A pretreatment method for extracting DNA from giant panda feces and its application

The QIAamp FAST DNA Stool Mini Kit, combined with a pretreatment method of rapid freezing, crushing, freeze-drying, and sieving, overcomes the difficulty of extracting DNA from old giant panda feces, improves DNA concentration and typing success rate, and is suitable for sex identification and genetic research in giant pandas.

CN120210328BActive Publication Date: 2025-09-12CHINA CONSERVATION & RES CENT FOR THE GIANT PANDA SICHUAN
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510695131.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-05-28
Publication Date
2025-09-12
Estimated Expiration
2045-05-28

AI Technical Summary

Technical Problem

During surveys of giant pandas in the wild, it was difficult to extract DNA from old feces, and the mucosal layer was severely degraded, resulting in reduced DNA concentration and quality, affecting the success rate of microsatellite typing. In addition, fresh feces were difficult to preserve for a long time and took up a lot of space.

Method used

DNA was extracted from giant panda feces using a pretreatment method that included rapid freezing, crushing, freeze-drying, and sieving, combined with the QIAamp FAST DNA Stool Mini Kit. This method omits the mucosal layer stripping step and is suitable for both fresh and aged feces.

Benefits of technology

It improves the success rate and stability of DNA extraction, reduces storage space requirements, and is suitable for long-term storage and efficient microsatellite typing, especially DNA typing of old feces.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120210328B_ABST
    Figure CN120210328B_ABST
Patent Text Reader

Abstract

The present invention discloses a pretreatment method and application for extracting DNA from giant panda feces, and relates to the technical field of molecular biology. The pretreatment method comprises the following steps: putting the newly collected feces into a sterile sampling bag, making the sample quickly and completely frozen, then breaking the feces, freeze-drying, sieving, and then sealing and freezing. The pretreatment method of the present invention can enrich the DNA of the surface mucosal layer and the trace DNA in the feces, without the need to peel off the surface mucosal layer, saving time and effort. The pretreatment operation is simple and does not require the use of any reagents. The pretreated feces is small in size, stable, and easy to store. It can be stored in a refrigerator for a long time for standby use, and the required storage space is small. The effective shelf life and service life of the sample can be improved, and can provide technical support for molecular and genetic research on giant pandas.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biology, and in particular relates to a pretreatment method for extracting DNA from giant panda feces and an application thereof. Background Art

[0002] As a flagship species unique to my country, the giant panda's population protection and genetic research are important topics in biodiversity conservation. Due to its non-destructive sampling characteristics, feces are widely used in the identification and sex determination of giant pandas. Microsatellite typing technology based on giant panda genomic DNA has become an important technical means for the identification of giant pandas, kinship identification, and population genetic structure research. In the fourth national giant panda survey, the giant panda DNA microsatellite typing identification method was introduced for the first time. The application of this technology has significantly improved the accuracy of wild giant panda population assessments and realized the analysis of wild population genetic diversity. Because giant panda feces is different from the feces of ordinary mammals, the DNA in giant panda feces is mainly enriched in the surface mucosal layer, and feces only contains trace amounts of DNA, while the DNA of ordinary mammals is mainly enriched in feces. Therefore, this identification method requires the direct peeling of the surface mucosal layer of the feces for DNA extraction. However, the distribution area of ​​giant pandas in the wild is wide, and it is difficult to obtain fresh feces. The pretreatment technology for DNA extraction from old giant panda feces has the following disadvantages:

[0003] 1. When conducting wild giant panda surveys, the collected feces are usually frozen and stored as a whole. Because giant panda feces are large in size, they take up a lot of space.

[0004] 2. Difficulty in obtaining exfoliated intestinal epithelial cells (ECs) present in giant panda feces: Panda feces are primarily composed of undigested bamboo stalks and leaves, covered by a mucous membrane. In addition to the exfoliated intestinal epithelial cells present in the mucous membrane, the undigested bamboo stalks and leaves in panda feces also carry a large number of these cells. However, the amount of these cells per gram of panda feces is relatively low, requiring pre-treatment and concentration before extraction.

