Nucleic acid releasing agent, microfluidic device and detection method thereof

Abstract

The invention belongs to the technical field of medical treatment, and relates to a nucleic acid releasing agent which comprises the following components: acetonitrile, strong base, lithium dodecyl sulfate, potassium trifluoromethanesulfonate, ammonium sulfate, dimethyl sulfoxide and thiourea. The invention also relates to a microfluidic device and a detection method thereof. According to the technical scheme provided by the invention, the inhibition effect of protein on nucleic acid can be destroyed, and the inhibitor is effectively removed and amplified.

Description

Technical Field

[0001] The present application relates to the field of medical technology, and more specifically, to a nucleic acid releasing agent, a microfluidic device and a detection method thereof. Background Art

[0002] Nucleic acid detection has been widely applied in fields such as biomedicine, and plays a crucial role in many fields, such as clinical medicine, food safety, genetic testing, etc.

[0003] When performing nucleic acid detection, due to the inhibitory effect of some proteins on PCR, nucleic acids cannot be amplified, thus affecting the detection results; in addition, when performing nucleic acid detection, nucleic acids need to be extracted. The existing nucleic acid extraction methods are centrifugal column method or magnetic bead method. The existing nucleic acid extraction methods usually require steps such as lysis, binding, washing, and elution. After integration, steps such as nucleic acid molecular hybridization, polymerase chain reaction (PCR), and biochips are required to complete the detection, making it difficult for the instrument to achieve full automation and resulting in low detection efficiency; in addition, the existing nucleic acid extraction methods usually use manual pipetting, which is complex in operation and can contaminate the sample, affecting the detection results. Summary of the Invention

[0004] The technical problem to be solved by the embodiments of the present application is that it is difficult for existing instruments to achieve full automation of nucleic acid extraction and detection, and the sample solution after nucleic acid extraction is contaminated, resulting in affecting the detection results.

[0005] To solve the above technical problem, the embodiments of the present application provide a nucleic acid releasing agent, and adopt the following technical solutions:

[0006] A nucleic acid releasing agent, comprising the following components: acetonitrile, strong base, lithium dodecyl sulfate, potassium trifluoromethanesulfonate, ammonium sulfate, dimethyl sulfoxide and thiourea.

[0007] Further, the mass - volume percentage of the acetonitrile is 5% - 15%; the molar concentration of the strong base is 200 mM - 300 mM; the mass - volume percentage of the lithium dodecyl sulfate is 0.01% - 0.2%; the molar concentration of the potassium trifluoromethanesulfonate is 10 mM - 20 mM; the molar concentration of the ammonium sulfate is 150 mM - 300 mM; the mass - volume percentage of the dimethyl sulfoxide is 5% - 20%; the molar concentration of the thiourea is 0.8 M - 1.5 M.

[0008] To solve the above technical problem, the embodiments of the present application also provide a microfluidic device, and adopt the following technical solutions:

[0009] A microfluidic device, comprising a chip body and a lysis solution chamber, a dilution solution chamber and at least one reaction chamber arranged on the chip body;

[0010] The chip body is provided with a microchannel, and the lysis solution chamber, the dilution solution chamber and the reaction chamber are sequentially connected through the microchannel;

[0011] The lysis solution chamber includes a first pressing member, the first pressing member is installed on the liquid injection port of the lysis solution chamber, and the nucleic acid releasing agent as described above is provided inside the lysis solution chamber;

[0012] The dilution solution chamber includes a second pressing member, and the second pressing member is installed on the liquid injection port of the dilution solution chamber;

[0013] The microfluidic device further includes a valve assembly, and the valve assembly is used to control the conduction between the lysis solution chamber and the dilution solution chamber and / or control the conduction between the dilution solution chamber and the reaction chamber.

[0014] Furthermore, the valve assembly includes a first valve body and a second valve body;

[0015] The first valve body is disposed on the microchannel between the lysis solution chamber and the dilution solution chamber;

[0016] The second valve body is disposed on the microchannel between the dilution solution chamber and the reaction chamber.

[0017] Furthermore, the first valve body and the second valve body are paraffin valves.

[0018] Furthermore, the valve assembly further includes an adsorption chamber, the adsorption chamber is located at the liquid outlet of the paraffin valve, and adsorbing members are arranged in a staggered manner in the adsorption chamber.

[0019] Furthermore, the first pressing member and the second pressing member are each independently selected from at least one of a soft plastic cap, a silicone cap or a push rod;

[0020] The first pressing member is assembled on the liquid injection port of the lysis solution chamber by means of thread fit or interference fit;

[0021] The second pressing member is assembled on the liquid injection port of the dilution solution chamber by means of thread fit or interference fit.

[0022] Furthermore, at least one exhaust channel is further provided on the chip body;

[0023] The reaction chamber communicates with the outside through the exhaust channel.

[0024] Furthermore, the microfluidic device further includes a waterproof and breathable membrane, and the waterproof and breathable membrane is disposed on the chip body and covers the air outlet of the exhaust channel.

[0025] Further, the microfluidic device further includes a sealing film, which is installed on the chip body and used to seal the lysis solution chamber, the dilution solution chamber, the reaction chamber, and the microchannel.

