Method for creating high-glossiness cucumber material and special biological material thereof

Abstract

The invention relates to a method for creating a high-glossiness cucumber material and a special biological material thereof, and belongs to the field of cucumber breeding. According to the method, a biological material for inhibiting BEC1 gene expression is introduced into a cucumber material to enable the BEC1 gene in a cucumber genome to lose functions, so that the cucumber material with improved cucumber epidermal glossiness is obtained, and the nucleotide sequence of the BEC1 gene is shown as a sequence 1 in a sequence table. According to the method disclosed by the invention, the BEC1 mutant can be obtained, a high-glossiness cucumber variety is successfully cultivated, a new breeding idea is provided for improving the commodity value of the cucumber, and the method has a wide market prospect in the field of the cucumber.

Description

Technical Field

[0001] The present invention relates to the field of cucumber breeding, and particularly to a method for creating a cucumber material with high glossiness and a specific biological material therefor. Background Art

[0002] Cucumber (Cucumis sativus L.), as a vegetable widely cultivated in China, not only has significant economic value but also is rich in nutrition and is highly beneficial to human health. In the fresh food and fruit market, cucumber fruits with a shiny luster are often more favored by consumers, which is an important way to enhance their commercial value and market competitiveness.

[0003] Traditional breeding methods for high glossiness quality mainly rely on cross-breeding, and only after the fruits develop and mature can the genotype or excellent offspring be indirectly selected through phenotypes, which is a low-efficiency method. Therefore, exploring the cucumber peel luster trait at the molecular level is of great significance for improving the efficiency of quality breeding and has important value for cultivating cucumber varieties with high glossiness.

[0004] Although previous studies have been conducted on the related traits of cucumber fruits, the research on the genetic law of cucumber peel luster trait is still insufficient. Summary of the Invention

[0005] In view of the deficiencies of the prior art, one object of the present invention is to provide an application of a biological material that inhibits the expression of the BEC1 gene.

[0006] Another object of the present invention is to provide a method for creating a cucumber variety with high glossiness.

[0007] To achieve the above objects, the present invention adopts the following technical solutions:

[0008] The first aspect of the present invention provides an application of a biological material that inhibits the expression of the BEC1 gene in creating a cucumber variety with high glossiness or in improving the glossiness of a cucumber variety, wherein the BEC1 gene has the nucleotide sequence as described in (1) or (2) below:

[0009] (1) The nucleotide sequence shown as Sequence 1 in the sequence listing;

[0010] (2) A DNA sequence that hybridizes with the nucleotide sequence described in (1) under stringent conditions and has the same function as the protein encoded by the nucleotide sequence described in (1).

[0011] The stringent conditions may be: hybridizing and washing the membrane at 65°C in a solution of 0.1X SSPE (or 0.1X SSC) and 0.1% SDS.

[0012] Sequence 1 in the sequence listing is a DNA molecule composed of 2,253 nucleotides, which is the genomic sequence of the BEC1 gene. Among them, this sequence 1 contains three exons. The nucleotides at positions 1 to 1,195 are the first exon, the nucleotides at positions 1,296 to 1,483 are the second exon, and the nucleotides at positions 1,993 to 2,253 are the third exon. The nucleotide sequence formed by the three exons is the coding sequence of this gene, encoding the BEC1 protein.

[0013] Through research, it has been found that the protein encoded by the BEC1 gene has the function of regulating the glossiness of cucumber peel. After the function of this gene fails, the glossiness of cucumber peel or epidermis will be significantly improved.

[0014] The biological material for inhibiting the expression of the BEC1 gene provided by the present invention can improve the glossiness of wild cucumber materials, or in other words, this biological material can be used to create cucumber varieties with high glossiness. The cucumber varieties created by the biological material of the present invention have high glossiness. The high glossiness mentioned in the present invention means that there is a statistically significant increase in glossiness compared to the control cucumber variety in which the expression of the BEC1 gene is not inhibited; or high glossiness means that the average value of the glossiness measured by a high-precision color difference meter is 37L or above (such as 38, 40, 42, 44, 46, 48, etc.), preferably the average value of the glossiness is 39L or above, and the average value is 30% higher than that of the control variety N62-5 (the glossiness is measured by a high-precision color difference meter), which is significantly different from the control variety. The average value of the glossiness mentioned in the present invention refers to taking at least 3 point values on the same cucumber for measurement and taking the average value as the glossiness of this cucumber.