[0005] 3. Furthermore, with increasing exposure time in the wild, the mucosal layer on the surface of aged feces degrades due to air drying and other factors, becoming less visible and sometimes difficult to observe with the naked eye. Some of the mucosal layer is broken, making it difficult to remove and utilize. Consequently, compared to fresh giant panda feces, the concentration and quality of DNA obtained from aged feces exposed in the wild are reduced, resulting in a significant decrease in the success rate of microsatellite typing. This severely limits the practical application of fecal DNA microsatellite typing in complex wild environments. Furthermore, the high humidity and multiple sources of contamination in the wild environment of giant panda feces make the genomic DNA in the feces susceptible to degradation.

[0006] In summary, obtaining a higher concentration of giant panda genomic DNA from old feces as much as possible is one of the key issues to be solved in order to improve the success rate of microsatellite typing. Summary of the Invention

[0007] The purpose of the present invention is to provide a pretreatment method for extracting DNA from giant panda feces and its application. The pretreatment method is efficient and simple, and the treated samples can be preserved for a long time and can be used for microsatellite typing and identification experiments.

[0008] In order to solve the problems existing in the prior art, the technical solutions adopted by the present invention are as follows:

[0009] In a first aspect, the present invention provides a pretreatment method for extracting DNA from giant panda feces, comprising the following steps:

[0010] The newly collected feces are placed in a sterile sampling bag, and the sample is quickly and completely frozen. The feces are then crushed, freeze-dried, and sieved. The sieved powder is placed in a glass test tube, which is then sealed and frozen in an ultra-low temperature refrigerator. The freeze-drying includes pre-freezing and analytical drying.

[0011] Furthermore, an ultra-low temperature freezer was used to quickly and completely freeze the samples at -72±1°C within 24 hours.

[0012] Furthermore, the pre-freezing temperature is -50±1°C, and the temperature is kept for 6±1h; the analytical drying starts from -50±1°C and increases by 10±1°C each time, and the temperature is kept for 63±1h until it reaches 20±1°C, and the temperature is kept warm for 3±1h.

[0013] Furthermore, the method further comprises the following steps:

[0014] The freeze-dried giant panda feces is sieved using a 30-40 mesh sieve, preferably 35 mesh.

[0015] Preferably, the freeze-drying is performed under vacuum conditions.

[0016] Furthermore, the freezing temperature is -72°C to -60°C.

[0017] In a second aspect, the present invention provides a giant panda feces DNA extraction sample, which is processed using the method described in the first aspect above.

[0018] In a third aspect, the present invention provides a method for extracting DNA from giant panda feces, which uses the extraction sample described in the second aspect above and a QIAamp FAST DNA Stool Mini Kit (51604) kit for DNA extraction. The QIAamp FAST DNA Stool Mini Kit (51604) kit contains InhibitEX Buffer, and the solid-liquid ratio of the extraction sample to InhibitEX Buffer is (0.05-0.12) g: (1-1.8) ml, preferably (0.08-0.10) g: (1.3-1.5) ml.

[0019] In a fourth aspect, the present invention provides the use of DNA obtained by the extraction method described in the third aspect in microsatellite typing and identification of giant panda feces.

[0020] In a fifth aspect, the present invention provides the use of DNA obtained by the extraction method described in the third aspect in sex identification of giant pandas.

[0021] The advantages and beneficial effects of the present invention are:

[0022] The present invention adopts a pretreatment method for giant panda feces, which includes first quickly and completely freezing, then crushing, freeze-drying, and sieving. This method can enrich the DNA of the surface mucosal layer and the trace DNA in the feces, without the need to peel off the surface mucosal layer, saving time and effort. The pretreatment operation is simple and does not require the use of any reagents. The pretreated feces is small in volume, stable, and easy to store. It can be stored in a refrigerator for a long time for standby use, and the required storage space is small. The effective shelf life and service life of the sample can be improved, and technical support can be provided for molecular and genetic research on giant pandas.