[0026] Further, the width of the microchannel is 10 μm to 10 mm; and / or

[0027] the depth of the microchannel is 10 μm to 10 mm; and / or

[0028] the volume of the lysis solution chamber is 1 μL to 5000 μL; and / or

[0029] the volume of the dilution solution chamber is 1 μL to 5000 μL; and / or

[0030] the volume of the reaction chamber is 1 μL to 1000 μL.

[0031] To solve the above technical problems, the embodiment of the present application also provides a detection method for a microfluidic device, adopting the following technical solutions:

[0032] A nucleic acid detection of a microfluidic device includes the following steps:

[0033] Provide a nucleic acid releasing agent and pre-install the nucleic acid releasing agent into the lysis solution chamber, wherein the nucleic acid releasing agent is the nucleic acid releasing agent as described above;

[0034] Provide a sample to be tested and add the sample to be tested into the lysis solution chamber. The nucleic acid in the sample to be tested is released under the action of the nucleic acid releasing agent in the lysis solution chamber to form a lysis solution;

[0035] Control the valve assembly to open and drive the first pressing member. The lysis solution flows into the dilution solution chamber through the microchannel and forms a pre-reaction solution after mixing with the dilution solution pre-installed in the dilution solution chamber;

[0036] Drive the second pressing member. The pre-reaction solution flows into the reaction chamber through the microchannel and dissolves the freeze-dried balls in the reaction chamber to form a reaction solution;

[0037] Adjust the temperature in the reaction chamber, and a biological reaction occurs in the reaction solution in the reaction chamber;

[0038] After the biological reaction ends, read the fluorescence in the reaction chamber through a detection instrument and output the detection result.

[0039] Compared with the prior art, the embodiment of the present application mainly has the following beneficial effects:

[0040] The present application provides a nucleic acid releasing agent. By adding a low concentration of acetonitrile to the nucleic acid releasing agent, the inhibition of PCR by proteins in the sample to be tested is reduced, inhibitors are effectively removed, and amplification is carried out. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] In order to more clearly illustrate the solutions of the present application, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are some embodiments of the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0042] Figure 1 It is a schematic structural diagram of the microfluidic device according to the embodiment of the present application;

[0043] Figure 2 It is a front view of the microfluidic device according to the embodiment of the present application;

[0044] Figure 3 It is a rear view of the microfluidic device according to the embodiment of the present application;

[0045] Figure 4 It is a result detection diagram of Embodiment 1 of the present application;

[0046] Figure 5 It is a result detection diagram of Embodiment 2 of the present application;

[0047] Figure 6 It is a result detection diagram of Embodiment 3 of the present application;

[0048] Figure 7 It is a result detection diagram of Comparative Example 1 of the present application.

[0049] REFERENCE SIGNS:

[0050] 1. Chip body; 11. First microchannel; 12. Second microchannel; 13. Branch channel; 14. Exhaust channel; 2. Lysis solution chamber; 21. First pressing member; 3. Diluent chamber; 31. Second pressing member; 4. Reaction chamber; 51. First valve body; 52. Second valve body; 53. Adsorption chamber; 6. Waterproof and breathable membrane; 7. Sealing membrane. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the technical field to which this application belongs; the terms used in the specification of this application are only for the purpose of describing specific embodiments and are not intended to limit this application; the terms "comprising" and "having" and any variations thereof in the specification and claims of this application and the above drawings are intended to cover non-exclusive inclusion. The terms "first", "second", etc. in the specification and claims of this application or the above drawings are used to distinguish different objects and not to describe a specific order.

[0052] Reference to "embodiments" herein means that a particular feature, structure, or characteristic described in connection with the embodiments can be included in at least one embodiment of this application. The phrase appears in various places in the specification and does not necessarily refer to the same embodiment, nor is it an independent or alternative embodiment mutually exclusive with other embodiments. Those skilled in the art will explicitly and implicitly understand that the embodiments described herein can be combined with other embodiments.

[0053] An embodiment of this application provides a nucleic acid releasing agent capable of rapidly extracting nucleic acid from a sample to be tested, comprising the following components: acetonitrile, strong base, lithium dodecyl sulfate, potassium trifluoromethanesulfonate, ammonium sulfate, dimethyl sulfoxide, and thiourea.

[0054] In some embodiments, the mass-volume percentage of the acetonitrile is 5% - 15%, the molar concentration of the strong base is 200 mM - 300 mM; the mass-volume percentage of the lithium dodecyl sulfate is 0.01% - 0.2%; the molar concentration of the potassium trifluoromethanesulfonate is 10 mM - 20 mM; the molar concentration of the ammonium sulfate is 150 mM - 300 mM; the mass-volume percentage of the dimethyl sulfoxide is 5% - 20%; the molar concentration of the thiourea is 0.8 M - 1.5 M.

[0055] In this embodiment, the mass-volume percentage of the acetonitrile is preferably 5% - 10%, the strong base is KOH, and the molar concentration of the KOH is preferably 200 mM - 250 mM; the mass-volume percentage of the lithium dodecyl sulfate is preferably 0.05% - 0.1%; the molar concentration of the potassium trifluoromethanesulfonate is preferably 10 mM - 15 mM; the molar concentration of the ammonium sulfate is preferably 200 mM - 250 mM; the mass-volume percentage of the dimethyl sulfoxide is preferably 10% - 15%; the molar concentration of the thiourea is preferably 0.8 M - 1.2 M.

