Identification method of flower thrips

Abstract

The invention provides a method for identifying flower thrips, and belongs to the technical field of flower thrips identification. The method comprises the following steps: puncturing the second section to the eighth section of the belly of the Frankliniella occidentalis by using a microneedle, placing the punctured Frankliniella occidentalis in a buffer solution, adding a protease K solution, carrying out primary centrifugation, incubating at 37 DEG C for 30 minutes, denaturing at 95 DEG C for 7 minutes, carrying out secondary centrifugation, taking supernate, and respectively carrying out ITS sequence amplification and COI sequence amplification on the supernate. The DNA for PCR amplification of the ITS sequence and the COI sequence is extracted by adopting the method disclosed by the invention, and the method is quick, effective, simple, convenient and capable of accurately identifying the Frankliniella occidentalis.

Description

Technical Field

[0001] The present invention belongs to the technical field of Frankliniella intonsa identification, and particularly relates to a method for identifying Frankliniella intonsa. Background Art

[0002] Frankliniella intonsa (Trybom) of the genus Frankliniella Karny is widely distributed. Frankliniella intonsa has a wide variety of host plants, strong flower tropism, inhabits many plant flowers, and can help plants spread pollen. However, when the population is large, it can also damage plants. During the flowering period when sunflower young grains are formed, a large number of Frankliniella intonsa feed on pollen and rasp young grains, resulting in scars (collectively referred to as "grain rust spots") in the process of the grain husk hardening and forming. After maturity, it affects the purchase price of grains and causes economic losses to farmers.

[0003] The classification and identification of thrips are very important for controlling harmful thrips and utilizing beneficial thrips, as well as for the quarantine and monitoring of thrips. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a method for identifying Frankliniella intonsa, which is fast, effective, simple and convenient, and can accurately identify Frankliniella intonsa.

[0005] In order to achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0006] A method for identifying Frankliniella intonsa includes the following steps: puncturing the second to eighth abdominal segments of Frankliniella intonsa with a micro needle, placing the punctured Frankliniella intonsa in a buffer solution, adding a proteinase K solution, performing the first centrifugation, then incubating at 37 °C for 30 min, denaturing at 95 °C for 7 min, and taking the supernatant after the second centrifugation to amplify the ITS sequence and the COI sequence respectively.

[0007] Preferably, the micro needle is a No. 00 insect needle, and the number of punctures is 1 to 3 times.

[0008] Preferably, the buffer solution is 100 mmol / L NaCl + 10 mmol / L Tris-HCl + 1 mmol / L EDTA, pH 8.0.

[0009] Preferably, the ratio of Frankliniella intonsa, buffer solution and proteinase K solution is 1 head: 50 μL: 4 μL; the concentration of the proteinase K solution is 10 mg / mL.

[0010] Preferably, the amplification program for the ITS sequence and the COI sequence is: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 45 - 50 °C for 30 s, extension at 72 °C for 50 s, for a total of 35 cycles; full extension at 72 °C for 10 min.

[0011] Preferably, the nucleotide sequences of the upstream and downstream primers for ITS sequence amplification are shown in SEQ ID NO.1-2, and the nucleotide sequences of the upstream and downstream primers for COI sequence amplification are shown in SEQ ID NO.3-4.

[0012] Preferably, the reaction systems for both ITS sequence amplification and COI sequence amplification are as follows: 5 μL of DNA template, 25 μL of 2×EasyTaq PCR SuperMix, 1 μL of each of the upstream and downstream primers, and 18 μL of sterilized double-distilled water.

[0013] Preferably, after the amplification of the ITS sequence and the COI sequence is completed, the amplification products are respectively subjected to agarose gel electrophoresis: if a 500 bp band appears in the electrophoresis pattern of the ITS sequence amplification product and a 700 bp band appears in the electrophoresis pattern of the COI sequence amplification product at the same time, then the amplification products are sequenced.

