Method for high-yield production of sialic acid lactose through double-bacterium coupling fermentation

Through the bifidobacterial coupled fermentation method, N-acetylglucosamine and lactose are used as substrates, combined with the enzyme conversion ability of Saccharomyces cerevisiae, the yield and production efficiency of 3'-sialic acid lactose were successfully improved, and the problems of high production costs and low efficiency in the prior art were solved.

CN120210310APending Publication Date: 2025-06-27JIANGNAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510170741.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-17
Publication Date
2025-06-27

AI Technical Summary

Technical Problem

In the prior art, 3'-sialic acid lactose has high production cost and low production efficiency, making it difficult to meet the demand for large-scale industrial production.

Method used

Using the bifidobacterial coupled fermentation method, the cheaper N-acetylglucosamine was used as the substrate to synthesize sialic acid in two steps, and then 3'-sialic acid lactose was synthesized using lactose. At the same time, the enzyme system in Saccharomyces cerevisiae is used to convert the cheaper cytidine-5'-monophosphate into cytidine 5'-triphosphate, reducing the transformation steps of E. coli and reducing production costs.

Benefits of technology

Through the bifidil coupled fermentation method, the yield of 3'-sialic acid lactose reached 78.03g/L, which is much higher than the current output, and effectively reduces production costs.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210310A_ABST
    Figure CN120210310A_ABST
Patent Text Reader

Abstract

The invention relates to a method for high-yield production of sialyllactose through double-bacterium coupling fermentation, and belongs to the technical field of genetic engineering. According to the invention, N-acetylglucosamine and lactose are taken as substrates, and recombinant bacteria are utilized to over-express N-acetylglucosamine 2-iminase, N-acetylneuraminidase, cytidine-5 '-monophosphate-sialic acid synthetase and alpha-2, 3-sialic acid transferase to construct a 3'-sialic acid lactose synthesis path; meanwhile, the yeast is used as a CTP donor to be coupled and fermented with the recombinant bacteria, and fermentation conditions are optimized, so that the yield of the finally obtained 3 '-sialic acid lactose is up to 78.03 g / L and is far higher than the highest yield in the prior art. According to the method for producing the 3 '-sialic acid lactose at high yield through double-bacterium coupling fermentation, the production efficiency of the 3'-sialic acid lactose is remarkably improved while the production cost is reduced, and industrial expanded production is facilitated.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly to a method for producing lactosylsialic acid with high yield by dual-bacteria coupled fermentation. Background Art

[0002] 3'-sialyllactose (3'-SL) is a multifunctional oligosaccharide present in breast milk and is composed of sialic acid directly linked to lactose via an α-1,3 glycosidic bond. The synthesis methods of 3'-sialyllactose include extraction method, chemical synthesis method, and biosynthesis method. Although the extraction method can ensure that the natural structure of 3'-sialyllactose is not damaged, it is difficult to obtain breast milk, and the extraction method cannot achieve large-scale production. Although the chemical synthesis method can guide large-scale production, the reaction process is complex and the yield of 3'-sialyllactose is low. Constructing engineering microorganisms and using the biosynthesis method can overcome the above disadvantages, but how to produce 3'-sialyllactose more efficiently still needs further research. Whole-cell biocatalysis is one of the simplest and oldest catalytic methods for the production of natural compounds. Using a whole-cell biocatalysis system does not require the purification of enzymes. The cell as a carrier can contain a series of enzymes, greatly reducing the production cost of industrial applications. In addition, using microorganisms such as fungi and bacteria is a sustainable production method, and the cell itself can provide cofactors without additional supplementation.

[0003] The high production cost and low production efficiency are the main problems faced in the large-scale and efficient production of 3'-sialyllactose at present. The current production of 3'-sialyllactose is carried out by fermentative synthesis using sialic acid or glucose as a substrate. However, when using sialic acid as a substrate, the production cost is high, and when using glucose as a substrate, the production efficiency of 3'-sialyllactose is low. The highest current fermentation yield of 3'-sialyllactose reached 56.8 g / L in a 5L bioreactor, which set a record in this field. However, for industrial production, its production cost and production efficiency still cannot meet industrial requirements. Summary of the Invention

[0004] Therefore, the technical problem to be solved by the present invention is to overcome the problems of high production cost and low production efficiency of 3'-sialyllactose in the prior art.

