEQ ID NO.5) is as follows:

[0121]

[0122] The present invention first proposes to use the UBQ-3 gene, CYP-2 gene, GAPDH-1 gene, GAPDH-3 gene, and CYP-1 gene as internal reference genes for Astragalus membranaceus qRT-PCR to normalize the expression level of target genes, solving the current situation that there is no internal reference gene for Astragalus membranaceus qRT-PCR under low temperature, lead, and salt stress.

[0123] The specific research is as follows:

[0124] Example 1

[0125] 1 Experimental materials and treatments

[0126] The experimental material, Astragalus membranaceus seeds, were collected from the Daxing'anling region and planted in the Astragalus membranaceus Industry Research Institute of Qiqihar Medical College. After 48 days of emergence, they were transferred to an artificial climate chamber for artificial simulation of 4°C low temperature stress for 72 h, with a photoperiod of 14 h / 10 h (day / night), light intensity of 80%, and humidity of 55%. For salt and lead stress treatments, seedlings were irrigated with 200 mL (400 mM) of salt (NaCl) solution and 200 mL (400 mM) of lead solution once a day for 3 consecutive days. The control group was collected from samples with normal growth. Roots and leaves of Astragalus membranaceus under different treatments for 72 h were taken, with 20 plants for each treatment, and 3 biological replicates were set for each tissue. They were cooled with liquid nitrogen and stored at -80°C.

[0127] 2 Experimental methods

[0128] Total RNA was extracted respectively with reference to the Trizol reagent instruction manual (Beijing Tiangen Biotechnology Co., Ltd.). cDNA was reverse transcribed and synthesized using a cDNA synthesis kit (Beijing Tiangen Biotechnology Co., Ltd.). The cDNA was diluted to 100 ng / μL as the qRT-PCR template. Real-time fluorescence quantitative analysis was carried out with reference to the TIANGEN, FastKing One-Step RT-qPCR Kit (SYBR Green) (FP313) kit, and the qRT-PCR primer combinations of each candidate gene are shown in Table 1.

[0129] Table 1 Candidate internal reference genes and primer information

[0130]

[0131] The qRT-PCR reaction program was: 95°C, 3 min, (95°C - 5 s; 60°C - 15 s, 72°C - 15 s) × 40 cycles; the melting curve program: heated from 65°C to 90°C, 5 s. Each reaction was repeated three times, and the amplification melting curve is shown in Figures 1 - 8After the amplification is completed, it is automatically analyzed to check the gene amplification situation, and the corresponding threshold cycle number, that is, the Ct value, is exported. Calculate the amplification efficiency, correlation and average Ct value of each candidate gene. The results are shown in Table 2.

[0132] Table 2 Amplification efficiency, correlation and average Ct value of candidate genes in the roots and leaves of Astragalus membranaceus under different stresses

[0133]

[0134]

[0135] 3 Analysis of the stability of each candidate reference gene

[0136] To screen out the best reference genes in the roots and leaves of Astragalus membranaceus under low temperature, lead and salt stresses, according to the Ct values of each gene in different tissues, the geNorm, Normfinder, BestKeeper and Delta Ct tools are used to analyze the stability of each reference gene, and the online analysis RefFinder (http: / / blooge.cn / RefFinder / ) is used to comprehensively analyze the data to obtain the best reference genes in different tissues under different stresses.

[0137] 3.1 Analysis of the stability of reference genes by geNorm

[0138] The geNorm software calculates the expression stability M value of each candidate gene. The smaller the M value, the higher the stability; on the contrary, the larger the M value, the more unstable. The analysis results of the geNorm software are as Figure 9 shown. The analysis results of the geNorm software show that: under low temperature stress, the most stable reference genes in the roots of Astragalus membranaceus are UBQ-3 gene and GAPDH-3 gene, and the most unstable is UBQ-1 gene ( Figure 9 A in), the most stable reference genes in the leaves are CYP-1 gene and CYP-2 gene, and the most unstable is UBQ-2 gene ( Figure 9 B in); under lead stress, the most stable reference genes in the roots of Astragalus membranaceus are UBQ-2 gene and GAPDH-2 gene, and the most unstable is GAPDH-3 gene ( Figure 9 C in), the most stable reference genes in the leaves are GAPDH-1 gene and GAPDH-2 gene, and the most unstable is GAPDH-3 ( Figure 9 D in); under salt stress, the most stable reference genes in the roots of Astragalus membranaceus are GAPDH-1 gene and GAPDH-3 gene, and the most unstable is UBQ-3 gene ( Figure 9 E in), the most stable in the leaves are CYP-1 gene and CYP-2 gene, and the most unstable is GAPDH-3 gene ( Figure 9 F in).