[0015] The cucumber variety described in the present invention can be any existing cucumber variety, including commercially available or other source cucumber varieties.

[0016] In the application described in the first aspect of the present invention, the biological material for inhibiting the expression of the BEC1 gene can be the related biological material that knocks out the BEC1 gene through gene editing technology, or it can be the small molecule RNA that silences the BEC1 gene through RNA interference technology, such as miRNA, siRNA, dsRNA or shRNA, so that the function of the BEC1 gene fails.

[0017] Furthermore, the biological material for inhibiting the expression of the BEC1 gene includes any one of the following (a) to (c):

[0018] (a) The sgRNA expression cassette, which expresses the sgRNA targeting the BEC1 gene;

[0019] (b) The recombinant vector containing the sgRNA expression cassette described in (a);

[0020] (c) A host cell or host bacterium comprising the sgRNA expression cassette described in (a) or the recombinant vector described in (b).

[0021] Furthermore, the target sequence of the sgRNA is the nucleotide sequence shown in Sequence 2 in the Sequence Listing, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in Sequence 2 in the Sequence Listing.

[0022] Furthermore, the recombinant vector is obtained based on a CRISPR / Cas9 vector, which includes a Cas9 expression cassette and the above-mentioned sgRNA expression cassette. The Cas9 expression cassette expresses Cas9, and the sgRNA expression cassette expresses sgRNA.

[0023] The biological material can also be a transgenic cell line containing the above-mentioned recombinant vector, a host bacterium containing the above-mentioned recombinant vector, and other products that can be used for gene editing, such as Agrobacterium tumefaciens GV3101 containing the above-mentioned recombinant vector. In addition, the primers used to amplify any fragment of the BEC1 gene for screening the cucumber materials with expected gene mutations from the cucumber materials obtained after the transformation of the gene editing system also fall within the protection scope of the present invention.

[0024] The second aspect of the present invention provides a method for creating a cucumber variety with high glossiness (or a method for improving the glossiness of a cucumber variety). The method includes: using the biological material for inhibiting the expression of the BEC1 gene provided in the first aspect to cause the loss of function of the BEC1 gene in the cucumber genome, thereby obtaining a cucumber material with improved glossiness of the cucumber epidermis.

[0025] In the method provided in the second aspect of the present invention, the method specifically includes:

[0026] S1: Introduce the recombinant vector provided in the first aspect into the cucumber material, and obtain the successfully transformed plants through screening;

[0027] S2: Identify the lines with mutations in the BEC1 gene from the successfully transformed plants. When the BEC1 gene mutates into a homozygous mutation, the obtained cucumber material is the cucumber material with improved glossiness of the cucumber epidermis or the cucumber material with high glossiness; when the BEC1 gene mutates into a heterozygous mutation, step S3 is further included;

[0028] S3: Self-cross the cucumber materials with heterozygous mutations in the BEC1 gene, and then identify the cucumber materials with homozygous mutations in the BEC1 gene from the self-crossed offspring, that is, the cucumber materials with improved glossiness of the cucumber epidermis or the cucumber materials with high glossiness.

[0029] Further, the identification described in step S2 means: using the genome of the successfully transformed plant as a template for PCR amplification, and then detecting by gel electrophoresis or sequencing to obtain the lines in which the BEC1 gene has mutated.

[0030] Further, the identification described in step S3 means: using the genome of the self-crossed progeny plants as a template for PCR amplification, and then detecting by gel electrophoresis or sequencing to obtain the lines in which the BEC1 gene has homozygous mutations.