[0056] In the embodiment of this application, by adding a low concentration of acetonitrile to the nucleic acid releasing agent, the inhibition of PCR by proteins in the sample to be tested is reduced, inhibitors are effectively removed, and amplification is carried out.

[0057] Please refer toFigures 1 to 3 As shown in Figures 1 to 3 , an embodiment of the present application provides a microfluidic device, which includes: a chip body 1, and a lysis solution chamber 2, a dilution solution chamber 3, and at least one reaction chamber 4 provided on the chip body 1.

[0058] In this embodiment, the lysis solution chamber 2, the dilution solution chamber 3, and the reaction chamber 4 are all integrally injection-molded on the chip body 1. The number of the reaction chambers 4 can be multiple. For example, Figure 1 in Figure 1 , the number of the reaction chambers 4 is nine, which are used to detect the new coronavirus primer-probe and the internal standard primer-probe respectively. In other embodiments, the lysis solution chamber 2, the dilution solution chamber 3, and the reaction chamber 4 can also be assembled on the chip body 1.

[0059] The chip body 1 is provided with microchannels, and the lysis solution chamber 2, the dilution solution chamber 3, and the reaction chamber 4 are sequentially connected through the channels.

[0060] The lysis solution chamber 2 includes a first pressing member 21, and the first pressing member 21 is installed on the liquid injection port of the lysis solution chamber 2. In this embodiment, 500 μL of nucleic acid releasing agent is pre-loaded inside the lysis solution chamber 2.

[0061] The dilution solution chamber 3 includes a second pressing member 31, and the second pressing member 31 is installed on the liquid injection port of the dilution solution chamber 3. In this embodiment, 1500 μL of dilution solution is pre-loaded inside the dilution solution chamber 3.

[0062] In some embodiments, a freeze-dried reagent is provided inside the reaction chamber 4. In this embodiment, the nucleic acid dilution solution for storing virus nucleic acid is diluted 10 times by the dilution solution to form a pre-reaction solution, which enters the reaction chamber 4 to dissolve the freeze-dried reagent for subsequent fluorescence PCR amplification.

[0063] The microfluidic device further includes a valve assembly, and the valve assembly is used to control the conduction between the lysis solution chamber 2 and the dilution solution chamber 3 and / or control the conduction between the dilution solution chamber 3 and the reaction chamber 4.

[0064] The microfluidic device provided by the embodiment of the present application includes multiple reaction chambers 4, which can simultaneously detect multiple new coronavirus primer-probes and internal standard primer-probes in a sample, and has a high detection throughput. At the same time, after the microfluidic device completes sample loading, through the cooperation of the first pressing member 21, the second pressing member 31, and the valve assembly, pipetting into the reaction chamber 4 is realized in a fully enclosed environment, avoiding aerosol contamination. The entire detection process (including nucleic acid extraction and fluorescence PCR amplification) of the microfluidic device of the present application is completed on a single chip body 1, with high automation and saving manual operation time.

[0065] Please refer to Figure 2 、 Figure 3As shown, in some embodiments, the microchannel includes a first microchannel 11 and a second microchannel 12.

[0066] In some embodiments, the width of the microchannel is 10 μm to 10 mm. Specifically, the width of the microchannel can be set to any value among 10 μm, 50 μm, 100 μm, 500 μm, 1 mm, 5 mm, 10 mm or a range formed between any two of these values.

[0067] In some embodiments, the depth of the microchannel is 10 μm to 10 mm. Specifically, the depth of the microchannel can be set to any value among 10 μm, 50 μm, 100 μm, 500 μm, 1 mm, 5 mm, 10 mm or a range formed between any two of these values.

[0068] Based on the above width and depth of the microchannel, the cross-section of the microchannel can be circular, square or polygonal.

[0069] Please refer to Figure 3 As shown, in some embodiments, the lysis solution chamber 2 includes a first liquid injection port at the top and a first liquid outlet at the bottom. The nucleic acid diluent is injected into the lysis solution chamber 2 through the first liquid injection port, and the lysis solution chamber 2 is sealed by the threaded or interference fit between the first pressing member 21 and the first liquid injection port.

[0070] In some embodiments, the volume of the lysis solution chamber 2 is 1 μL to 5000 μL. Specifically, the volume of the lysis solution chamber 2 can be any value among 1 μL, 5 μL, 10 μL, 50 μL, 100 μL, 500 μL, 1000 μL, 2500 μL, 5000 μL or a range formed between any two of these values.

[0071] Please refer to Figure 2 、 Figure 3 As shown, in some embodiments, the diluent chamber 3 includes a second liquid injection port at the top, a second liquid outlet at the bottom, and a liquid inlet between the second liquid injection port and the second liquid outlet. The diluent is injected into the diluent chamber 3 through the second liquid injection port, and the diluent chamber 3 is sealed by the threaded or interference fit between the second pressing member 31 and the second liquid injection port. Since the liquid inlet of the present application is located between the second liquid injection port and the second liquid outlet, and the height of the liquid inlet is higher than the height of the second liquid outlet and higher than the liquid level of the diluent, when the second pressing member 31 is pressed, the diluent will not flow back from the liquid inlet to the lysis solution chamber 2.