[0005] To solve the above technical problems, the present invention provides a method for producing high-yield sialyllactose by dual-bacteria coupled fermentation. Aiming at the problem of high production cost, the present invention uses a cheaper N-acetylglucosamine as a substrate, first synthesizes an important precursor sialic acid through two steps, and then uses lactose to synthesize 3'-sialyllactose through two steps. In the process of synthesizing 3'-sialyllactose from sialic acid and lactose, the participation of cytidine 5'-triphosphate (CTP) is required, but the price of CTP is relatively high. If a large amount of CTP is added, the production cost will inevitably increase. The present invention uses Saccharomyces cerevisiae to participate in the synthesis of 3'-sialyllactose. The yeast body contains a rich enzyme system, which can convert the relatively cheap cytidine-5'-monophosphate (CMP) into CTP without consuming lactose, reducing the modification steps of Escherichia coli, reducing the metabolic pressure of Escherichia coli, and effectively reducing the production cost. In addition, the present invention also optimizes the induction conditions and fermentation conditions. Therefore, the yield of 3'-sialyllactose after the dual-bacteria coupled fermentation of the present invention is as high as 78.03 g / L, far higher than the existing yield.

[0006] The first object of the present invention is to provide a method for producing high-yield sialyllactose by dual-bacteria coupled fermentation, inoculating yeast and recombinant bacteria into a fermentation system with N-acetylglucosamine, pyruvate, and lactose as substrates for coupled fermentation to synthesize the 3'-sialyllactose, wherein the recombinant bacteria overexpress N-acetylglucosamine 2-imide enzyme, N-acetylneuraminidase, cytidine-5'-monophosphate-sialic acid synthase, and α-2,3 sialyltransferase.

[0007] Furthermore, the gene ce_3 encoding the N-acetylglucosamine 2-imide enzyme has a nucleotide sequence as shown in SEQ ID NO.1, the gene nanA encoding the N-acetylneuraminidase has a nucleotide sequence as shown in SEQ ID NO.2, the gene neuA encoding the CMP-Neu5Ac synthase has a nucleotide sequence as shown in SEQ ID NO.3, and the gene nst3 encoding the α-2,3 sialyltransferase has a nucleotide sequence as shown in SEQ ID NO.4.

[0008] Furthermore, the sequence of SEQ ID NO.1 is as follows:

[0009]

[0010] Furthermore, the sequence of SEQ ID NO.2 is shown as follows:

[0011] ATGGCTAGCGCTACTTTTACGGGTGTTATTCCGCCTGTTATGACTCCGCTGCACGCTGATGGTAGCGTGGACGTTGAAAGCCTGCGTAAACTGGTTGATCACCTGATTAACGGTGGTGTGGACGGTCTGTTCGCTCTGGGCTCCAGCGGTGAAGCTGCATTCCTGACCCGTGCCCAGCGTAAACTGGCTCTGACCACCATTATCGAACACACCGCTGGTCGCGTTCCGGTTACCGCAGGTGTCATCGAAACCACCACTGCGCGTGTGATCGAACTGGTAGAGGATGCCCTGGAAGCGGGTGCAGAAGGTCTGGTAGCCACTGCGCCATTCTACACTCGCACCCACGATGTGGAAATCGAAGAACACTTCCGTAAAATTCATGCAGCAGCACCGGAACTGCCGCTGTTTGCGTACAACATTCCGGTGTCTGTGCACTCTAACCTGAATCCGGTTATGCTGCTGACCCTGGCAAAGGATGGCGTCCTGGCTGGTACTAAAGACAGCTCTGGCAACGACGGTGCTATCCGTTCTCTGATCGAAGCTCGTGACGATGCAGGCCTGACCGAGCAGTTTAAGATCCTGACTGGTAGCGAAACCACTGTTGATTTCGCATACCTGGCTGGTGCGGACGGTGTTGTACCAGGTCTGGGTAACGTGGACCCGGCAGCTTATGCAGCGCTGGCTAAGCTGTGCCTGGACGGTAAATGGGCTGAAGCGGCAGCGCTGCAGAAACGCATTAATCATCTGTTCCACATCGTTTTCGTTGGTGATACCTCTCACATGTCCGGTAGCTCTGCAGGTCTGGGTGGTTTCAAAACTGCCCTGGCCCACCTGGGCATTATCGAATCTAACGCGATGGCGGTGCCTCATCAGTCTCTGTCCGATGAAGAAACCGCTCGTATTCACGCGATTGTTGATGAATTCCTGTATACCGCGTAA

[0012] Furthermore, the sequence of SEQ ID NO.3 is shown as follows:

[0013] ATGGAAAAACAAAATATTGCGGTTATACTTGCGCGCCAAAACTCCAAAGGATTGCCATTAAAAAATCTCCGGAAAATGAATGGCATATCATTACTTGGTCATACAATTAATGCTGCTATATCATCAAAGTGTTTTGACCGCATAATTGTTTCGACTGATGGCGGGTTAATTGCAGAAGAAGCTAAAAATTTCGGTGTCGAAGTCGTCCTACGCCCTGCAGAGCTGGCCTCCGATACAGCCAGCTCTATTTCAGGTGTAATACATGCTTTAGAAACAATTGGCAGTAATTCCGGCACAGTAACCCTATTACAACCAACCAGTCCATTACGCACAGGGGCTCATATTCGTGAAGCTTTTTCTCTATTTGATGAGAAAATAAAAGGATCCGTTGTCTCTGCATGCCCAATGGAGCATCATCCACTAAAAACCCTGCTTCAAATCAATAATGGCGAATATGCCCCCATGCGCCATCTAAGCGATTTGGAGCAGCCTCGCCAACAATTACCTCAGGCATTTAGGCCTAATGGTGCAATTTACATTAATGATACTGCTTCACTAATTGCAAATAATTGTTTTTTTATCGCTCCAACCAAACTTTATATTATGTCTCATCAAGACTCTATCGATATTGATACTGAGCTTGATTTACAACAGGCAGAAAACATTCTTAATCACAAGGAAAGCTAA

[0014] Furthermore, the sequence of SEQ ID NO.4 is shown as follows:

[0015]

[0016] Furthermore, the addition amount of N-acetylglucosamine is 100 - 500 mM.

[0017] Furthermore, the addition amount of lactose is 80 - 250 mM.

[0018] Furthermore, the addition amount of yeast is 50 - 150 g / L.

[0019] Furthermore, the addition amount of pyruvic acid is 300 - 700 mM.

[0020] Furthermore, the fermentation system further includes CMP, and the addition amount of CMP is 10 - 70 mM.

[0021] Furthermore, the recombinant bacterium uses Escherichia coli or Bacillus subtilis as the host.

[0022] Furthermore, the yeast is selected from one or more of baker's yeast, brewer's yeast, and Saccharomyces cerevisiae.

[0023] Furthermore, the recombinant bacterium is induced to culture, and the induced recombinant bacterium and yeast are inoculated into a fermentation system with N-acetylglucosamine, pyruvic acid, and lactose as substrates for coupled fermentation to synthesize the 3'-sialyllactose. Among them, the recombinant bacterium overexpresses N-acetylglucosamine 2-imide enzyme, N-acetylneuraminidase, CMP-Neu5Ac synthase, and α-2,3 sialyltransferase. The temperature of the induced culture is 15 - 35 °C, the time of the induced culture is 10 - 35 hours, and the OD value of the induced culture is 0.6 - 1.5.

[0024] Furthermore, the fermentation system further includes 0.5 - 1.5 mM DTT, 15 - 25 mL / L glycerol, 2.5 - 7.5 g / L acetaldehyde, 15 - 25 mM MgCl2, 200 - 250 mM KH2PO4, 100 - 200 mM Tris, and 3 - 5 g / L octadecylamine polyoxyethylene ether.

[0025] Furthermore, the temperature of the coupled fermentation is 25 - 35 °C.

[0026] Advantages of the present invention:

[0027] The present invention provides a method for producing high - yield sialyllactose by dual - strain coupled fermentation. The present invention uses a cheaper N - acetylglucosamine as a substrate, first synthesizes an important precursor sialic acid through two steps, and then synthesizes 3'-sialyllactose from lactose in two steps. At the same time, Saccharomyces cerevisiae is used to participate in the synthesis of 3'-sialyllactose. The yeast contains a rich enzyme system, which can convert relatively cheap cytidine - 5'-monophosphate (CMP) into CTP without consuming lactose, reducing the modification steps of Escherichia coli, reducing the metabolic pressure of Escherichia coli, and effectively reducing the production cost. In addition, the present invention also optimizes the induction conditions and fermentation conditions. Therefore, the yield of 3'-sialyllactose after the dual - strain coupled fermentation of the present invention is as high as 78.03 g / L, far higher than the existing yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to make the content of the present invention easier to be clearly understood, the following further details the present invention according to specific embodiments of the present invention and in combination with the drawings, wherein

[0029] Figure 1 is the technical route map of the dual - strain coupled whole - cell synthesis of 3'-sialyllactose of the present invention;