[0023] The method of the present invention is applicable to microsatellite typing identification of both fresh and old feces. Compared with the traditional method of directly peeling off the mucosal layer on the surface of feces for DNA extraction, the method of the present invention has better application effect in DNA microsatellite typing identification of old feces and has a higher typing success rate.

[0024] The method of the present invention is suitable for sex identification of giant pandas using old giant panda feces. Combined with the method of the present invention, loci suitable for microsatellite typing identification of old wild giant panda feces are screened out, thereby improving the efficiency of subsequent work. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 Figure 3 shows the results of PCR amplification of the microsatellite locus gpz-47 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0026] Figure 2 Figure 3 shows the results of PCR amplification of the microsatellite locus gpz-06 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0027] Figure 3 Figure 3 shows the results of PCR amplification of the microsatellite locus gpz-51 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0028] Figure 4 Figure 3 shows the results of PCR amplification of the microsatellite locus gpz-20 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0029] Figure 5 Figure 3 shows the results of PCR amplification of the microsatellite locus GPL-60 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0030] Figure 6 Figure 3 shows the results of PCR amplification of the microsatellite locus GPL-08 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0031] Figure 7 Figure 3 shows the results of PCR amplification of the microsatellite locus GPL-44 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0032] Figure 8 Figure 3 shows the results of PCR amplification of the microsatellite locus gpy-05 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0033] Figure 9 Figure 3 shows the results of PCR amplification of the microsatellite locus gpy-20 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0034] Figure 10 Figure 3 shows the results of PCR amplification of the microsatellite locus GPL-31 using DNA extracted from giant panda FF feces (exposure day 3) using the method described in Example 3, and the results of fluorescence capillary electrophoresis detection of the PCR products;

[0035] Figure 11 The number of successful microsatellite typing sites in fecal samples of the two pandas in the experimental group 1 and the control group 3 at different exposure times. In the figure: a is the exposure day of sample FF; b is the exposure day of sample DL;

[0036] Figure 12 SYR gene electrophoresis detection diagram; in the figure: Marker: DL2000; Lane 1: male control; Lane 2: DL; Lane 3: FF; Lane 4: LL; Lane 5: JM; Lane 6: XL; Lane 7: HZ; Lane 8: female control;

[0037] Figure 13 The typing success rate of different microsatellite loci in the fecal DNA of 30 wild giant pandas;

[0038] Figure 14 Fresh manure for enclosure;

[0039] Figure 15 For old feces in the wild;

[0040] Figure 16 This is the feces sample after pretreatment in Example 1. DETAILED DESCRIPTION

[0041] The following will be combined with the accompanying drawings in the embodiments of the present application to clearly describe the technical solutions in the embodiments of the present application. Obviously, the embodiments described are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field are within the scope of protection of this application.

[0042] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0043] Example 1

[0044] This embodiment provides a pretreatment method for extracting DNA from old giant panda feces, comprising the following steps:

[0045] ①Put the newly collected old giant panda feces into a sterile sampling bag and place it in an ultra-low temperature refrigerator. Freeze the sample quickly and completely within 24 hours at -72°C.

[0046] ②Then use a hammer to knock the feces into pieces through the sterile bag.

[0047] ③ Freeze-dry the fragments in a freeze-drying machine under vacuum conditions. The freeze-drying process includes pre-freezing and desorption drying. The pre-freezing stage is at -50°C for 6 hours. The desorption drying stage starts at -50°C and increases the temperature by 10°C each time, for 63 hours, until it reaches 20°C, where it is maintained for 3 hours. The entire process takes approximately 72 hours.