[0072] In some embodiments, the volume of the diluent chamber 3 is 1 μL to 5000 μL. Specifically, the volume of the diluent chamber 3 can be any value among 1 μL, 5 μL, 10 μL, 50 μL, 100 μL, 500 μL, 1000 μL, 2500 μL, 5000 μL or a range formed between any two values.

[0073] Please refer to again Figure 2 、 Figure 3 As shown, one end of the first microchannel 11 is connected to the first liquid outlet, and the other end is connected to the liquid inlet to realize the connection between the lysis solution chamber 2 and the diluent chamber 3.

[0074] One end of the second microchannel 12 is connected to the liquid inlet, and the other end is connected to the reaction chamber 4. In this embodiment, the number of the reaction chambers 4 is nine. A plurality of branch channels 13 are formed at the end of the second microchannel 12 far from the diluent chamber 3, and one branch channel 13 communicates with one reaction chamber 4 to realize the connection between the diluent chamber 3 and a plurality of reaction chambers 4 respectively.

[0075] Please refer to Figure 2 As shown, in some embodiments, the number of the reaction chambers 4 is nine. The shape of each reaction chamber 4 can be circular, square or irregular, and the volume of each reaction chamber 4 is 1 μL to 1000 μL. Specifically, the volume of the reaction chamber 4 can be set to any value among 1 μL, 5 μL, 10 μL, 50 μL, 100 μL, 500 μL, 1000 μL or a range formed between any two values.

[0076] In some embodiments, a plurality of reaction chambers 4 can be distributed in a straight line, staggered or in a circular distribution. In this embodiment, a plurality of reaction chambers 4 are staggered on the chip body 1. By means of the staggered distribution, the space occupied by the chip body 1 is reduced, and the space utilization rate of the chip body 1 is improved.

[0077] In this embodiment, the nine reaction chambers 4 are respectively used to detect the forward primer N-F of the novel coronavirus N gene: GGCCGCAAATTGCACAAT (SEQ ID NO: 1); the reverse primer N-R of the novel coronavirus N gene: CCAATGCGCGACATTCC (SEQ ID NO: 2); the probe N-P of the novel coronavirus N gene: FAM-CCCCCAGCGCTTCAGCGTTCT-BHQ1 (SEQ ID NO: 3); the forward primer Orf1ab-F of the novel coronavirus Orf1ab gene: CCGTCTGCGGTATGTGGAA (SEQ ID NO: 4); the reverse primer Orf1ab-R of the novel coronavirus Orf1ab gene: AACGATTGTGCATCAGCTGACT (SEQ ID NO: 5); the probe Orf1ab-P of the novel coronavirus Orf1ab gene: VIC-TGATCAACTCCGCGAACCCATGCT-BHQ1 (SEQ ID NO: 6); the internal standard forward primer IC-F: CGTGGACATCCGCAAAGAC (SEQ ID NO: 7); the internal standard reverse primer IC-R: GCATCCTGTCGGCAATGC (SEQ ID NO: 8); the internal standard probe: IC-P: Cy5-CCAACACAGTGCTGTCTGGCGGC-BHQ2 (SEQ ID NO: 9).

[0078] In some embodiments, the microfluidic device further includes a detection instrument (not shown in the figure), and the detection instrument includes a temperature control module (not shown in the figure), and the temperature control module heats the reaction chamber to cause a biological reaction of the reaction solution in the reaction chamber 4

[0079] In this embodiment, the detection instrument further includes a fluorescence detection module, and the step of causing a biological reaction of the reaction solution in the reaction chamber 4 specifically includes:

[0080] Set the following cycle parameters in the temperature control module:

[0081] The first step: 50 °C, 5 minutes; the second step: 90 °C, 2 minutes; the third step: 90 °C, 5 seconds; 65 °C, 35 seconds, 10 cycles; the fourth step, 95 °C, 5 seconds, 60 °C, 35 seconds, 35 cycles;

[0082] After the temperature control module executes the above cycle parameters, collect fluorescence information through the fluorescence detection module and record it as a curve graph, as Figure 4 shown.

[0083] Please refer to Figure 2As shown, in some embodiments, the valve assembly includes a first valve body 51 and a second valve body 52. In this embodiment, the first valve body 51 is disposed on the microchannel between the lysis solution chamber 2 and the dilution solution chamber 3, specifically on the first microchannel 11; the second valve body 52 is disposed on the microchannel between the dilution solution chamber 3 and the reaction chamber 4, specifically on the second microchannel 12.

[0084] In this embodiment, both the first valve body 51 and the second valve body 52 are paraffin valves, and the shape of the paraffin valve can be a circular cavity, a square cavity, or an irregular cavity;

[0085] The melting point of the paraffin valve is 54°C to 56°C. In some embodiments, the detection instrument adjusts the temperature of the paraffin valve through the temperature control module to melt the paraffin, so that the nucleic acid releasing agent can flow through the first microchannel 11 to the dilution solution chamber 3 or the pre-reaction solution can flow through the second microchannel 12 and the branch microchannel 13 to each reaction chamber 4.

[0086] In some embodiments, the first pressing member 21 and the second pressing member 31 are each independently selected from at least one of a soft plastic cap, a silicone cap, or a push rod.