[0139] 3.2 Normfinder Analysis of the Stability of Reference Genes

[0140] The Normfinder software combines the within-group variance and between-group variance to calculate the stability value M of each candidate reference gene. The smaller the M value, the more stable the reference gene; conversely, the higher the M value, the worse the stability. The results of the Normfinder software analysis of the stability of reference genes in different tissues of Astragalus membranaceus under different stresses are shown in Tables 3 and 4. The results show that under low-temperature stress, the most stable reference genes in the roots of Astragalus membranaceus are UBQ-3 gene and GAPDH-3 gene, and the most unstable is UBQ-1 gene. The most stable reference gene in the leaves is CYP-2 gene, and the most unstable is UBQ-2 gene; under lead stress, the most stable reference genes in the roots and leaves of Astragalus membranaceus are both GAPDH-1 gene, and the most unstable is GAPDH-3 gene; under salt stress, the most stable reference gene in the roots of Astragalus membranaceus is GAPDH-3 gene, and the most unstable is UBQ-3 gene. The most stable in the leaves are CYP-1 gene and CYP-2 gene, and the most unstable is GAPDH-3 gene.

[0141] Table 3 Results of Normfinder Analysis of the Stability of Candidate Reference Genes in the Roots of Astragalus membranaceus under Different Stresses

[0142]

[0143] Table 4 Results of Normfinder Analysis of the Stability of Candidate Reference Genes in the Leaves of Astragalus membranaceus under Different Stresses

[0144]

[0145] 3.3 BestKeeper Analysis of the Stability of Reference Genes

[0146] The BestKeeper software compares the stability of each reference gene by calculating the standard deviation (SD) and coefficient of variation (CV) of Ct values. The smaller the standard deviation and coefficient of variation, the better the stability. The analysis results of the BestKeeper software are shown in Tables 5 and 6. The results show that: under low-temperature stress, the most stable reference gene in the roots of Astragalus membranaceus is the GAPDH-2 gene, and the most unstable is the UBQ-1 gene; in the leaves, the most stable reference gene is the UBQ-1 gene, and the most unstable is the UBQ-2 gene; under lead stress, the most stable reference gene in the roots of Astragalus membranaceus is the GAPDH-1 gene, and the most unstable is the CYP-2 gene; in the leaves, the most stable reference gene is the GAPDH-2 gene, and the most unstable is the GAPDH-3 gene; under salt stress, the most stable reference gene in the roots of Astragalus membranaceus is the GAPDH-3 gene, and the most unstable is the UBQ-3 gene; in the leaves, the most stable is the UBQ-3 gene, and the most unstable is the UBQ-2 gene.

[0147] Table 5 Results of the stability of candidate reference genes analyzed by BestKeeper in the roots of Astragalus membranaceus under different stresses

[0148]

[0149] Note: CV is the coefficient of variation; SD is the standard deviation; the same below.

[0150] Table 6 Results of the stability of candidate reference genes analyzed by BestKeeper in the leaves of Astragalus membranaceus under different stresses

[0151]

[0152] 3.4 Analysis of the stability of reference genes by the Delta Ct method

[0153] The Delta Ct method evaluates the stability of reference genes by calculating ΔCt. The smaller ΔCt, the more stable. The analysis results of the Delta Ct method are shown in Tables 7 and 8. The results show that: under low-temperature stress, the most stable reference genes in the roots of Astragalus membranaceus are the UBQ-3 gene and the GAPDH-3 gene, and the most unstable is the UBQ-1 gene; in the leaves, the most stable reference gene is the CYP-2 gene, and the most unstable is the UBQ-2 gene; under lead stress, the most stable reference genes in both the roots and leaves of Astragalus membranaceus are the GAPDH-1 gene, and the most unstable are both the GAPDH-3 genes; under salt stress, the most stable reference gene in the roots of Astragalus membranaceus is the GAPDH-3 gene, and the most unstable is the UBQ-3 gene; in the leaves, the most stable is the CYP-1 gene, and the most unstable is the GAPDH-3 gene. The results are shown in detail in Tables 7 and 8.

[0154] Table 7 Results of the stability of candidate reference genes in the roots of Astragalus membranaceus under different stresses analyzed by Delta Ct

[0155]

[0156] Table 8 Results of the stability of candidate reference genes in the leaves of Astragalus membranaceus under different stresses analyzed by Delta Ct

[0157]

[0158]

[0159] 3.5 Comprehensive analysis results

[0160] The geometric mean of the stability rankings obtained by the geNorm, Normfinder, BestKeeper methods and the Delta Ct method was calculated using the RefFinder software to obtain the comprehensive index ranking. The smaller the index, the more stable the expression of the reference gene. The results are shown in Table 9. The results show that the most stable reference gene in the roots of Astragalus membranaceus under low temperature stress is the UBQ-3 gene, and the most stable one in the leaves is the CYP-2 gene; the most stable one in both the roots and leaves of Astragalus membranaceus under lead stress is the GAPDH-1 gene; the most stable one in the roots of Astragalus membranaceus under salt stress is the GAPDH-3 gene, and the most stable one in the leaves is the CYP-1 gene. The results are shown in detail in Table 9