[0030] Figure 2 is the detection result of the recombinant plasmid pCDF Deut - 1 - ce_3 - nanA protein expression and whole - cell synthesis of sialic acid of the present invention; wherein a is the protein expression result, 1 is the expression result before induction, 2 is the expression result after induction; b is the TLC detection result, 1 is the sialic acid standard, 2 is the supernatant of the catalytic solution, 3 is the uncatalyzed negative control; c is the detection result of purified MALDI - TOF MS;

[0031] Figure 3 is the detection result of the recombinant plasmid pET Deut - 1 - neuA - nst3 protein expression and whole - cell synthesis of 3'-sialyllactose of the present invention; wherein a is the protein expression result, 1 is the expression result before induction, 2 is the expression result after induction; b is the TLC detection result, 1 is the sialic acid standard, 2 is the 3'-sialyllactose standard, 3 is the supernatant of the catalytic solution, 4 is the uncatalyzed negative control; c is the detection result of purified MALDI - TOF MS;

[0032] Figure 4 is the construction and screening result of the optimal plasmid for the synthesis of sialic acid and 3'-sialyllactose by the engineering strain Escherichia coli JM109(DE3) of the present invention; a is the combination of different vectors and gene construction; b is the screening result of the optimal plasmid for the synthesis of sialic acid; c is the screening result of the optimal plasmid for the synthesis of 3'-sialyllactose;

[0033] Figure 5It is the optimization result of the induction conditions of the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA of the present invention; a is the TLC detection result, 1 is the sialic acid standard, 2 is the 3'-sialyllactose standard, and 3 is the supernatant of the catalytic solution; b is the effect of different induction temperatures on the synthesis of 3'-sialyllactose; c is the effect of different induction times on the synthesis of 3'-sialyllactose; d is the effect of different induction OD on the synthesis of 3'-sialyllactose;

[0034] Figure 6 It is the optimization result of the whole-cell catalytic system of the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA of the present invention; a is the effect of different N-acetylglucosamine concentrations on the synthesis of 3'-sialyllactose; b is the effect of different pyruvic acid concentrations on the synthesis of 3'-sialyllactose; c is the effect of different CMP concentrations on the synthesis of 3'-sialyllactose; d is the effect of different lactose concentrations on the synthesis of 3'-sialyllactose; e is the effect of different yeast addition amounts on the synthesis of 3'-sialyllactose;

[0035] Figure 7 It is the result of the coupled whole-cell synthesis of 3'-sialyllactose by the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA of the present invention in a 5L fermenter system and yeast; a is the growth of the engineered strain in a 5L fermenter; b is the synthesis of 3'-sialyllactose by the engineered strain in a 5L fermenter coupled with yeast. Detailed implementation manners

[0036] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the specific embodiments cited are not intended to limit the present invention.

[0037] The sources of the materials in the present specific implementation method are as follows:

[0038] (1) Saccharomyces cerevisiae; obtained by fermentation and culture of GDMCC61663. Escherichia coli JM109(DE3) was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; other reagents used can be obtained commercially;

[0039] (2) Sources of genes required for the experiment: ce_3 is from Bacteroides thetaiotaomicron; nanA is from Escherichia coli K-12; neuA is from Neisseria meningitidis; nst3 is from Neisseria gonorrhoeae; the genes involved were all synthesized after artificial codon optimization;

[0040] (3) Culture media and main solutions

[0041] LB liquid medium (g / L): NaCl 10.0, tryptone 10.0, yeast extract 5.0, pH 7.0; Sterilization condition: 121 °C for 20 min.

[0042] LB solid medium (g / L): NaCl 10.0, tryptone 10.0, yeast extract 5.0, agar 20.0, pH 7.0; Sterilization condition: 121 °C for 20 min.

[0043] Fermentation medium (g / L): casein 10.0, yeast extract 5.0, NH4Cl 2.674, Na2HPO4 3.549, KH2PO4 3.402, Na2SO4 0.7102, MgSO4 0.3244, glycerol 5.0, glucose 0.5. Sterilization condition: 115 °C for 30 min.

[0044] Yeast seed medium: glucose 10 g / L, peptone 5 g / L, yeast extract 15 g / L, sodium chloride 4 g / L, pH 7.0.

[0045] Yeast basic fermentation medium: glucose 20 g / L, ammonium sulfate 8 g / L, KH2PO4 2.5 g / L, MgSO4·7H2O 0.5 g / L, pH 5.5.

[0046] Diphenylamine - aniline - phosphoric acid solution: 4 g of diphenylamine, 4 mL of aniline and 20 mL of 85% phosphoric acid are dissolved in 200 mL of acetone.