[0031] Furthermore, the nucleotide sequences of the primer pairs used for the PCR amplification are as shown in sequences 5 and 6 in the sequence listing.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] First, the inventors found that the BEC1 gene has the function of regulating the glossiness of cucumber epidermis. Therefore, the present invention inactivates the function of this gene by inhibiting the expression of the BEC1 gene in cucumber, thereby obtaining a cucumber variety with high glossiness. The research on this molecular mechanism has important theoretical and practical significance for cucumber breeding.

[0034] Second, the method for creating a cucumber variety with high glossiness provided by the present invention can create BEC1 mutants and successfully cultivate a cucumber variety with high glossiness. The experiment uses the CRISPR / Cas9 technology for gene editing, through steps such as target design and oligo sequence synthesis, vector construction, obtaining T0 generation bec1 mutants, and PCR identification to obtain T1 generation bec1 mutants. Finally, a bec1 mutant with frameshift mutations is obtained. Compared with the control variety, the fruits of the bec1 mutant show higher glossiness, which is also confirmed by measurement with a high-precision color difference meter. The successful application of this technology provides a new breeding idea for improving the commercial value of cucumbers. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is a schematic diagram of the BEC1 gene editing vector.

[0036] Figure 2 It is the sequencing identification result of the bec1 mutant.

[0037] Figure 3 It is the detection result of the pericarp phenotype and brightness of the bec1 mutant and the control N62-5, where (a) is a photo of the pericarp phenotype; (b) is a bar chart of the glossiness data measured by a high-precision color difference meter, and Glossinness of fruit on the vertical axis is the fruit glossiness. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0038] The present invention will be described in detail and explained through specific embodiments below. The following embodiments are only used to explain the technical features or solutions of the present invention, and do not limit the technical solutions of the present invention. Simple modifications made by those skilled in the art based on the present invention also fall within the protection scope of the present invention.

[0039] Unless otherwise specified, the experimental methods used in the following embodiments are usually carried out under conventional conditions, such as those described in the Molecular Cloning Experiment Guide (Second Edition, written by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or according to the conditions recommended by the manufacturer.

[0040] Unless otherwise specified, the materials, reagents, etc. used in the following embodiments can all be obtained from commercial channels.

[0041] In the following embodiments, all quantitative tests are set up with three repeated experiments, and the results are averaged.

[0042] Experimental Materials

[0043] The cucumber variety used in this experiment is N62-5, which is a cucumber variety with low glossiness. The average glossiness of the cucumber epidermis is 32L, and it is supplied by the Vegetable Research Institute of Beijing Academy of Agriculture and Forestry Sciences. The CRISPR / Cas9 vector used is from Hangzhou Baige Biotechnology Co., Ltd., and the product number is BGK03.

[0044] The medium formulations are as follows:

[0045] (1) MS medium (liquid): contains 4.43 g / L of MS powder, 30 g / L of sucrose, and 2.5 g / L of plant gel (this component is not added to the MS culture solution), and the pH value is maintained between 5.7 and 5.8.

[0046] (2) MS differentiation medium: On the basis of the MS medium, 0.5 mg / L of 6-BA and 1 mg / L of ABA are added.

[0047] (3) MS resistant differentiation medium: The components are the same as those of the MS differentiation medium.

[0048] (4) MS rooting medium: The components are the same as those of the MS medium.

[0049] (5) 1 / 2MS liquid medium: contains 2.2 g / L of MS powder, 30 g / L of sucrose, and the pH value is maintained at 5.7 to 5.8.

[0050] In addition, the TPS buffer is composed of 100 mM, pH = 8.0 Tris-HCl, 10 mM, pH = 8.0 EDTA, and 1 M KCl.

[0051] Through functional analysis, it was found that the protein BEC1 obtained by transcription and translation of the BEC1 gene shown in Sequence 1 can regulate the glossiness of cucumber epidermis. When the expression of the BEC1 gene is inhibited or the gene is knocked out, the glossiness of cucumber epidermis is significantly improved compared to the wild type. For details, please refer to Figure 3 。

[0052] Example 1 Obtaining the sequence of the BEC1 gene

[0053] The BEC1 gene sequence was obtained from the website http: / / www.cucumberdb.com / # / home. The genomic sequence of the BEC1 gene is as shown in Sequence 1 in the sequence listing.