[0014] Preferably, after the second centrifugation, the Frankliniella intonsa in the buffer is taken out for morphological identification.

[0015] Preferably, the morphological identification includes the following steps: soaking the Frankliniella intonsa in 10% NaOH solution to soften it, soaking the softened Frankliniella intonsa in water to discharge the substances in the body, then soaking the Frankliniella intonsa in 10% glacial acetic acid, dehydrating the Frankliniella intonsa after washing, arranging the specimen morphology on a glass slide, dropping glue on the Frankliniella intonsa, covering it with a cover slip, and performing microscopic examination after drying.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides a method for identifying Frankliniella intonsa. By adopting the method of the present invention, DNA for PCR amplification of ITS sequence and COI sequence can be extracted and obtained without damaging the insect body. This method is rapid, effective, simple and convenient, and can accurately identify Frankliniella intonsa. Description of the Drawings

[0018] Figure 1 It is the electrophoresis diagram of the ITS sequence amplification product;

[0019] Figure 2 It is the electrophoresis diagram of the COI sequence amplification product;

[0020] Figure 3 It is the microscopic examination picture of the Frankliniella intonsa specimen;

[0021] Figure 4 It is the amplification results of the DNA of Frankliniella intonsa (X1 and X2) using primer H, primer F and primer P at different annealing temperatures;

[0022] Figure 5Amplification results of DNA of Frankliniella intonsa (X3 and X4) using primer A at different annealing temperatures;

[0023] Figure 6 Results of amplification of DNA obtained by different extraction methods using primer H. Lanes 1 and 2 are the detection results of treatment 1, lanes 3 and 4 are the detection results of treatment 2, lane 5 is the detection result of treatment 3, and lane 6 is the detection result of treatment 4. Detailed implementation manners

[0024] The present invention provides a method for identifying Frankliniella intonsa, comprising the following steps: puncturing the second to eighth abdominal segments of Frankliniella intonsa with a microneedle, placing the punctured Frankliniella intonsa in a buffer solution, adding a proteinase K solution, performing a first centrifugation, then incubating at 37 °C for 30 min, denaturing at 95 °C for 7 min, and taking the supernatant after the second centrifugation to perform amplification of ITS sequence and COI sequence respectively.

[0025] In the specific embodiments of the present invention, it is used to identify adult Frankliniella intonsa collected from sunflower fields. Preferably at the R5 stage of sunflower (6 d to 12 d after flowering), adult Frankliniella intonsa are collected on the field flower disks. The method for collecting adult Frankliniella intonsa is the slapping method or the bagging method.

[0026] The steps of collecting by the slapping method preferably include: preparing a collection plate or collection cloth with an area larger than the sunflower disk, placing it under the sunflower disk, slapping the flower disk with the hand to slap the Frankliniella intonsa into the collection plate; then using a small brush to dip in absolute ethanol and collecting it into a collection tube containing an absolute ethanol solution.

[0027] The steps of collecting by the bagging method preferably include: preparing a 300-mesh net bag, putting it on the sunflower disk, cutting off the flower disk and tying the opening firmly, bringing it back indoors to collect adult Frankliniella intonsa on the flower disk; using a small brush to dip in absolute ethanol and collecting it into a collection tube containing an absolute ethanol solution.

[0028] In the present invention, the collection tube is preferably 10 mL, 9 mL of absolute ethanol is added to each tube, and 100 - 200 Frankliniella intonsa can be collected in each tube. The collection of Frankliniella intonsa is mainly based on adults, and two collection tubes are collected at each location; a written label is placed in the collection tube, then the collection tube is sealed with a sealing film and placed in a plastic-sealed bag; stored at -20 °C for standby; the writing method of the label is: write a label in each collection tube during collection, indicating the collection time, location, host plant part, longitude and latitude, collector, and indicating the growth period of the sunflower and the surrounding environment.