[0087] Please refer to Figure 2 As shown, in some embodiments, at least one exhaust channel 14 is further provided on the chip body 1. In this embodiment, the number of the exhaust channels 14 is nine, and each exhaust channel 14 is connected to a reaction chamber 4. The reaction chamber 4 communicates with the outside through the exhaust channel 14. When the first pressing member 21 and / or the second pressing member 31 presses, the air pressure balance in the sealed cavity is maintained through the intake or exhaust of the exhaust channel 14.

[0088] Please refer to Figure 1 As shown, in some embodiments, the microfluidic device further includes a waterproof and breathable membrane 6. The waterproof and breathable membrane 6 is disposed on the chip body 1 and covers the exhaust hole. The waterproof and breathable membrane 6 is used to prevent the reconstituted lyophilized solution in the reaction chamber 4 from overflowing and prevent external aerosol from entering the reaction chamber 4, which can avoid the lyophilized balls in the reaction chamber 4 from getting damp and improve the accuracy of the detection result.

[0089] Please continue to refer to Figure 1 As shown, in some embodiments, the microfluidic device further includes a sealing film 7. The sealing film 7 is installed on the chip body 1 and is used to seal the lysis solution chamber 2, the dilution solution chamber 3, the reaction chamber 4, and the microchannel.

[0090] In some embodiments, the sealing film 7 can be selected as a high-grade synthetic glue, which has the characteristics of being resistant to strong acids and alkalis, has a strong sealing effect on the lysate chamber 2, the diluent chamber 3, the reaction chamber 4 and the microchannel, has no back glue and residue during the fitting process, has good biocompatibility, and will not react with reagents or samples.

[0091] In other embodiments, the sealing film 7 can also be a plastic thin plate, and the plastic thin plate is sealed and fixed on the chip body 1 by means such as ultrasonic welding, laser welding or hot press welding.

[0092] Based on the above microfluidic device, an embodiment of the present application also provides a detection method for a microfluidic pore device, including the following steps:

[0093] Provide a nucleic acid releasing agent, and preload the nucleic acid releasing agent into the lysate chamber, wherein, the nucleic acid releasing agent is the nucleic acid releasing agent as described above;

[0094] Provide a sample to be tested, and add the sample to be tested into the lysate chamber. The nucleic acid in the sample to be tested is released under the action of the nucleic acid releasing agent in the lysate chamber to form a lysate solution;

[0095] Control the valve assembly to open, drive the first pressing member, and the lysate solution flows into the diluent chamber through the microchannel, and a pre-reaction solution is formed after being mixed with the diluent pre-loaded in the diluent chamber;

[0096] Drive the second pressing member, and the pre-reaction solution flows into the reaction chamber through the microchannel to dissolve the freeze-dried balls in the reaction chamber to form a reaction solution;

[0097] Adjust the temperature in the reaction chamber, and a biological reaction occurs in the reaction solution in the reaction chamber;

[0098] After the biological reaction ends, read the fluorescence in the reaction chamber through a detection instrument and output a detection result.

[0099] The detection method provided by the embodiment of the present application can, after the sample addition is completed in the microfluidic device, through the cooperation of the first pressing member, the second pressing member and the valve assembly, realize pipetting into the reaction chamber in a fully enclosed environment, avoiding aerosol contamination; and complete a complete detection process on one chip body, with a high degree of automation and saving manual operation time.

[0100] In some embodiments, the nucleic acid releasing agent contains acetonitrile, wherein the mass-volume percentage of acetonitrile in the nucleic acid releasing agent is 5% - 15%. Specifically, the mass-volume percentage of acetonitrile in the nucleic acid releasing agent can be set to any value among 5%, 10%, 15% or the range formed between any two values.

[0101] In the embodiments of the present application, by adding a low concentration of acetonitrile to the nucleic acid releasing agent, the inhibition of PCR by proteins in the sample to be tested is reduced, inhibitors are effectively removed, and amplification is carried out.

[0102] In some embodiments, the sample to be tested is a sampling swab or a patient sample.

[0103] In some embodiments, the step of opening the control valve assembly, driving the first pressing member, and allowing the lysis solution to flow into the diluent chamber through the microchannel and mix with the diluent pre-loaded in the diluent chamber to form a pre-reaction solution specifically includes:

[0104] The detection instrument controls the temperature control module to start, and adjusts the temperature of the first valve body to 54°C to 56°C to melt the paraffin.

[0105] Press the first pressing member, the first pressing member deforms and sinks, and the air volume in the lysis solution chamber is compressed.

[0106] Under the action of pressure and gravity, the lysis solution flows into the diluent chamber through the first liquid outlet below the lysis solution chamber, and after being uniformly mixed with the diluent in the diluent chamber, a pre-reaction solution is formed.

[0107] In this embodiment, the concentration of the lysis solution diluted by the diluent is one-tenth of the concentration of the original lysis solution.

[0108] In some embodiments, the step of driving the second pressing member, allowing the pre-reaction solution to flow into the reaction chamber through the microchannel, and dissolving the lyophilized balls in the reaction chamber to form a reaction solution specifically includes:

[0109] The detection instrument controls the temperature control module to start, and adjusts the temperature of the second valve body to 54°C to 56°C to melt the paraffin.

[0110] Press the second pressing member, the second pressing member deforms and sinks, and the air volume in the diluent chamber is compressed.