[0054] Example 2 Construction of the recombinant vector

[0055] 1. Target design and oligo sequence synthesis

[0056] Using the DNA sequence in Sequence 1, target design was performed on the E-CRISPR website (http: / / www.e-crisp.org / E-CRISP / designcrispr.html), and the target sequence CATTCTGCAGAATTAAGGGATGG (Sequence 2) was obtained.

[0057] Subsequently, according to the guidelines of the CRISPR / CAS9 vector construction kit (BGK03), two Oligo sequences were successfully synthesized as follows:

[0058] Oligo-1: 5’-TGTGTGCATTCTGCAGAATTAAGGGATGG-3’ (Sequence 3);

[0059] Oligo-2: 5’-AAACCCATCCCTTAATTCTGCAGAATGCA-3’ (Sequence 4).

[0060] 2. Construction of the recombinant vector for gene editing of BEC1 in cucumber

[0061] (1) Preparation of oligo dimer: Take 1 μL each of the 10 μM oligo-1 and Oligo-2 solutions, add 18 μL BufferAneal, mix well, heat at 95 °C for 3 min, and then cool to 20 °C at a rate of 0.2 °C / s.

[0062] (2) Construction of the recombinant vector: Take 1 μL of the oligo dimer, 2 μL of the CRISPR / Cas Vector, 1 μL of the BsaIEnzyme Mix, supplement with ddH2O to 10 μL, and react at 20 °C for 1 h.

[0063] (3) Transformation: Add 5 μL of the reaction solution from step (2) to Trans1-T1 Escherichia coli competent cells. After ice-bathing for 30 min, heat-shock at 42 °C for 45 s, and immediately ice-bathe for 2 min. Add 700 μL of antibiotic-free LB medium and resuscitate at 37 °C and 200 rpm for 1 h.

[0064] (4) Screening: Spread on an LB plate containing kanamycin and culture overnight at 37 °C. Pick monoclonal colonies for sequencing verification. Successfully construct the BEC1 gene editing vector, and a partial structure of the vector is as Figure 1 shown.

[0065] Example 3 Obtaining of T0 Generation Regenerated Plants

[0066] 1. Seed disinfection and sowing

[0067] Select plump cucumber N62-5 seeds. First, disinfect with 70% alcohol for 30 s, then soak in 2.0% sodium hypochlorite solution for 15 min for sterilization treatment. Then rinse thoroughly with sterile water and sow on MS medium. Wait for 2 to 3 days until the cotyledons break through the shell before proceeding to the next step.

[0068] 2. Preparation of Agrobacterium

[0069] Take 1 μg of the recombinant vector prepared in Example 2 and place it in 100 μL of GV3101 competent cells. Quick-freeze in liquid nitrogen for 3 minutes, water-bathe at 37 °C for 5 minutes. Pick a single colony of Agrobacterium carrying the recombinant plasmid and inoculate it into YEB medium containing 50 mg / L kanamycin and 70 mg / L rifampicin. Shake-culture overnight at 28 °C and 200 rpm / min. Subsequently, take 2 mL of the bacterial solution and add it to 50 mL of YEB medium with the same antibiotic concentration, and continue to shake-culture for about 14 h until the late logarithmic growth phase, with the OD600 value between 0.6 and 0.8. Then, centrifuge at 5000 rpm for 5 min to collect the bacterial cells. Wash the bacterial cells once with 1 / 2 MS liquid medium and dilute it to 5 times the original volume of the bacterial solution to ensure that the OD600 value is about 0.2 for subsequent infection.