[0029] The identification method of Frankliniella intonsa in the present invention preferably uses a No. 00 insect pin as the micro-needle, and the number of punctures is 1 to 3 times. As an implementable method, the present invention takes a single Frankliniella intonsa out of the absolute ethanol preservation solution and transfers it to a clean glass slide. The glass slide is placed under a dissection microscope and adjusted to be within the field of view. First, the wings of the Frankliniella intonsa are spread to both sides of the body with a sterile micro-needle, and then the abdomen of the Frankliniella intonsa is punctured with the micro-needle. The present invention uses a micro-needle to puncture Frankliniella intonsa, and DNA for PCR amplification can be extracted and obtained without damaging the scutellum of the first abdominal segment of Frankliniella intonsa.

[0030] In the present invention, preferably, the buffer solution is 100 mmol / L NaCl + 10 mmol / L Tris-HCl + 1 mmol / L EDTA, pH 8.0; wherein, the concentration of each substance is its final concentration in the buffer solution. Preferably, the ratio of Frankliniella intonsa, the buffer solution and the proteinase K solution is 1 head: 50 μL: 4 μL; the concentration of the proteinase K solution is 10 mg / mL. In the specific embodiment of the present invention, the proteinase K (RT403) is purchased from Tiangen Company, and the enzyme activity is ≥45 U / mg.

[0031] Frankliniella intonsa belongs to micro-insects with a body length of only 0.5 - 2.0 cm. It is relatively difficult to obtain DNA that can be used for PCR amplification without damaging the insect body. In the present invention, the buffer solution for DNA extraction and proteinase K are directly used to digest the contents overflowing from the insect body, without the need for supernatant transfer, avoiding contamination. At the same time, the extracted DNA can be used for subsequent PCR amplification.

[0032] In the identification method of Frankliniella intonsa in the present invention, preferably, the centrifugation conditions are: the centrifugation temperature is 4°C, the centrifugation speed is 10000 - 13000 rpm, more preferably 12000 rpm, and the centrifugation time is 0.5 - 2 min, more preferably 1 min. The first centrifugation in the present invention can mix the Frankliniella intonsa body, the contents after puncture, the buffer solution and the proteinase K together to fully react during incubation; after the second centrifugation in the present invention, the supernatant is used as a DNA template for subsequent PCR reactions, and the centrifuged Frankliniella intonsa is stored at -20°C and can be used for subsequent morphological identification.

[0033] In the present invention, the nucleotide sequences of the upstream and downstream primers preferably used for ITS sequence amplification are shown in SEQ ID NO.1 - 2: CAS5p8sFc (SEQ ID NO.1): TGAACATCGACATTTYGAACGCA CAT, CAS28sB1d (SEQ ID NO.2): TTCTTTTCCTCCSCTTAYTRATATGCTTAA; the nucleotide sequences of the upstream and downstream primers preferably used for COI sequence amplification are shown in SEQ ID NO.3 - 4: LCO1490 (SEQ ID NO.3): GGTCAACAAATCATAAAGATATTGG, HCO2198 (SEQ ID NO.4): TAAACTTCAGGGTGACCAAAAAATCA.

[0034] In the present invention, the amplification reaction systems for both ITS sequence and COI sequence are preferably: 5 μL of DNA template, 25 μL of 2×EasyTaq PCR SuperMix, 1 μL of each of the upstream and downstream primers, and 18 μL of sterilized double-distilled water. The amplification procedures for both ITS sequence and COI sequence are preferably: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 45 - 50°C for 30 s, extension at 72°C for 50 s, for a total of 35 cycles; final extension at 72°C for 10 min. The present invention discovers through research that when performing PCR amplification using the primers provided by the present invention, the annealing temperature directly affects whether a target band can be specifically amplified.

[0035] In the present invention, preferably after the amplification of ITS sequence and COI sequence is completed, the amplification products are respectively subjected to agarose gel electrophoresis: if a 500 bp band appears in the electrophoresis pattern of the ITS sequence amplification product and a 700 bp band appears in the electrophoresis pattern of the COI sequence amplification product, then the amplification products are sequenced, and the sequencing results are compared on NCBI, and it is determined whether it is Frankliniella intonsa according to the comparison results.