[0048] The freeze-drying equipment used in this example is the LGJ-100FG standard in-situ silicone oil freeze dryer from Beijing Yaxing Instrument Technology Development Co., Ltd. Its technical parameters are as follows: Freeze-drying area: 1.04 m2; Cold trap temperature: -75°C (unladen); Shelf temperature range: -50°C to +70°C, with a temperature control accuracy of ±1°C; Ultimate vacuum: ≤5 Pa (unladen); Water capture capacity: 15 kg / 24 h (standard model) or 15 kg (some parameters do not include time units); Cooling method: Air cooling (room temperature ≤ 25°C); Power supply: 380 V / 50 Hz; Total power: 6500 W; Dimensions: 1150 × 830 × 1620 mm; Shelf parameters: 70 mm interlayer spacing, 61 shelving layers, and 480 × 360 mm shelving dimensions.

[0049] ④ The freeze-dried fragments were sieved through a 35-mesh sieve, and the sieved powder was placed in a sealed glass test tube and stored in an ultra-low temperature refrigerator at -72°C. The obtained giant panda feces powder was as follows: Figure 16 As shown, the powder can be used as a sample for DNA extraction from giant panda feces.

[0050] Example 2

[0051] This embodiment provides a pretreatment method for DNA extraction from fresh giant panda feces. The only difference between this embodiment and Example 1 is that fresh giant panda feces is pretreated, and the rest is the same as Example 1.

[0052] Comparative Example 1

[0053] This comparative example provides a pretreatment method for extracting DNA from old giant panda feces, comprising the following steps:

[0054] ①Put the newly collected old giant panda feces into a sterile sampling bag and place it in an ultra-low temperature refrigerator. Freeze the sample quickly and completely within 24 hours at -72°C.

[0055] ②Then use a hammer to break up the feces through the sterile bag;

[0056] ③ Place the crushed feces in a sealed glass tube and freeze it in an ultra-low temperature refrigerator at -72°C.

[0057] Example 3

[0058] This embodiment provides a method for extracting DNA from giant panda feces, comprising the following steps:

[0059] The stool powder obtained in Example 1 was used as a sample, and DNA was extracted using the QIAamp FAST DNA Stool Mini Kit (51604). In this example, the amount of stool sample used in step 1 and the amount of InhibitEX Buffer used in step 2 of the kit instructions were modified. In this example, the amount of stool sample used in step 1 was 0.1 g, and the amount of InhibitEX Buffer used in step 2 was 1.5 ml. The remaining steps were performed according to the kit instructions.

[0060] Example 4

[0061] This embodiment provides a method for extracting DNA from giant panda feces. The only difference between this embodiment and Example 3 is that the amount of extracted sample is 0.08 g, and the rest is the same as Example 3.

[0062] Example 5

[0063] This example provides a method for extracting DNA from giant panda feces. The only difference between this example and Example 3 is that the amount of sample used for extraction is 0.11 g, and the rest is the same as Example 3.

[0064] Example 6

[0065] This embodiment provides a method for extracting DNA from giant panda feces. The only difference between this embodiment and Example 3 is that the powder obtained in Example 2 is used as a sample. The rest is the same as Example 3.

[0066] Comparative Example 2

[0067] This comparative example provides a method for extracting DNA from giant panda feces. The only difference between this comparative example and Example 3 is that the feces sample obtained in Comparative Example 1 is used as the sample for extraction, and the rest is the same as Example 3.

[0068] Comparative Example 3

[0069] This comparative example provides a method for extracting DNA from giant panda feces. The only difference between this comparative example and Example 3 is that the operation in this comparative example is carried out in full accordance with the instructions of the QIAamp FAST DNA Stool Mini Kit (51604), the amount of feces sample used is 0.18 g, and the amount of InhibitEX Buffer used is 1.0 ml.

[0070] Comparative Example 4

[0071] The stool sample obtained in Example 1 was used as a sample for extraction using the SDS-CTAB method, and the steps were as follows:

[0072] Take 0.1g of freeze-dried feces, add 950ul of TE, 50ul of 10% SDS, and 50ul of 20mg / ml proteinase K, mix well, and incubate at 37°C for 1 hour. Then add 150ul of 5mol / L NaCl and 150ul of CTAB, mix well, and incubate at 65°C for 20 minutes.