[0047] The detection methods used in the present invention are as follows:

[0048] (1) Isolation and purification of sialic acid and 3'-sialyllactose

[0049] Separation and purification method: Use HyperSep Hypercarb solid-phase extraction cartridge (SPE cartridge) for purification. The purification steps are as follows: Activation: Activate the SPE cartridge with 3 mL of methanol; Equilibration: Equilibrate the SPE cartridge with 3 mL of ultrapure water and keep it moist; Loading: Take 300 μL of the catalytic supernatant and evenly pass it through the SPE cartridge; Washing: Wash the SPE cartridge with 1 mL of ultrapure water, repeating three times; Elution: Elute the product with 0.5 mL of 80% acetonitrile, repeating 3 times.

[0050] (2) Analysis and detection of sialic acid and 3'-sialyllactose

[0051] Thin-layer chromatography (TLC): The developing agent is v(n-propanol):v(water):v(25% ammonia water) = 37.5:15:10. After the thin-layer chromatography plate is naturally dried, it is stained with diphenylamine-aniline-phosphoric acid solution and placed in an oven at 105 °C for 1 min for color development.

[0052] (3) Matrix-assisted laser ionization time-of-flight mass spectrometry (MALDI-TOF-MS): Identify the molecular weight of the purified product. Mix 1 μL of the purified product and 1 μL of the spotting matrix 2,5-dihydroxybenzoic acid containing Na + , and spot them at the same position on the target plate respectively. After mixing evenly, dry them and load them onto the instrument for processing. Mass spectrometry conditions: Use the reflectron positive ion mode; Scanning molecular weight range: 0 - 2000 Da.

[0053] (4) High-performance liquid chromatography (HPLC): The ultraviolet detection wavelength is 210 nm; The chromatographic column is Aminex HPX-87H Ion Exclusion Column (7.8 mm × 300 mm); The mobile phase is 5 mM H2SO4; The column temperature is 60 °C; The injection volume is 10 μL; The flow rate is 0.6 mL / min.

[0054] (5) SDS-PAGE gel electrophoresis: Take 40 μL of the bacterial solution before and after induction and add 10 μL of protein loading buffer, mix evenly, boil in water bath for 4 min, ice bath for 2 min, and take 10 μL of the mixed solution for SDS-PAGE gel electrophoresis. After protein electrophoresis, the bacteria that successfully induced the expression of the target protein are stored at -20 °C for later use.

[0055] Example 1: Construction of engineering strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA and protein induction expression

[0056] Construct the recombinant plasmid pCDF Deut-1-ce_3-nanA by homologous recombination. Use the ce_3 gene sequence in Bacteroides thetaiotaomicron and the nanA gene sequence in Escherichia coli K-12 as templates to synthesize the target genes, and design primers pCDF-F, pCDF-R, ce_3-F, ce_3-R, nanA-F, and nanA-R. PCR amplification yields the corresponding fragments. The plasmid fragment pCDF Deut-1 can be amplified using primers pCDF-F / R, and the gene fragments ce_3 and nanA can be amplified using primers ce_3-F / R and nanA-F / R. After verification by nucleic acid electrophoresis, gel extraction is performed, and the above fragments are ligated by homologous recombination.

[0057] Transform the successfully constructed recombinant plasmid pCDF Deut-1-ce_3-nanA into the competent cell E. coli JM109(DE3), perform plate coating using Amp as the screening marker, pick single colonies for shake flask culture after verification by colony PCR, extract the plasmid in the bacterial liquid for PCR verification, and send it to Tianlin Biotechnology (Wuxi) Co., Ltd. for sequencing and identification.

[0058] Induce the expression of the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA and perform SDS-PAGE ( Figure 2 -a) is consistent with the actual molecular weight size, indicating the successful expression of the target protein.

[0059] At the shake flask level, use the successfully induced strain to culture and perform whole-cell catalysis for the synthesis of sialic acid using N-acetylglucosamine as the substrate, and the catalytic reaction lasts for 24 h. TLC detection reveals the presence of a component in the fermentation broth with the same Rf value as the standard sialic acid ( Figure 2 -b). After purification of the catalytic solution, perform MALDI-TOF MS detection on it ( Figure 2 -c), and the synthesized target product sialic acid can be identified.