[0036] In the present invention, preferably after the second centrifugation, the Frankliniella intonsa in the buffer is taken out for morphological identification. The morphological identification includes the following steps: soaking the Frankliniella intonsa in 10% NaOH solution to soften it; after softening, soaking the Frankliniella intonsa in water to discharge the substances in the body; then soaking the Frankliniella intonsa in 10% glacial acetic acid, dehydrating the Frankliniella intonsa after washing, placing it on a glass slide to arrange the specimen morphology, dropping glue on the Frankliniella intonsa, covering it with a cover slip, and performing microscopic examination after drying.

[0037] In the present invention, in the morphological selection and identification, it is preferably soaked in 10% NaOH solution for 5 - 6 h; preferably soaked in water for 11 - 13 h to discharge the substances in the body, more preferably soaked for 12 h; preferably soaked in 10% glacial acetic acid for 2 - 4 min, more preferably soaked for 3 min; the dehydration is preferably carried out by soaking the flower thrips in ethanol solutions with mass fractions of 35%, 50%, 70%, 85%, 90%, 95% and absolute ethanol in sequence for 2 min each, and dehydrating step by step from low concentration to high concentration; the specimen morphology is arranged to make the antennae and front legs of the flower thrips extend forward, and the middle legs and hind legs extend backward. When arranging the morphology, it is preferably carried out in absolute ethanol to avoid the insect body from drying out and being easily damaged; the drying temperature is preferably 35 - 45 °C, more preferably 40 °C, and the drying time is preferably 40 - 50 h, more preferably 48 h.

[0038] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example 1

[0040] A method for identifying flower thrips includes the following steps:

[0041] 1. Collect flower thrips.

[0042] 10 days after the sunflower blossoms, the flower thrips in the sunflower field are collected by the bagging method. Prepare a 300 - mesh net bag, put it on the sunflower disk, cut off the flower disk and tie the opening firmly, and bring it back indoors to collect the adult flower thrips on the flower disk.

[0043] Then, dip a small brush in absolute ethanol and collect it into a collecting tube containing absolute ethanol solution (the collecting tube is 10 mL, 9 mL of absolute ethanol is added to each tube, and each tube can collect 100 - 200 flower thrips. The collection of flower thrips is mainly based on adults, and two collecting tubes are collected at each location).

[0044] Put the written label into the collecting tube with a pencil, then seal the collecting tube with a sealing film and put it into a plastic - sealed bag. Store it in a - 20 °C refrigerator.

[0045] 2. Molecular biology identification.

[0046] 2.1 Extract DNA of flower thrips.

[0047] Add 50 μL of buffer solution (100 mmol / L NaCl + 10 mmol / L Tris - HCl + 1 mmol / L EDTA, pH 8.0) into the PCR tube, and place the centrifuge tube on ice;

[0048] Take the Frankliniella unicuspis from the absolute ethanol preservation solution and transfer it to a clean glass slide. Place the glass slide under a dissection microscope and adjust it within the field of view. First, use a sterile micro needle (the "00" needle in insect needles) to spread the wings of the Frankliniella unicuspis to both sides of the body, and then use the micro needle to pierce the second to eighth abdominal segments of the Frankliniella unicuspis three times. Put the pierced Frankliniella unicuspis into a PCR tube pre-filled with 50 μL of buffer solution;

[0049] Use a pipette to add 4 μL of proteinase K (10 mg / mL) to the centrifuge tube containing a single Frankliniella unicuspis;

[0050] Centrifuge at 12000 rpm for 1 min at 4 °C;

[0051] Incubate at 37 °C for 30 min and denature at 95 °C for 7 min;

[0052] After centrifuging at 12000 rpm for 1 min at 4 °C, take the supernatant as the template for the PCR reaction and immediately perform PCR amplification.