[0070] 3. Infection operation

[0071] Select cucumber seeds that have grown for 2 days, remove the growing point and hypocotyl, and at the same time cut off the upper half (about 1 / 2 to 1 / 3) of the two cotyledons, leaving the lower half of the cotyledons. Infect the cotyledons with the diluted bacterial solution prepared in the previous step for 15 min. After infection, gently blot the excess bacterial solution with a sterilized filter paper, and place the cotyledon pieces with the back facing down on the differentiation medium. Conduct dark culture at 28 °C for 2 d.

[0072] 4. Resistance screening and culture

[0073] After 2 days of co-culture, the explants were transferred onto MS differentiation medium containing 25 mg / L kanamycin and 500 mg / L carbenicillin, and placed in a tissue culture room for cultivation. After about 15 to 20 days, when the resistant buds grew to 1 to 1.5 cm in length, they were cut and transferred into MS rooting medium containing 100 mg / L kanamycin to induce root formation, thereby obtaining resistant plants.

[0074] 5. Transplanting and management

[0075] After the roots of the transgenic cucumbers were well-developed (with 5 to 6 leaves), they were transplanted into flower pots filled with sterile soil. Covered with plastic wrap to maintain moisture, and cultured in an artificial climate chamber for one week. Then the plants were transferred to a greenhouse for a 3- to 5-day adaptation period, and finally the transgenic seedlings were managed according to the conventional method. Eventually, 2 transgenic seedlings were obtained.

[0076] Example 4 Identification of T1 generation bec1 mutants by PCR

[0077] 1. Obtaining T1 generation bec1 mutants

[0078] The T0 generation transgenic seedlings obtained in Example 3 were self-crossed, and T1 generation seeds were successfully harvested. After these seeds were germinated, they were raised in 32-well trays with a size of 540 * 280 mm, and then T1 generation plants were cultivated.

[0079] 2. Extracting DNA from T1 generation plants

[0080] Approximately 0.5 g of samples were taken from the above-mentioned cultivated T1 generation plants and N62-5 leaves and placed into 2 mL centrifuge tubes, and TPS was added as the DNA extraction solution. To improve the extraction efficiency, 2 steel beads with a diameter of 4 mm were added to the centrifuge tubes, and a high-throughput grinder was used for DNA grinding extraction. Subsequently, centrifuged at a speed of 10000 rpm for 2 minutes. 20 μL of the supernatant was transferred to a new centrifuge tube, and 180 μL of deionized water was added to ensure uniform mixing.

[0081] 3. Identification of bec1 mutants by PCR

[0082] Using the DNA extracted above as a template, PCR amplification was carried out using specific primers for BEC1. The primer sequences selected were:

[0083] Forward primer F: 5’-TAGGCTCAATTGCCTTCGCA-3’ (Sequence 5);

[0084] Reverse primer R: 5’-GGAAAGCAAGCAACAGTAAGAGG-3’ (Sequence 6).

[0085] PCR reaction procedure: pre-denaturation at 94°C for 5 min; 35 cycles of 94°C for 30 s, 55°C for 15 s, and 72°C for 30 s; final extension at 72°C for 7 min. The PCR products were sent to Qingke Biotechnology Co., Ltd. for sequencing.

[0086] The sequencing results showed as Figure 2 follows:

[0087] bec1-1 mutant: a CT deletion at position +730 in the BEC1 coding region, resulting in a frameshift mutation and being a homozygous mutant.

[0088] bec1-2 mutant: a AATT deletion at position +733 in the BEC1 coding region, resulting in a frameshift mutation and being a homozygous mutant.

[0089] Phenotype observation and brightness measurement of the above two bec1 mutants

[0090] After cultivating the bec1-1 mutant and bec1-2 mutant mentioned above in a 32-well plate until they grew 4 true leaves, they were transplanted into the solar greenhouse of the Vegetable Research Institute of Beijing Academy of Agriculture and Forestry Sciences for observing and recording the phenotypic characteristics of the plants. Through visual observation, we found that the fruits of the two bec1 mutants showed higher glossiness compared with the control variety N62-5. The specific results are as Figure 3 (a) shown.