[0060] Table 1 Primers and their sequences involved in Example 1

[0061] SEQ ID Primer Name Sequence SEQ ID NO.5 pCDF-F ATATACATATGGCAGATCTCAATTGGATATCGG SEQ ID NO.6 pCDF-R CTCCTTATTAAAGTTAAACAAAATTATTTCTACAGGGGAATTG SEQ ID NO.7 ce_3-F AACTTTAATAAGGAGTATACCATGGACTTCAAGAAACTGGCTAAC SEQ ID NO.8 ce_3-R CTGCCCATGGTATATTTACAGCGGCTCCAGGACTTTC SEQ ID NO.9 nanA-F AAGTATAAGAAGGAGTATACCATGGCTAGCGCTACTTTTACG SEQ ID NO.10 nanA-R CTGCCATATGTATATTTACGCGGTATACAGGAATTCATCAACAATC

[0062] Example 2: Construction and protein induction expression of the engineered strain E. coli JM109(DE3) / pET Deut-1-neuA-nst3

[0063] Construct the recombinant plasmid pET Deut-1-neuA-nst3 by homologous recombination. Use the neuA gene sequence in Neisseria meningitidis and the nst3 gene sequence in Neisseria gonorrhoeae as templates to synthesize the target genes, and design primers pET-F, pET-R, neuA-F, neuA-R, nst3-F, and nst3-R. Amplify the corresponding fragments by PCR. The plasmid fragment pET Deut-1 can be amplified using primers pET-F / R, and the gene fragments neuA and nst3 can be amplified using primers neuA-F / R and nst3-F / R. After verifying the correctness by nucleic acid electrophoresis, cut the gel and recover the fragments, and then ligate the above fragments by homologous recombination.

[0064] Transform the successfully constructed recombinant plasmid pET Deut-1-neuA-nst3 into the competent cell E. coli JM109(DE3), coat the plate using Str as the screening marker, pick a single colony for shake flask culture after verifying by colony PCR, extract the plasmid in the bacterial solution for PCR verification, and send it to Tianlin Biotechnology (Wuxi) Co., Ltd. for sequencing and identification.

[0065] Induce the expression of the engineering strain E. coli JM109(DE3) / pET Deut-1-neuA-nst3 and perform SDS-PAGE ( Figure 3 -a) which is consistent with the actual molecular weight size, indicating the successful expression of the target protein.

[0066] At the shake flask level, co-culture the induced strain with Saccharomyces cerevisiae and use sialic acid as the substrate for whole-cell catalysis to synthesize 3'-sialyllactose, and catalyze the reaction for 24 h. It is found by TLC detection that there is a component in the fermentation broth with the same Rf value as the standard 3'-sialyllactose ( Figure 3 -b). After purifying the catalytic solution, perform MALDI-TOF MS detection on it ( Figure 3 -c), and it can be determined that the target product 3'-sialyllactose is synthesized.

[0067] Table 2 Primers and their sequences involved in Example 2

[0068]

[0069] Example 3: Construction and screening of the optimal plasmid for sialic acid synthesis by the engineering strain E. coli JM109(DE3)

[0070] Construct recombinant plasmids pET Deut-1-ce_3-nanA, pET Deut-1-nanA-ce_3, pCDF Deut-1-ce_3-nanA, and pCDF Deut-1-nanA-ce_3 by homologous recombination. After verifying the plasmid fragments pETDeut-1 and pCDF Deut-1, and gene fragments ce_3 and nanA obtained by PCR amplification through nucleic acid electrophoresis, cut the gel and recover them. Connect the above fragments by homologous recombination to construct combinations as Figure 4 shown in -a.

[0071] Transform the 4 successfully constructed recombinant plasmids into competent cells E. coli JM109(DE3) respectively. The plasmid vector pET Deut-1 uses Amp as the screening marker, and the plasmid vector pCDF Deut-1 uses Str as the screening marker. Perform plate coating, pick single colonies for shake flask culture after verifying by colony PCR, extract the plasmids in the bacterial liquid for PCR verification, and send them to Tianlin Biotechnology (Wuxi) Co., Ltd. for sequencing and identification.

[0072] At the shake flask level, use the 4 induced engineering strains for culture to catalytically synthesize sialic acid with N-acetylglucosamine as the substrate for 24 h. Use HPLC to quantitatively analyze the supernatant of the fermentation broth. After 24 h of fermentation, the sialic acid yield of the engineering strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA is the best, with a concentration of 4.09 g / L and a conversion rate of N-acetylglucosamine of 11.55% ( Figure 4 shown in -b).