[0053] Store the centrifuged Frankliniella unicuspis in a -20 °C refrigerator. Take it out when making slide specimens and make permanent slides for species identification.

[0054] 2.2 PCR amplification.

[0055] Perform PCR amplification on the mt DNA COI and ITS gene fragments of Frankliniella unicuspis respectively, and the amplification reaction conditions for both are the same.

[0056] ITS sequence amplification primers (denoted as primer A): SEQ ID NO.1 - 2;

[0057] COI sequence amplification primers (denoted as primer H): SEQ ID NO.3 - 4.

[0058] The amplification reaction system (50 μL) is: 5 μL of DNA template, 25 μL of 2×Easy Taq PCR Super Mix (TRAN), 1 μL each of upstream and downstream primers (10 μmol / L), and 18 μL of sterilized double-distilled water (prepare the PCR amplification system on ice).

[0059] Amplification program: Pre-denature at 94 °C for 5 min; denature at 94 °C for 30 s, anneal at 50 °C for 30 s, extend at 72 °C for 50 s, for a total of 35 cycles; extend at 72 °C for 10 min and store at 4 °C.

[0060] 2.3 Gel electrophoresis detection method for DNA detection: Use 1% agarose gel electrophoresis to detect the amplification results.

[0061] Place the gel-making tank flat and insert the comb and the gel plate;

[0062] Weigh an appropriate amount of 0.2 g of agarose, add 20 mL of 1×TAE buffer to an Erlenmeyer flask, shake well, place it in a microwave oven and heat for 1 min. After the colloid becomes transparent, remove it and shake well.

[0063] When the gel cools to about 65 °C, add 2 μL of nucleic acid dye. After mixing, pour the gel into the gel casting tray. After the gel has completely solidified, carefully remove the comb and the gel plate:

[0064] Place the gel in the electrophoresis tank with the gel wells facing the negative electrode, and add electrophoresis buffer (1×TAE) until it just covers the gel surface by about 1 mm;

[0065] Take 5 μL of the PCR product, mix well and add it to the gel wells with a pipette (direct loading and marker). The marker used is DL2000;

[0066] Output voltage is 180 V, current is 150 mA, and electrophoresis is carried out for 25 min;

[0067] After electrophoresis, take out the gel from the electrophoresis tank, place it in a gel imaging system for photographing, saving, and recording the results. Entrust the successfully amplified PCR products to a biotechnology company for sequencing.

[0068] After sequencing, perform sequence alignment on the NCBI website (https: / / www.ncbi.nlm.nih.gov / ).

[0069] 3. Morphological identification.

[0070] Softening: Take out the Frankliniella intonsa specimens placed in the buffer and soak them in 10% NaOH solution for 5 h.

[0071] Take out the Frankliniella intonsa and soak it in distilled water for 12 h to discharge the substances in the body.

[0072] Washing: Wash once in distilled water.

[0073] Soak in 10% glacial acetic acid for 3 min.

[0074] Washing: Wash with distilled water.

[0075] Dehydration: Soak successively in ethanol solutions with mass fractions of 35%, 50%, 70%, 85%, 90%, and 95%, and absolute ethanol for 2 min each, dehydrating step by step from low concentration to high concentration.

[0076] Mounting: Wipe the glass slide clean with lens paper, place the specimen on it, and quickly arrange the specimen morphology (antennae, front legs extended forward, middle and hind legs extended backward) in the presence of absolute ethanol.

[0077] Mounting medium: Drop a drop of Canada balsam to completely cover the Frankliniella intonsa. Wipe off the excess balsam at the edges and corners with xylene and dishwashing liquid after drying the glass slide.

[0078] Cover slip: Cover it with a clean round cover slip.

[0079] Attach a label.

[0080] Drying: Place it in an oven at 40 °C for 48 h.

[0081] Examine under a microscope after drying.