[0073] ② Add an equal volume of chloroform-isoamyl alcohol (24:1 volume ratio) and mix gently by inversion for 10 minutes. Centrifuge (12,000 × g, 10 min, 4°C) and transfer the supernatant to a clean centrifuge tube.

[0074] ③ Add 1 volume of isopropanol, gently invert to mix, and let stand at -20°C for 30 minutes. Centrifuge (12,000 × g, 15 minutes, 4°C), discard the supernatant, and retain the DNA pellet.

[0075] ④ Wash the precipitate twice with 1 mL of 70% ethanol, centrifuge, and air dry. After drying, dissolve the precipitate in 50-100 μL of TE buffer.

[0076] Comparative Example 5

[0077] This comparative example provides a method for extracting DNA from giant panda feces, comprising the following steps: placing a whole piece of fresh giant panda feces in a sterile box, peeling off the epidermal mucosa of the fresh giant panda feces with sterile tweezers, placing the peeled fecal epidermal mucosa in a 2 ml EP tube, and then using the peeled fecal epidermal mucosa as a sample to extract DNA using the QIAamp FAST DNA StoolMini Kit (51604). In this comparative example, the amount of epidermal mucosa used is 0.2 g, the amount of InhibitEX Buffer used is 1.5 ml, and the remaining steps are the same as in Example 6.

[0078] Experimental Example 1

[0079] The effects of different pretreatment methods on the success rate of microsatellite typing in giant panda feces are as follows:

[0080] 1. Experimental methods

[0081] The experiment was conducted at the Dujiangyan Base of the China Conservation and Research Center for the Giant Panda.

[0082] Fecal samples were collected from two adult captive giant pandas (FF: female, DL: male) and placed in a bamboo forest (temperature 5.5℃-11.6℃, humidity 58.7-69.2%) to simulate the fecal environment in the wild. Fecal samples were collected on days 0, 3, 7, 14, 21, and 28. Figure 14 As shown in the figure, the feces collected within 2 hours of the giant panda’s defecation on day 0 are fresh feces in captivity. Figure 15As shown, feces placed in a simulated outdoor feces environment for 3-28 days are all stale feces. The fresh feces samples of the two pandas collected on day 0 were divided into 2 parts, one for DNA extraction according to the method described in Example 6; the other for DNA extraction according to the method described in Comparative Example 5; the stale feces of the two pandas collected on days 3, 7, 14, 21 and 28 were divided into 6 parts, one for DNA extraction according to the method described in Comparative Example 2; the remaining 5 parts were respectively extracted with DNA according to the methods of Examples 3-5 and Comparative Examples 3-4. The specific experimental groups are:

[0083] Experimental groups:

[0084] Experimental Group 1: DNA was extracted from giant panda feces according to the method described in Example 3;

[0085] Experimental Group 2: DNA was extracted from giant panda feces according to the method described in Example 4;

[0086] Experimental Group 3: DNA was extracted from giant panda feces according to the method described in Example 5;

[0087] Experimental Group 4: DNA was extracted from giant panda feces according to the method described in Example 6;

[0088] Control group 1: DNA was extracted from giant panda feces according to the method described in comparative example 3;

[0089] Control group 2: DNA was extracted from giant panda feces according to the method described in comparative example 4;

[0090] Control group 3: DNA was extracted from giant panda feces according to the method described in comparative example 5;

[0091] Control group 4: DNA was extracted from giant panda feces according to the method described in Comparative Example 2.

[0092] Because DNA extracted from blood samples is highly stable, subsequent microsatellite typing results are highly accurate. Therefore, DNA extracted from the blood samples of two giant pandas was used in the same batch as fecal samples for microsatellite typing. The microsatellite typing results obtained from the blood DNA were used as the standard value to determine whether the microsatellite typing results from the fecal DNA samples were correct.