[0161] Table 9 Ranking of the stability of candidate reference genes in the roots and leaves of Astragalus membranaceus under different stresses analyzed by the RefFinder software

[0162]

[0163] According to the above analysis results, it can be determined that the most stable reference genes in the roots and leaves of Astragalus membranaceus under low temperature stress are the UBQ-3 gene and the CYP-2 gene respectively; the most stable one in both the roots and leaves of Astragalus membranaceus under lead stress is the GAPDH-1 gene; the most stable ones in the roots and leaves of Astragalus membranaceus under salt stress are the GAPDH-3 gene and the CYP-1 gene respectively

[0164] Example 2 Verification analysis of reference genes

[0165] According to the test results of Example 1, verify the stability of the reference genes UBQ-3 and CYP-2 in the roots and leaves of Astragalus membranaceus under low temperature stress; verify the stability of the reference gene GAPDH-1 in the roots and leaves of Astragalus membranaceus under lead stress; verify the stability of GAPDH-3 and CYP-1 in the roots and leaves of Astragalus membranaceus under salt stress

[0166] Chalcone Synthase (CHS), an important enzyme in the flavonoid synthesis pathway, plays a key role in plant growth and development, stress resistance, and medicinal value. Some studies have pointed out that the expression of the CHS gene is positively correlated with the flavonoid content in Astragalus membranaceus, especially at different developmental stages and under various stress conditions. In-depth study of the role of CHS in Astragalus membranaceus in response to low temperature, lead, and salt stress helps to reveal the stress response mechanism of Astragalus membranaceus and provides a scientific basis for its rational utilization and cultivation. Therefore, to verify the stability of the best reference genes screened under different tissues and different stresses, the CHS gene can be selected as the verification gene, and its expression level should show a significant upward trend at different time points under low temperature, lead, and salt stress. Analyze the expression pattern of CHS under different tissues and different stresses using the most stable and the most unstable reference genes recommended by RefFinder, and calculate the relative expression level of the target gene using the 2 -ΔΔCT method, and each biological sample is detected three times.

[0167] The primers for quantitative real-time PCR of the CHS gene are as follows:

[0168] Forward primer: 5’-CCGCAACGCTCAGAGATCCAATG-3’, SEQ ID NO.22;

[0169] Reverse primer: 5’-ACAGTGAGAAGGAGTGGCAGTACC-3’, SEQ ID NO.22.

[0170] According to the transcriptome sequencing data of Astragalus membranaceus at 0 h, 12 h, and 24 h under low temperature stress, the change of the FPKM value (Fragments Per Kilobase of transcript per Million mapped reads) of the CHS gene under low temperature stress is as shown in Figure 10 A. Under low temperature stress, the most stable reference genes UBQ-3 and CYP-2 in the roots and leaves of Astragalus membranaceus, and the most unstable reference genes UBQ-1 and UBQ-2 were used to analyze the change of the expression level of the CHS gene, and the results are as shown in Figure 10As shown in B of [FIGURE REFERENCE]: The change in the expression level of the CHS gene analyzed using the UBQ-3 gene and the CYP-2 gene as reference genes was consistent with the sequencing data. However, when the UBQ-1 gene and the UBQ-2 gene were used as reference genes, the trend of change in the expression level of the CHS gene was significantly different, indicating that the UBQ-3 gene and the CYP-2 gene can be used as stable reference genes in the roots and leaves of Astragalus membranaceus under low-temperature stress; Under lead stress, the most stable reference gene GAPDH-1 and the most unstable reference gene GAPDH-3 in the roots and leaves of Astragalus membranaceus were used; The change in the expression level of the CHS gene was analyzed, and the results are as Figure 10 shown in C of [FIGURE REFERENCE]: When the GAPDH-1 gene was used as the reference gene, the trend of change in the expression level of the CHS gene was significantly and continuously increasing, which was consistent with the expected results. However, when the GAPDH-3 gene was used as the reference gene, the trend of change in the expression level of the CHS gene was quite different, indicating that the GAPDH-1 gene can be used as a reference gene for analyzing the change in gene expression in the roots and leaves of Astragalus membranaceus under lead stress; Under salt stress, the most stable reference genes GAPDH-3 and CYP-1, and the most unstable reference genes UBQ-3 and GAPDH-3 in the roots and leaves of Astragalus membranaceus were used; The change in the expression level of the CHS gene was analyzed, and the results are as Figure 10 shown in D of [FIGURE REFERENCE]: The change in the expression level of the CHS gene analyzed using the GAPDH-3 gene and the CYP-1 gene as reference genes was consistent with the expectation. However, when the UBQ-3 gene and the GAPDH-3 gene were used as reference genes, there was no significant change in the expression level of the CHS gene under stress conditions at different time periods, indicating that the GAPDH-3 gene and the CYP-1 gene can be used as reference genes for gene expression analysis in the roots and leaves of Astragalus membranaceus under salt stress, respectively.