[0082] Example 2

[0083] A method for identifying Frankliniella intonsa, which is different from Example 1 in that the annealing temperature in the PCR amplification program is 45 °C.

[0084] Example 3

[0085] Identification of Frankliniella intonsa.

[0086] Adopt the method of Example 1 to collect Frankliniella intonsa in the sunflower field in Balin Left Banner, Chifeng City, Inner Mongolia for identification.

[0087] Select 48 of the collected Frankliniella intonsa for molecular biology identification. The electrophoresis pattern of the ITS sequence is as Figure 1 shown. The presence of an amplification band at 500 bp indicates successful amplification. The electrophoresis pattern of the COI sequence of the above 48 Frankliniella intonsa is as Figure 2 shown. The presence of an amplification band at 700 bp indicates successful amplification. Send the PCR products with successful amplification of both the ITS sequence and the COI sequence for sequencing, and compare the sequencing results on NCBI.

[0088] Samples numbered 2, 6, 9, 13, 15, 16, 20, 21, 22, 23, 24, 25, 26, 27, 29, 31, 32, 34, 38, 39, 40, 41, 42, 44, 48 are determined to be Frankliniella intonsa by sequencing. Take the specimens prepared from them for morphological identification. The microscopic examination pictures of the Frankliniella intonsa specimens are as Figure 3 shown.

[0089] According to Figure 3It can be seen that the flower thrips is brown in body color, slightly lighter in head and thorax, and the end of the femur of the front leg and the tibia are light brown. The antenna has 8 segments. Segments III, IV, and the basal half of segment V of the antenna are yellow, and the end half is brown, and the rest are brown. The front wings are slightly yellow. The anterior margin line of abdominal segments I-VII is dark brown. The body bristles and wing bristles are dark brown. The ocellar bristles between the ocelli on the head are long and thick, and are located on the connecting line of the centers of the anterior and posterior ocelli. The postocular bristle III is long and thick, almost 1 / 2 of the ocellar bristle between the ocelli. Segments III and IV have forked sensory cones. The maxillary palpus has 3 segments. There are 4 pairs of anterior margin bristles and 5 pairs of posterior margin bristles on the pronotal disc. The median posterior bristles and the posterior margin bristles on the mesothorax are both in front of the posterior margin. The anterior margin bristles on the metathoracic scutum are on the anterior margin, and the anterior median bristles are close to the anterior margin. There are 27 anterior margin bristles, 19 anterior vein bristles, which are evenly arranged, and 15 posterior vein bristles on the front wings. There are spines on the median internal furcula of the mesothorax. There are paired slightly curved combs on abdominal tergites V-VIII, and the comb on the posterior margin of tergite VIII is complete, and the base of the comb hair is slightly triangular. The median pair of bristles on abdominal sternite VII is above the posterior margin.

[0090] Example 4

[0091] Effect of annealing temperature in the amplification program on the amplification result.

[0092] The difference from Example 1 is as follows:

[0093] The primer types are as follows:

[0094] ITS sequence amplification primer (denoted as primer A): SEQ ID NO.1-2.

[0095] COI sequence amplification primer (denoted as primer H): SEQ ID NO.3-4.

[0096] COI sequence amplification primer (primer F):

[0097] LepF1 (SEQ ID NO.5): 5′-ATTCAACCAATCATAAAGATATTGG-3′,

[0098] LepR1 (SEQ ID NO.6): 5′-TAAACTTCTGGATGTCCAAAAAATCA-3′.

[0099] ITS sequence amplification primer (primer P):

[0100] P1 (SEQ ID NO.7): 5'-ATCACTCGGCTCGTGGATCG-3',

[0101] 52R (SEQ ID NO.8): 5'-GTTAGTTTCTTTTCCTCCCCT-3'.