[0111] Under the action of pressure and gravity, the pre-reaction solution flows through the second liquid outlet below the diluent chamber to the second microchannel, and then after being branched through several branch channels, it flows into each reaction chamber respectively to dissolve the lyophilized balls in the reaction chamber to form a reaction solution.

[0112] In this embodiment, the reaction solution formed after the freeze-dried balls are dissolved specifically includes the following components: Tris-SO4 with a molar concentration of 80 mM and a pH of 8.8, MgCl2 with a molar concentration of 3.2 mM, betaine with a mass-volume percentage of 10%, sorbitol with a mass-volume percentage of 0.5%, potassium glutamate with a molar concentration of 15 mM, dNTPs with a molar concentration of 550 mM, BSA with a concentration of 20 μg / mL, Taq with a concentration of 8 U / 80 μL, MMLV with a concentration of 40 U / 80 μL, RNase inhibitor with a concentration of 40 U / 80 μL, primers with a molar concentration of 200 nM, and a probe with a concentration of 120 nM.

[0113] Among them, the primers include novel coronavirus primers and / or internal standard primers, and the probes include novel coronavirus probes and / or internal standard probes. Specifically, the novel coronavirus primers include the forward primer N-F of the novel coronavirus N gene: GGCCGCAAATTGCACAAT (SEQ ID NO: 1); the reverse primer N-R of the novel coronavirus N gene: CCAATGCGCGACATTCC (SEQ ID NO: 2); the forward primer Orf1ab-F of the novel coronavirus Orf1ab gene: CCGTCTGCGGTATGTGGAA (SEQ ID NO: 4); the reverse primer Orf1ab-R of the novel coronavirus Orf1ab gene: AACGATTGTGCATCAGCTGACT (SEQ ID NO: 5);

[0114] The novel coronavirus probes include the probe N-P of the novel coronavirus N gene: FAM-CCCCCAGCGCTTCAGCGTTCT-BHQ1 (SEQ ID NO: 3); the probe Orf1ab-P of the novel coronavirus Orf1ab gene: VIC-TGATCAACTCCGCGAACCCATGCT-BHQ1 (SEQ ID NO: 6);

[0115] The internal standard primers include the internal standard forward primer IC-F: CGTGGACATCCGCAAAGAC (SEQ ID NO: 7); the internal standard reverse primer IC-R: GCATCCTGTCGGCAATGC (SEQ ID NO: 8);

[0116] The internal standard probe includes: IC-P: Cy5-CCAACACAGTGCTGTCTGGCGGC-BHQ2 (SEQ ID NO: 9).

[0117] In some embodiments, the step of adjusting the temperature in the reaction chamber and allowing the reaction solution to undergo a biological reaction in the reaction chamber specifically includes:

[0118] Set the following cycle parameters in the temperature control module:

[0119] Step 1: 50°C for 5 minutes; Step 2: 90°C for 2 minutes; Step 3: 90°C for 5 seconds, 65°C for 35 seconds, 10 cycles; Step 4: 95°C for 5 seconds, 60°C for 35 seconds, 35 cycles.

[0120] In some embodiments, after the biological reaction ends, that is, when the temperature control module executes the above cycle parameters, the fluorescence detection module collects fluorescence information and records it as a curve graph, as Figure 1 shown.

[0121] The following uses specific embodiments to specifically illustrate the present application. The following embodiments are only partial embodiments of the present application and do not limit the present application.

[0122] Example 1

[0123] Step (1), Dilute the new coronavirus quality control product (purchased from Guangzhou Bangde Sheng Biotechnology Co., Ltd.) with a nucleic acid release agent to 500 cp / mL and add it to the lysis solution chamber;

[0124] The nucleic acid release agent includes the following components: KOH with a molar concentration of 300 mM, lithium dodecyl sulfate with a mass-volume percentage of 0.05%, potassium trifluoromethanesulfonate with a molar concentration of 15 mM, ammonium sulfate with a molar concentration of 160 mM, DMSO with a mass-volume percentage of 10%, thiourea with a molar concentration of 0.8 M, and acetonitrile with a mass-volume percentage of 10%.

[0125] Step (2), Use the swab that has collected a negative sample as the test sample and add it to the lysis solution chamber to form a 6 μL lysis solution;

[0126] Step (3), Open the first valve body, press the first pressing member, transfer 500 μL of the lysis solution to the dilution solution chamber, and mix it with 1000 μL of glycerol with a mass-volume percentage of 3% in the dilution solution chamber to form 1500 μL of a pre-reaction solution;

[0127] Step (4), Open the second valve body, press the second pressing member, transfer a part of the pre-reaction solution to the reaction chamber to dissolve the lyophilized beads in the reaction chamber to form a reaction solution;

[0128] Among them, the reaction solution specifically includes the following components: Tris-SO4 with a molar concentration of 80 mM and a pH of 8.8, MgCl2 with a molar concentration of 3.2 mM, betaine with a mass-volume percentage of 10%, sorbitol with a mass-volume percentage of 0.5%, potassium glutamate with a molar concentration of 15 mM, dNTPs with a molar concentration of 550 mM, BSA with a concentration of 20 μg / mL, Taq with a concentration of 8 U / 80 μL, MMLV with a concentration of 40 U / 80 μL, RNase inhibitor with a concentration of 40 U / 80 μL, primers with a molar concentration of 200 nM, and probes with a concentration of 120 nM.