[0093] The obtained DNA sample was used as a template and PCR amplification was performed using multiple sets of microsatellite primers. The PCR amplification system was: 12.5ul of Premix Taq (TaKaRa Taq Verison 2.0 plus dye), 1ul of upstream and downstream primers, 2ul of DNA template, and 9.5ul of ddH2O. The PCR reaction program was: 95°C for 10min; 95°C for 30s, annealing temperature for 30s, 72°C for 30s, for a total of 37 cycles; and extension at 72°C for 10min. The PCR test was repeated three times for each sample. If the three results were inconsistent, the result was considered invalid. The obtained PCR products were sent to Qingke Biotechnology Co., Ltd. for genotyping. The number of sample alleles and allele size were determined using GeneMapper 4.0 software and the molecular internal standard ROX-500, respectively. Microsatellite primers and annealing temperatures are shown in Table 1:

[0094] Table 1 Information on giant panda microsatellite primers

[0095]

[0096] (II) Results: The microsatellite typing results of the two giant panda feces are shown in Tables 2 and 3:

[0097] Table 2

[0098]

[0099]

[0100]

[0101] Note: “ / ” means no results.

[0102] Table 3

[0103]

[0104]

[0105] Note: “ / ” means no results.

[0106] As shown in Tables 2 and 3, the microsatellite typing results for all DNA samples extracted from the blood of the two giant pandas were identical to those for samples collected on day 0 from experimental group 4 and control group 3, indicating that the panda fecal DNA extracted using the method of the present invention is suitable for microsatellite typing. This indicates that the method of the present invention is also applicable to microsatellite typing of DNA in fresh giant panda feces.

[0107] like Figures 1 to 10As shown in the figure, microsatellite PCR amplification was performed on the DNA extracted from giant panda FF feces (exposure day 3) in experimental group 1. The PCR products showed clear genotyping bands with few impurity peaks by capillary electrophoresis, and the results were highly accurate. Figures 1 to 10 The microsatellite loci in the middle are (A) gpz-47, (B) gpz-06, (C) gpz-51, (D) gpz-20, (E) GPL-60, (F) GPL-08, (G) GPL-44, (H) gpy-05, (I) gpy-20, and (J) GPL-31.

[0108] like Figure 11 As shown in the figure, the number of successful microsatellite typing sites in fecal samples of two giant pandas under different exposure times, experimental group 1 and control group 3, were analyzed. It was found that the number of successful typing sites decreased with the increase of exposure time.

[0109] like Figure 11 As shown in (a), when the giant panda FF fecal samples in experimental group 1 were exposed for 3, 7, 14, 21, and 28 days, the number of microsatellite loci that could be successfully detected in the samples of the experimental group were 10, 8, 6, 4, and 3, respectively, and the number of microsatellite loci that could be successfully detected in the samples of control group 3 were 8, 4, 2, 1, and 0.

[0110] like Figure 11 As shown in middle b, when the giant panda DL fecal samples of experimental group 1 were exposed for 3, 7, 14, 21 and 28 days, the number of microsatellite loci that could be successfully detected in the samples of the experimental group were 10, 10, 8, 7, and 5, respectively, and the number of microsatellite loci that could be successfully detected in the samples of control group 3 were 8, 8, 6, 2, and 2.

[0111] The above results show that under the same number of exposure days, the number of microsatellite loci successfully detected in the experimental group 1 using the present invention is greater than that in the control group 3, indicating that the present invention can improve the success rate of microsatellite typing of DNA samples extracted from old feces.

[0112] Experimental groups 1, 2, and 3 used different aged fecal samples to extract DNA. In experimental groups 2 and 3, all aged fecal samples of giant pandas FF and DL had 2-3 sites that could not be successfully detected. In experimental group 1, all sites of giant pandas FF and DL could be successfully detected on the third day of exposure. In control groups 1, 2, and 4, 5, 10, and 5 sites, respectively, could not be successfully detected. This indicates that the DNA extraction method of the present invention can improve the success rate of microsatellite typing of DNA samples.