[0171] The embodiments described above are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.

Claims

1. A set of internal reference genes of Astragalus membranaceus for abiotic stress, characterized in that: The Astragalus membranaceus internal reference gene includes one or more of the UBQ-3 gene as shown in SEQ ID NO.1, the CYP-2 gene as shown in SEQ ID NO.2, the GAPDH-1 gene as shown in SEQ ID NO.3, the GAPDH-3 gene as shown in SEQ ID NO.4 and the CYP-1 gene as shown in SEQ ID NO.

5.

2. The Astragalus membranaceus internal reference gene according to claim 1, characterized in that The abiotic stress includes low temperature stress, lead stress and salt stress.

3. The Astragalus membranaceus internal reference gene according to claim 2, characterized in that When the abiotic stress is low temperature stress, the internal reference genes of Astragalus membranaceus are UBQ-3 gene and CYP-2 gene; When the abiotic stress is lead stress, the Astragalus membranaceus internal reference gene is the GAPDH-1 gene; When the abiotic stress is salt stress, the internal reference genes of Astragalus membranaceus are GAPDH-3 gene and CYP-1 gene.

4. The fluorescent quantitative PCR detection primer pair for the internal reference gene of Astragalus membranaceus according to any one of claims 1 to 3, characterized in that: The fluorescent quantitative PCR detection primer pair includes one or more pairs of primer pairs for amplifying UBQ-3 gene, primer pairs for amplifying CYP-2 gene, primer pairs for amplifying GAPDH-1 gene, primer pairs for amplifying GAPDH-3 gene and primer pairs for amplifying CYP-1 gene; The primer pair used to amplify the UBQ-3 gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.14 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.15; The primer pair for amplifying the CYP-2 gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.8 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.9; the primer pair for amplifying the GAPDH-1 gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.16 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.17; The primer pair for amplifying the GAPDH-3 gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.20 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.21; The primer pair used to amplify the CYP-1 gene includes an upstream primer having a nucleotide sequence as shown in SEQ ID NO.6 and a downstream primer having a nucleotide sequence as shown in SEQ ID NO.

7.

5. Use of the fluorescent quantitative PCR detection primer pair according to claim 4 in preparing a product for quantitative detection of genes of Astragalus membranaceus under abiotic stress.

6. The use according to claim 5, characterized in that: The abiotic stress includes low temperature stress, lead stress and salt stress; the product includes reagents, kits or chips.

7. A product for assisting in detecting the expression of a target gene under abiotic stress in Astragalus membranaceus, characterized in that: The method comprises the fluorescent quantitative PCR detection primer pair described in claim 4.

8. A method for assisting detection of target gene expression under abiotic stress in Astragalus membranaceus, characterized in that: The method comprises the step of using the product according to claim 7 to perform fluorescent quantitative PCR detection.

9. Use of the Astragalus membranaceus internal reference gene of claim 1, the fluorescent quantitative PCR detection primer pair of claim 4, or the product of claim 7 in any of the following: (1) Detect the expression level of target genes in the roots of Astragalus membranaceus under abiotic stress conditions; (2) Screening or identifying resistance genes in the roots of Astragalus membranaceus under abiotic stress conditions; (3) preparing a product for detecting the expression level of a target gene in the roots of Astragalus membranaceus under abiotic stress conditions; (4) preparing products for screening or identifying resistance genes in roots of Astragalus membranaceus under abiotic stress conditions; (5) preparing a product for screening or identifying flavonoid biosynthesis genes in the roots of Astragalus membranaceus under abiotic stress conditions; (6) Detecting the expression level of target genes in leaves of Astragalus membranaceus under abiotic stress conditions; (7) Screening or identifying resistance genes in leaves of Astragalus membranaceus under abiotic stress conditions; (8) preparing a product for detecting the expression level of a target gene in leaves of Astragalus membranaceus under abiotic stress conditions; (9) preparing a product for screening or identifying resistance genes in leaves of Astragalus membranaceus under abiotic stress conditions; (10) preparing a product for screening or identifying flavonoid biosynthesis genes in leaves of Astragalus membranaceus under abiotic stress conditions; (11) Application of qRT-PCR in detecting gene transcription expression levels in roots and / or leaves of Astragalus membranaceus; (12) Application of fluorescence quantitative PCR in the detection of roots and / or leaves of Astragalus membranaceus under abiotic stress.

10. The use according to claim 9, characterized in that: The abiotic stress includes low temperature stress, lead stress and salt stress.

Images