[0129] Step ⑸, the detection instrument controls the temperature control module to adjust the temperature in the reaction chamber. The reaction solution undergoes a biological reaction in the reaction chamber. The detection instrument controls the fluorescence detection module to read the fluorescence in the reaction chamber and outputs the detection result, as recorded Figure 4 shown;

[0130] Among them, controlling the temperature control module to adjust the temperature in the reaction chamber, and the reaction solution undergoes a biological reaction in the reaction chamber, specifically includes: setting the following cycle parameters in the temperature control component:

[0131] The first step: 50 °C for 5 minutes; the second step: 90 °C for 2 minutes; the third step: 90 °C for 5 seconds; 65 °C for 35 seconds, 10 cycles; the fourth step, 95 °C for 5 seconds, 60 °C for 35 seconds, 35 cycles.

[0132] Example 2

[0133] The difference between this example and Example 1 is that the nucleic acid releasing agent in step ⑴ includes the following components: KOH with a molar concentration of 220 mM, lithium dodecyl sulfate with a mass-volume percentage of 0.01%, potassium trifluoromethanesulfonate with a molar concentration of 12 mM, ammonium sulfate with a molar concentration of 250 mM, DMSO with a mass-volume percentage of 15%, thiourea with a molar concentration of 1.1 M, and acetonitrile with a mass-volume percentage of 6%.

[0134] The reaction solution in step ⑷ specifically includes the following components: Tris-SO4 with a molar concentration of 60 mM and a pH of 8.5, MgCl2 with a molar concentration of 4.5 mM, betaine with a mass-volume percentage of 5%, sorbitol with a mass-volume percentage of 0.2%, potassium glutamate with a molar concentration of 35 mM, dNTPs with a molar concentration of 600 mM, BSA with a concentration of 40 μg / mL, Taq with a concentration of 6 U / 80 μL, MMLV with a concentration of 30 U / 80 μL, RNase inhibitor with a concentration of 30 U / 80 μL, primers with a molar concentration of 1000 nM, and probes with a concentration of 400 nM.

[0135] The detection result output in step ⑸ is recorded as Figure 5 shown below.

[0136] Example 3

[0137] The difference between this example and Example 1 is that the nucleic acid releasing agent in step ⑴ includes the following components: KOH with a molar concentration of 250 mM, lithium dodecyl sulfate with a mass-volume percentage of 0.2%, potassium trifluoromethanesulfonate with a molar concentration of 18 mM, ammonium sulfate with a molar concentration of 280 mM, DMSO with a mass-volume percentage of 14%, thiourea with a molar concentration of 1.2 M, and acetonitrile with a mass-volume percentage of 10%.

[0138] The reaction solution in step ⑷ specifically includes the following components: Tris-SO4 with a molar concentration of 60 mM and a pH of 8.5, MgCl2 with a molar concentration of 5.5 mM, betaine with a mass-volume percentage of 10%, sorbitol with a mass-volume percentage of 1%, potassium glutamate with a molar concentration of 20 mM, dNTPs with a molar concentration of 500 mM, BSA with a concentration of 25 μg / mL, Taq with a concentration of 6.4 U / 80 μL, MMLV with a concentration of 32 U / 80 μL, RNase inhibitor with a concentration of 32 U / 80 μL, primer with a molar concentration of 1200 nM, and probe with a concentration of 600 nM.

[0139] The detection result output in step ⑸ is recorded as Figure 6 shown below.

[0140] Comparative Example 1

[0141] The difference between this comparative example and Example 1 is that the nucleic acid releasing agent in step ⑴ includes the following components: KOH with a molar concentration of 300 mM, lithium dodecyl sulfate with a mass-volume percentage of 0.05%, potassium trifluoromethanesulfonate with a molar concentration of 15 mM, ammonium sulfate with a molar concentration of 160 mM, DMSO with a mass-volume percentage of 10%, and thiourea with a molar concentration of 0.8 M.

[0142] The reaction solution in step ⑷ specifically includes the following components: Tris-SO4 with a molar concentration of 80 mM and a pH of 8.8, MgCl2 with a molar concentration of 3.2 mM, betaine with a mass-volume percentage of 10%, sorbitol with a mass-volume percentage of 0.5%, potassium glutamate with a molar concentration of 15 mM, dNTPs with a molar concentration of 550 mM, BSA with a concentration of 20 μg / mL, Taq with a concentration of 8 U / 80 μL, MMLV with a concentration of 40 U / 80 μL, RNase inhibitor with a concentration of 40 U / 80 μL, primer with a molar concentration of 200 nM, and probe with a concentration of 120 nM.

[0143] The detection results output in step (5) are recorded as Figure 7 shown below.

[0144] Analysis of detection results:

[0145] According to Figures 4 to 7 shown below, it can be known that the novel coronavirus N gene, the novel coronavirus ORF1ab gene and the internal standard in Examples 1 to 3 all show amplification curves, while the novel coronavirus N gene, the novel coronavirus ORF1ab gene and the internal standard in Comparative Document 1 have no amplification results. Therefore, it can be considered that the nucleic acid releasing agent including acetonitrile provided by the present application can reduce the inhibition of proteins in the sample to be tested on PCR and enable primers and probes to perform PCR amplification.