[0102] The annealing temperatures in the amplification program were respectively set to 45°C, 50°C, 55°C, 60°C, 65°C, and 70°C for amplification, and the amplification results are asFigure 4 and Figure 5 as shown

[0103] Figure 4 and Figure 5 In , X1 to X4 represent Frankliniella intonsa adults, and the numbers 1 to 6 respectively refer to 6 annealing temperatures (1: 45 °C, 2: 50 °C, 3: 55 °C, 4: 60 °C, 5: 65 °C, and 6: 70 °C). For example, X3A1 is the DNA extracted from X3 thrips amplified using primer A, and the annealing temperature in the amplification program is 45 °C.

[0104] According to Figure 4 and Figure 5 the results of and , it can be seen that the primers selected in the present invention can amplify the target bands at annealing temperatures of 45 - 50 °C, and the bands are clear and bright.

[0105] Example 5

[0106] Effect of DNA extraction method on amplification results.

[0107] Adult thrips were collected from the sunflower flower disks in the experimental field of the Academy of Agricultural and Animal Husbandry Sciences at No. 22, Zhaojun Road, Hohhot, Inner Mongolia. The following treatments were performed on the thrips.

[0108] Treatment 1: A lysis solution was prepared by mixing 1.5 mL of PBS buffer and 10 μL of proteinase K. 50 μL of the prepared lysis solution was added to each centrifuge tube. The thrips were punctured 3 times on a glass slide, and after puncture, the insect bodies were placed in the lysis solution, centrifuged, and then taken out after being placed in a PCR instrument at 58 °C for 1 h. Amplification was performed using primer H, and the reaction system and amplification program were the same as in Example 1.

[0109] Treatment 2: A lysis solution was prepared by mixing 1.5 mL of PBS buffer and 10 μL of proteinase K. 50 μL of the prepared lysis solution was added to each centrifuge tube. The thrips were punctured 3 times on a glass slide, and after puncture, the insect bodies were placed in the lysis solution, centrifuged, and then taken out after being placed in a PCR instrument at 58 °C for 1 h. PCR was performed using primer H. The PCR system was: 15 μL of 2×TSINGKE MasterMix (Red), 1 μL of each primer, 8 μL of double-distilled water, and 5 μL of DNA template, configured into a 30 μL system, and the amplification program was the same as in Example 1.

[0110] Treatment 3: The DNA extraction method was as follows: Extraction was performed using the TIANamp Genomic DNA (DP304) kit from Tiangen. A single thrips was taken out, and the ethanol was allowed to evaporate completely. The thrips was placed in a centrifuge tube, magnetic beads with a diameter of 0.9 - 2 mm were added, frozen in liquid nitrogen and then ground. After grinding, the magnetic beads were taken out, washed with absolute ethanol, sterilized at 120 °C for 30 min, and after cooling to room temperature, 200 μL of GA solution was added;

[0111] Add 4 μL of RNase A (100 mg / ml) solution, shake for 15 s, and leave at room temperature for 5 min. Add 20 μL of proteinase K to the above centrifuge tube and mix well. Then place the centrifuge tube in a water bath at 58 °C for 3 h (take it out and mix well every 0.5 h) until the tissue dissolves.

[0112] Follow the kit instructions to perform the next steps step by step.

[0113] Extract the DNA and perform amplification using primer H. The reaction system and amplification program are the same as in Example 1.

[0114] Treatment 4: Compared with Treatment 3, in this treatment, transfer the Frankliniella intonsa to a glass slide with 2 μL of GA solution (TIANamp Genomic DNA (DP304) kit from Tiangen Biotech Co., Ltd.). Place the glass slide under a dissecting microscope and adjust it within the field of view. First, use a sterile micro needle (the "00" needle in insect needles) to spread the wings of the Frankliniella intonsa to both sides of the body, and then use the micro needle to pierce the abdomen of the Frankliniella intonsa 3 times. Put the pierced Frankliniella intonsa into a 2 mL centrifuge tube containing 10 μL of extraction solution, then aspirate 40 μL of the extraction solution to rinse the needle and drop it into the centrifuge tube. Then take 48 μL of the extraction solution to rinse back and forth the position where the Frankliniella intonsa was placed on the glass slide, and inhale it into the centrifuge tube together with the original 2 μL of extraction solution. Add 100 μL of buffer GA to make up to 200 μL, and the remaining steps are the same as in Treatment 3.