[0113] Experimental Group 4, using fresh fecal samples from giant pandas FF and DL, successfully detected 10 loci. However, Control Group 3, using fresh fecal samples from giant pandas FF and DL, failed to detect one locus in each case. This demonstrates that the method of the present invention can improve the success rate of microsatellite typing in DNA samples, whether fresh or aged. When the "fecal sample size is 0.1 g and the InhibitEX Buffer dosage is 1.5 ml," the success rate of microsatellite typing in NA samples can be effectively improved.

[0114] Experimental Example 2

[0115] The pretreatment method for extracting DNA from old giant panda feces and the application of extracted DNA in giant panda sex identification are as follows:

[0116] 1. Experimental Animals

[0117] DNA was extracted from the old feces of six captive giant pandas (day 3 of exposure in the wild). The information of the six giant panda samples is shown in Table 4:

[0118] Table 4

[0119]

[0120] 2. Experimental groups and methods:

[0121] Experimental Group 1: DNA was extracted from the feces of the six adult captive giant pandas (day 3 of field exposure) according to the method described in Example 3;

[0122] Control group 1: DNA was extracted from the old feces of the six giant pandas (day 3 of field exposure) according to the following method: the old feces of the giant pandas were directly frozen in an ultra-low temperature freezer for more than 6 months after collection. Before DNA extraction, they were thawed at room temperature. The fecal epidermis and mucosa were peeled off with sterile tweezers, and then DNA was extracted using the QIAamp FAST DNAStool Mini Kit (51604). In this control group, the amount of fecal epidermis and mucosa used was 0.2 g, and the amount of InhibitEX Buffer used was 1.5 ml. The remaining steps were carried out according to the kit instructions.

[0123] Based on the sex-identifying genes SYR SRY-F (SEQ ID NO.21: TGGTCTCGTGATCAAAGGCG), SRY-R (SEQ ID NO.22: GCCATTTTTCGGCTTCCGTAAG), and SRY-R1 (SEQ ID NO.23: GCCATTTTTCGGCTTCtGTAAG), PCR was used to amplify the male-specific SYR gene (approximately 120 bp). Male and female control DNA samples were also prepared. The PCR amplification system consisted of 12.5 μl of Premix Taq (TaKaRa Taq Verison 2.0 plus dye), 1 μl of each primer, 2 μl of DNA template, and 9.5 μl of ddH2O. The PCR reaction program was: 95°C for 5 min, followed by 30 cycles of 95°C for 5 s and 59°C for 90 s, followed by an extension at 60°C for 30 min.

[0124] The samples were tested using 1.5% agarose gel electrophoresis. The sex was determined based on whether the SRY gene was amplified. If a band was detected, the sample was male; if no band was detected, the sample was female.

[0125] 3. Experimental results:

[0126] Experimental group 1: Figure 12 As shown, lanes 1, 2, 4, and 6 correspond to male samples, namely the male control, sample DL, sample LL, and sample XL, respectively. Bands were detected by electrophoresis, indicating successful sex identification. Lanes 3, 5, 7, and 8 correspond to female samples, namely samples FF, JM, HZ, and the female control, respectively. No bands were detected by electrophoresis, indicating successful sex identification.

[0127] Control group 1: No bands were detected in males, and sex identification was not successfully completed.

[0128] The results showed that the DNA extracted from the samples obtained by the feces pretreatment method of the present invention successfully completed the sex identification, indicating that the method of the present invention can be used to identify the sex of giant pandas.

[0129] Experimental Example 3

[0130] Based on the 10 microsatellite loci commonly used for microsatellite identification of giant pandas in Example 1, loci with a high success rate for DNA typing and identification of old wild giant panda feces were screened.

[0131] The experimental methods are as follows:

[0132] (1) This study collected 30 fecal samples from wild giant pandas at different locations. Based on empirical evidence, the feces were exposed to the wild for 3-15 days. The fecal samples were pretreated as described in Example 1, and DNA was then extracted from the fecal samples using the method described in Example 3.