[0073] Example 4: Construction and screening of the optimal plasmid for synthesizing 3'-sialyllactose by engineering strain E. coli JM109(DE3)

[0074] Construct recombinant plasmids pET Deut-1-neuA-nst3, pET Deut-1-nst3-neuA, pCDF Deut-1-neuA-nst3, and pCDF Deut-1-nst3-neuA by homologous recombination. After verifying the plasmid fragments pETDeut-1 and pCDF Deut-1, and gene fragments neuA and nst3 obtained by PCR amplification through nucleic acid electrophoresis, cut the gel and recover them. Connect the above fragments by homologous recombination to construct combinations as Figure 4 shown in -a.

[0075] The four successfully constructed recombinant plasmids were separately transformed into the competent cell E. coli JM109(DE3). The plasmid vector pET Deut-1 uses Amp as the screening marker, and the plasmid vector pCDF Deut-1 uses Str as the screening marker. After plate coating, single colonies were picked for shake flask culture after verification by colony PCR. The plasmids in the bacterial liquid were extracted for PCR verification and sent to Tianlin Biotechnology (Wuxi) Co., Ltd. for sequencing and identification.

[0076] At the shake flask level, the four induced engineering strains and Saccharomyces cerevisiae were co-cultured respectively to catalyze the synthesis of 3'-sialyllactose with sialic acid as the substrate in whole cell, and the catalytic reaction was carried out for 24 h. HPLC was used to quantitatively analyze the supernatant of the fermentation broth. After 24 h of fermentation, the 3'-sialyllactose yield of the engineering strain E. coli JM109(DE3) / pET Deut-1-nst3-neuA was the best, with a concentration of 21.81 g / L and the conversion rate of sialic acid being 47.5%( Figure 4 -b).

[0077] Example 5: Optimization of the induction conditions of the engineering strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA

[0078] The above two screened recombinant plasmids pCDF Deut-1-ce_3-nanA and pET Deut-1-nst3-neuA were co-transformed into the competent cell E. coli JM109(DE3), and plate coating was carried out with both Amp and Str as screening markers to obtain the engineering strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA.

[0079] At the shake flask level, the induction conditions of the engineering strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA were optimized, that is, single factor optimization of the induction OD, induction temperature, and induction time. The induction OD was set to 0.6, 0.8, 1, 1.2, 1.5, the induction temperature was set to 15 °C, 20 °C, 25 °C, 30 °C, 35 °C, and the induction time was set to 10 h, 15 h, 20 h, 25 h, 32 h.

[0080] The engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pETDeut-1-nst3-neuA that has been successfully induced and Saccharomyces cerevisiae were co-cultured to catalyze the synthesis of 3'-sialyllactose using N-acetylglucosamine as a substrate by whole-cell Figure 5 -a), HPLC was used to quantitatively analyze the supernatant of the fermentation broth. When the induced OD was 0.8( Figure 5 -b), the induction temperature was 15 °C( Figure 5 -c), and the induction time was 25 h( Figure 5 -d), the yield of 3'-sialyllactose was the best, with a concentration of 39.10 g / L and the conversion rate of N-acetylglucosamine being 61.71%.

[0081] Example 6: Optimization of the whole-cell catalytic system of the engineered strain E. coli JM109(DE3)pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA

[0082] At the shake-flask level, the whole-cell catalytic system of the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pETDeut-1-nst3-neuA was optimized, that is, single-factor optimization was carried out on the addition amounts of N-acetylglucosamine, pyruvic acid, CMP, lactose, and yeast. The addition amounts of N-acetylglucosamine were set as 100 mM, 200 mM, 300 mM, 400 mM, 500 mM, the addition amounts of pyruvic acid were set as 300 mM, 400 mM, 500 mM, 600 mM, 700 mM, the addition amounts of CMP were set as 10 mM, 30 mM, 50 mM, 70 mM, the addition amounts of lactose were set as 80 mM, 120 mM, 160 mM, 200 mM, 250 mM, and the addition amounts of yeast were set as 50 g / L, 75 g / L, 100 g / L, 125 g / L, 150 g / L.

[0083] The engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pETDeut-1-nst3-neuA that has been successfully induced and Saccharomyces cerevisiae were co-cultured for whole-cell catalytic synthesis of 3'-sialyllactose. HPLC was used to quantitatively analyze the supernatant of the fermentation broth. When the addition amount of N-acetylglucosamine was 400 mM( Figure 6 -a), the addition amount of pyruvic acid was 600 mM( Figure 6 -b), the addition amount of CMP was 30 mM( Figure 6 -c), the addition amount of lactose was 200 mM( Figure 6 -d), and the addition amount of yeast was 100 g / LFigure 6 -e), the yield of 3'-sialyllactose was the best, with a concentration of 71.62 g / L, and the conversion rate of N-acetylglucosamine was 28.26%.