[0115] Perform gel electrophoresis detection on the products amplified from Treatments 1 to 4 (the method is the same as in Example 1), and the results are as Figure 6 shown, where Treatments 1 and 2 were each repeated twice.

[0116] Figure 6 Lanes 1 and 2 in the figure are the detection results of Treatment 1, lanes 3 and 4 are the detection results of Treatment 2, lane 5 is the detection result of Treatment 3, and lane 6 is the detection result of Treatment 4. No bands appeared in the above gel electrophoresis, indicating that the DNA extraction was not successful, or the extracted DNA was not sufficient to enable successful amplification, and there was no sequence available for sequencing.

[0117] The above is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made, and these improvements and refinements should also be regarded as the protection scope of the present invention.

Claims

1. A method for identifying flower thrips, characterized in that: The steps include: Use a microneedle to puncture the second to eighth segments of the abdomen of the flower thrips. Place the punctured flower thrips in a buffer solution, add proteinase K solution, perform the first centrifugation, and then incubate at 37°C for 30 minutes, and then denature at 95°C for 7 minutes. After the second centrifugation, take the supernatant to amplify the ITS sequence and COI sequence respectively.

2. The identification method according to claim 1, characterized in that: The microneedle is a No. 00 insect needle, and the number of punctures is 1 to 3 times.

3. The identification method according to claim 1, characterized in that: The buffer solution is 100 mmol / L NaCl+10 mmol / L Tris-HCl+1 mmol / LEDTA, pH 8.

0.

4. The identification method according to claim 1, characterized in that: The ratio of flower thrips, buffer and proteinase K solution is 1 head: 50 μL: 4 μL; the concentration of the proteinase K solution is 10 mg / mL.

5. The identification method according to claim 1, characterized in that: The amplification procedures for ITS sequence and COI sequence were both as follows: pre-denaturation at 94°C for 5 min; denaturation at 94°C for 30 s, annealing at 45-50°C for 30 s, and extension at 72°C for 50 s, for a total of 35 cycles; and extension at 72°C for 10 min.

6. The identification method according to claim 1, characterized in that: The nucleotide sequences of the upstream and downstream primers used for amplifying the ITS sequence are shown in SEQ ID NOs. 1-2, and the nucleotide sequences of the upstream and downstream primers used for amplifying the COI sequence are shown in SEQ ID NOs. 3-4.

7. The identification method according to claim 1, characterized in that: The ITS sequence amplification reaction system and the COI sequence amplification reaction system were: 5 μL DNA template, 25 μL 2×EasyTaqPCR SuperMix, 1 μL each of upstream and downstream primers, and 18 μL sterile double distilled water.

8. The identification method according to claim 1, characterized in that: After the amplification of the ITS sequence and the COI sequence is completed, the amplified products are subjected to agarose gel electrophoresis respectively: if a 500 bp band appears in the electrophoresis spectrum of the ITS sequence amplified product and a 700 bp band appears in the electrophoresis spectrum of the COI sequence amplified product, the amplified products are sequenced.

9. The identification method according to claim 1, characterized in that: After the second centrifugation, the flower thrips in the buffer were taken out for morphological identification.

10. The identification method according to claim 9, characterized in that: The morphological identification comprises the following steps: Soak the flower thrips in a 10% NaOH solution to soften it. After softening, soak the flower thrips in water to expel substances from the body. Then soak the flower thrips in 10% glacial acetic acid. After washing, dehydrate the flower thrips, place them on a glass slide, arrange the specimen morphology, drop glue on the flower thrips, cover them with a coverslip, and examine them under a microscope after drying.

Images