[0133] (2) The obtained DNA samples were used as templates for PCR amplification using 10 sets of microsatellite primers: gpz-47, gpz-06, gpz-51, gpz-20, GPL-60, GPL-08, GPL-44, gpy-05, gpy-20, and GPL-31. The PCR amplification system was as follows: 12.5 μl of Premix Taq (TaKaRa Taq Verison 2.0 plus dye), 1 μl of each upstream and downstream primer, 2 μl of DNA template, and 9.5 μl of ddH2O. The PCR reaction procedure was as follows: 95°C for 10 min; 95°C for 30 s, annealing temperature for 30 s, and 72°C for 30 s, for a total of 37 cycles; and extension at 72°C for 10 min. The PCR test was repeated three times for each sample. If the three results were inconsistent, the result was considered invalid.

[0134] (3) The obtained PCR products were sent to Qingke Biotechnology Co., Ltd. for genotyping. The software GeneMapper4.0 and the molecular internal standard ROX-500 were used to determine the number of sample alleles and the size of the alleles, respectively.

[0135] 2. Experimental results:

[0136] (1) 30 wild giant panda fecal DNA samples were typed using 10 microsatellite primers. The number of giant panda samples that successfully amplified 1, 2, 3, 4, 5, and 6 microsatellite loci was 3, 4, 7, 8, 4, and 4, respectively. This indicates that the method of the present invention can be used for microsatellite detection in wild giant panda feces and is suitable for individual identification research of wild giant pandas.

[0137] (2) If Figure 13 As shown in the figure, an analysis of the typing success rates of different microsatellite loci revealed that six loci could be typed in a significant number of samples (over 40%), with the two loci GPY-05 and GPZ-51 having the highest typing success rates. Typing results were not obtained for the two loci GPL-60 and GPZ-47, indicating that these two loci are not suitable for microsatellite typing analysis of wild giant panda fecal samples.

[0138] The embodiments of the present application are described above in conjunction with the accompanying drawings, but the present application is not limited to the above-mentioned specific implementation methods. The above-mentioned specific implementation methods are merely illustrative and not restrictive. Under the guidance of this application, ordinary technicians in this field can also make many forms without departing from the purpose of this application and the scope of protection of the claims, all of which are within the protection of this application.

Claims

1. A pretreatment method for extracting DNA from giant panda feces, characterized in that: The following steps are involved: ①Put the newly collected old giant panda feces into a sterile sampling bag and place it in an ultra-low temperature freezer at -72±1℃ to quickly and completely freeze the sample within 24 hours; ②Then use a hammer to knock the feces into pieces through the sterile bag; ③ Freeze-dry the fragments using a freeze-drying device. Freeze-drying includes pre-freezing and desorption drying. The pre-freezing stage is at -50±1°C and the temperature is kept at this temperature for 6±1h. The desorption drying stage starts at -50±1°C and the temperature is increased by 10±1°C each time, and the temperature is kept at this temperature for 63±1h until it reaches 20±1°C, and the temperature is kept at this temperature for 3±1h. ④Sieve, seal and freeze.

2. The pretreatment method for extracting DNA from giant panda feces according to claim 1, wherein The following steps are also included: The freeze-dried giant panda feces was sieved using a 30-40 mesh sieve.

3. The pretreatment method for extracting DNA from giant panda feces according to claim 1, wherein The freeze-drying is carried out under vacuum conditions.

4. The pretreatment method for extracting DNA from giant panda feces according to claim 1, wherein The freezing temperature is -60°C to -72°C.

5. A method for extracting DNA from giant panda feces, characterized in that: A DNA extraction sample obtained by the pretreatment method for extracting DNA from giant panda feces according to any one of claims 1 to 4 is subjected to DNA extraction using a QIAamp FAST DNA Stool MiniKit kit, wherein the QIAamp FAST DNA Stool Mini Kit contains InhibitEX Buffer, and the solid-liquid ratio of the extracted sample to InhibitEX Buffer is 0.05–0.12 g: 1–1.8 ml.

Citation Information

Patent Citations

  • Method for acquiring microsatellite marker in panda excrement and application of microsatellite marker

    CN117965686A