[0084] Example 7: Whole-cell synthesis of 3'-sialyllactose by coupling the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA with yeast in a 5 L fermentor system

[0085] The seed solution of the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pETDeut-1-nst3-neuA was inoculated into a medium with an initial liquid volume of 2.5 L at an inoculation amount of 10%. The stirring speed was set to be coupled with the dissolved oxygen to control the dissolved oxygen at 30%, the temperature was set at 37 °C, and the aeration rate was 2 vvm. When the glucose content in the fermentation system was lower than 0.1 g / L, a glucose solution with a concentration of 300 g / L was supplemented at a feeding flow rate of 6 g / L / h. When the OD of the engineered bacteria reached 30, IPTG with a final concentration of 0.1 mM was added for induction culture at 30 °C, and the induction process continued until 32 h. At this time, the OD of the engineered bacteria was about 49.4, and the wet cell weight was about 100 g / L ( Figure 7 -a).

[0086] 100 g / L of the engineered strain E. coli JM109(DE3) / pCDF Deut-1-ce_3-nanA + pET Deut-1-nst3-neuA and 100 g / L of Saccharomyces cerevisiae were used as substrates with 400 mM N-acetylglucosamine, 600 mM pyruvate, and 200 mM lactose, and fermented in a conversion system containing 30 mM CMP, 300 mM glucose, 1 mM DTT, 20 mL / L glycerol, 5 g / L acetaldehyde, 20 mM MgCl2, 248.3 mM KH2PO4, 150 mM Tris, and 4 g / L octadecylamine polyoxyethylene ether. At 6 h of fermentation, a mixed solution with a concentration of 200 mM N-acetylglucosamine, 300 mM pyruvate, and 100 mM lactose was supplemented at a flow rate of 1.5 mL / min. The stirring speed was set to be coupled with the dissolved oxygen to control the dissolved oxygen at 30%, the temperature was set at 30 °C, and the aeration rate was 2 vvm. After the reaction ended, the fermentation broth was centrifuged at 8000 r / min for 5 min, and the supernatant was collected for detection ( Figure 7 -b). It can be seen that the yield of 3'-sialyllactose first increased and then decreased, reaching the highest yield of 78.03 g / L at 24 h, and the conversion rate was 30.79%. Therefore, 24 h was selected as the optimal fermentation time.

[0087] Obviously, the above embodiments are merely examples for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to enumerate all the implementation manners here. And the obvious changes or modifications derived therefrom are still within the protection scope of the present invention.

Claims

1. A method for high-yield sialyllactose by dual-bacteria coupled fermentation, characterized in that: Yeast and recombinant bacterial engineering strains are inoculated into a fermentation system with N-acetylglucosamine, pyruvate and lactose as substrates to synthesize sialyllactose by coupled fermentation, wherein the recombinant bacteria use Escherichia coli or Bacillus subtilis as host bacteria, and overexpress N-acetylglucosamine 2-acylimase, N-acetylneuraminidase, cytidine-5'-monophosphate-sialic acid synthetase and α-2,3 sialyltransferase in the host bacteria, wherein the sialyllactose includes 3'-sialyllactose.

2. The method according to claim 1, characterized in that The gene sequence encoding the N-acetylglucosamine 2-acylimase is shown in SEQ ID NO.1, the gene sequence encoding the N-acetylneuramidinase is shown in SEQ ID NO.2, the gene sequence encoding the cytidine-5'-monophosphate-sialic acid synthetase is shown in SEQ ID NO.3, and the gene sequence encoding the α-2,3 sialyltransferase is shown in SEQ ID NO.

4.

3. The method according to claim 1, characterized in that The added amount of the N-acetylglucosamine is 100-500 mM.

4. The method according to claim 1, characterized in that: The added amount of pyruvate is 300-700 mM.

5. The method according to claim 1, characterized in that The added amount of lactose is 80-250 mM.

6. The method according to claim 1, characterized in that The added amount of the yeast is 50-150 g / L.

7. The method according to claim 1, characterized in that The fermentation system also includes cytidine-5'-monophosphate, and the added amount of cytidine-5'-monophosphate is 10-70 mM.

8. The method according to claim 1, characterized in that The temperature of the coupled fermentation is 25-35°C.

9. The method according to claim 1, characterized in that: The yeast is selected from one or more of baker's yeast, brewer's yeast and brewer's yeast.

10. The method according to claim 1, characterized in that The recombinant bacteria are subjected to induction culture before being inoculated into the fermentation system. The temperature of the induction culture is 15-35° C. and the time of the induction culture is 10-35 hours.