[0146] Obviously, the embodiments described above are only a part of the embodiments of the present application, rather than all the embodiments. The preferred embodiments of the present application are given in the drawings, but do not limit the patent scope of the present application. The present application can be implemented in many different forms. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosure of the present application more thorough and comprehensive. Although the present application has been described in detail with reference to the foregoing embodiments, for those skilled in the art, they can still modify the technical solutions recorded in the foregoing specific embodiments, or perform equivalent replacements on some of the technical features. Any equivalent structure using the content of the specification and drawings of the present application, directly or indirectly applied in other related technical fields, is equally within the scope of the patent protection of the present application.

Claims

1. A nucleic acid releasing agent, characterized in that, It includes the following components: acetonitrile, strong base, lithium dodecyl sulfate, potassium trifluoromethanesulfonate, ammonium sulfate, dimethyl sulfoxide and thiourea.

2. The nucleic acid releasing agent according to claim 1, wherein The mass-volume percentage of the acetonitrile is 5% - 15%; the molar concentration of the strong base is 200 mM - 300 mM; the mass-volume percentage of the lithium dodecyl sulfate is 0.01% - 0.2%; the molar concentration of the potassium trifluoromethanesulfonate is 10 mM - 20 mM; the molar concentration of the ammonium sulfate is 150 mM - 300 mM; the mass-volume percentage of the dimethyl sulfoxide is 5% - 20%; the molar concentration of the thiourea is 0.8 M - 1.5 M.

3. A microfluidic device, characterized in that, It includes a chip body and a lysis solution chamber, a dilution solution chamber and at least one reaction chamber provided on the chip body; A microchannel is provided on the chip body, and the lysis solution chamber, the dilution solution chamber and the reaction chamber are sequentially connected through the microchannel; The lysis solution chamber includes a first pressing member, the first pressing member is installed on the liquid injection port of the lysis solution chamber, and a nucleic acid releasing agent as described in claim 1 or 2 is provided inside the lysis solution chamber; The dilution solution chamber includes a second pressing member, and the second pressing member is installed on the liquid injection port of the dilution solution chamber; The microfluidic device further includes a valve assembly, and the valve assembly is used to control the conduction between the lysis solution chamber and the dilution solution chamber and / or control the conduction between the dilution solution chamber and the reaction chamber.

4. The microfluidic device according to claim 3, characterized in that, The valve assembly includes a first valve body and a second valve body; The first valve body is provided on the microchannel between the lysis solution chamber and the dilution solution chamber; The second valve body is provided on the microchannel between the dilution solution chamber and the reaction chamber.

5. The microfluidic device according to claim 4, characterized in that, The first valve body and the second valve body are paraffin valves.

6. The microfluidic device according to claim 5, wherein The valve assembly further includes an adsorption chamber, the adsorption chamber is located at the liquid outlet of the paraffin valve, and adsorbing members are arranged in a staggered manner in the adsorption chamber.

7. The microfluidic device according to claim 3, wherein, The first pressing member and the second pressing member are each independently selected from at least one of a soft plastic cap, a silica gel cap or a push rod; The first pressing member is assembled on the liquid injection port of the lysis solution chamber by thread fit or interference fit; The second pressing member is assembled on the liquid injection port of the dilution solution chamber by thread fit or interference fit.

8. The microfluidic device according to claim 3, wherein, At least one exhaust channel is further provided on the chip body; The reaction chamber communicates with the outside through the exhaust channel.

9. The microfluidic device according to claim 8, wherein, The microfluidic device further includes a waterproof breathable membrane, the waterproof breathable membrane is provided on the chip body and covers the air outlet of the exhaust channel.

10. The microfluidic device according to any one of claims 3 to 9, characterized in that, The microfluidic device further includes a sealing membrane, and the sealing membrane is installed on the chip body for sealing the lysis solution chamber, the dilution solution chamber, the reaction chamber and the microchannel.

11. The microfluidic device according to any one of claims 3 to 9, characterized in that, The width of the microchannel is 10 μm - 10 mm; and / or The depth of the microchannel is 10 μm - 10 mm; and / or The volume of the lysis solution chamber is 1 μL - 5000 μL; and / or The volume of the dilution solution chamber is 1 μL - 5000 μL; and / or The volume of the reaction chamber is 1 μL - 1000 μL.

12. A nucleic acid detection method for a microfluidic device, characterized in that, It includes the following steps: A nucleic acid releasing agent is provided and pre-loaded into the lysis solution chamber, wherein the nucleic acid releasing agent is the nucleic acid releasing agent described in claim 1 or 2; A test sample is provided and added into the lysis solution chamber, and nucleic acids in the test sample are released under the action of the nucleic acid releasing agent in the lysis solution chamber to form a lysis solution; The valve assembly is controlled to open, and the first pressing member is driven, and the lysis solution flows into the diluent chamber through the microchannel and forms a pre-reaction solution after being mixed with the diluent pre-loaded in the diluent chamber; The second pressing member is driven, and the pre-reaction solution flows into the reaction chamber through the microchannel to dissolve the freeze-dried balls in the reaction chamber and form a reaction solution; The temperature in the reaction chamber is adjusted, and a biological reaction occurs in the reaction solution in the reaction chamber; After the biological reaction ends, the fluorescence in the reaction chamber is read by a detection instrument and a detection result is output.

Images