[0091] To more precisely quantify the brightness of the fruit peel, we used a high-precision color difference meter (NR-200, produced by Guangdong 3nh Technology Co., Ltd.) for measurement. On the relatively flat area of the fruit surface, the color difference meter automatically compared the difference between the standard sample and the object to be measured, and directly output the three parameter values of L, a, and b in the "CIELAB" color space, and then judged the color and brightness according to these values. To ensure the accuracy of the data, we measured each fruit at three different positions and repeated the experiment three times. The results showed that the brightness of the bec1 mutants was significantly higher than that of the control variety N62-5, as Figure 3 (b) shown.

Claims

1. Use of a biological material that inhibits the expression of the BEC1 gene in creating a high-gloss cucumber variety or in improving the gloss of a cucumber variety, wherein the BEC1 gene has a nucleotide sequence as described in (1) or (2): (1) the nucleotide sequence shown in Sequence 1 in the sequence listing; (2) A DNA sequence that hybridizes with the nucleotide sequence described in (1) under stringent conditions and has the same function as the protein encoded by the nucleotide sequence described in (1).

2. The application according to claim 1, characterized in that: The biological material for inhibiting the expression of the BEC1 gene utilizes gene editing technology to knock out the BEC1 gene, so as to disable the function of the BEC1 gene.

3. The application according to claim 2, characterized in that: The biological material for inhibiting the expression of the BEC1 gene includes any one of the following (a) to (c): (a) sgRNA expression cassette, which expresses sgRNA targeting the BEC1 gene; (b) a recombinant vector comprising the sgRNA expression cassette described in (a); (c) a host cell or host bacteria comprising the sgRNA expression cassette described in (a) or the recombinant vector described in (b).

4. The use according to claim 3, characterized in that: The target sequence of the sgRNA is the nucleotide sequence shown in Sequence 2 in the sequence list, or the target sequence of the sgRNA is the reverse complementary sequence of the sequence shown in Sequence 2 in the sequence list.

5. The application according to claim 3, characterized in that: The recombinant vector comprises a Cas9 expression cassette and the sgRNA expression cassette according to claim 3 or 4, and the Cas9 expression cassette expresses Cas9.

6. The use according to claim 3, characterized in that: The high glossiness refers to a statistically significant improvement in glossiness relative to a control cucumber variety in which BEC1 gene expression is not inhibited; or the high glossiness refers to an average glossiness value of 37L or above measured by a high-precision colorimeter, preferably an average glossiness value of 39L or above.

7. A method for creating a high-gloss cucumber variety, characterized in that: The method comprises: using the biological material described in any one of claims 1 to 6 to cause the BEC1 gene function in the cucumber genome to be lost, thereby obtaining a cucumber material with improved cucumber skin glossiness.

8. The method according to claim 7, characterized in that The method specifically comprises: S1: introducing the recombinant vector according to any one of claims 3 to 5 into a cucumber material, and obtaining successfully transformed plants by screening; S2: obtaining a strain with a mutation in the BEC1 gene from the successfully transformed plants by identification, and when the BEC1 gene mutation is a homozygous mutation, the obtained cucumber material is a cucumber material with improved glossiness of the cucumber skin or a cucumber material with high glossiness; when the BEC1 gene mutation is a heterozygous mutation, step S3 is also included; S3: Self-pollinate cucumber materials with heterozygous mutations in the BEC1 gene, and then identify cucumber materials with homozygous mutations in the BEC1 gene from the self-pollinated progeny, i.e., cucumber materials with improved cucumber skin gloss or cucumber materials with high gloss.

9. The method according to claim 8, characterized in that The identification in step S2 refers to: using the genome of the successfully transformed plant as a template for PCR amplification, and then detecting by gel electrophoresis or sequencing to obtain a strain with a mutation in the BEC1 gene.

10. The method according to claim 8, characterized in that The nucleotide sequences of the primer pairs used in the PCR amplification are shown in Sequence 5 and Sequence 6 in the sequence listing.

Images