Primer, probe and kit for simultaneously detecting bovine herpesvirus type 1 and bovine herpesvirus type 4

Abstract

A primer, a probe and a kit for simultaneously detecting bovine herpesvirus type 1 and bovine herpesvirus type 4 comprise a specific primer and a probe, and the specific primer is as follows: BoHV-1 / gL / F; boHV-1 / gL / R; boHV-4 / gL / F; boHV-4 / gL / R; the probe is as follows: BoHV-1 / gL Probe; and the probe is BoHV-4 / gL Probe. The invention successfully develops a special primer, a probe and a matched kit capable of synchronously detecting the bovine herpesvirus type 1 (BoHV-1) and the bovine herpesvirus type 4 (BoHV-4), and the kit has remarkable advantages in the aspects of simplicity and convenience in operation, specificity, sensitivity, repeatability and dual detection capability.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and particularly relates to a primer, a probe and a kit for simultaneously detecting bovine herpesvirus types 1 and 4. Background Art

[0002] Bovine herpesvirus type 1 (BoHV-1) is an important pathogen causing bovine respiratory diseases, conjunctivitis, abortion and reproductive tract diseases. Its prevention and control methods are limited, mainly relying on purification measures to reduce the infection risk. This virus can cause latent infections in cattle, and infected cattle often show typical symptoms such as loss of appetite, listlessness, decreased milk production and immunosuppression. In addition, BoHV-1 can also induce secondary bacterial infections, thereby triggering bovine respiratory disease syndrome (BRD), posing a major economic threat to the global cattle industry. Bovine infectious rhinotracheitis caused by BoHV-1 has been classified as a Class B disease by the World Health Organization, and it is also listed as a second-class disease in China. According to statistics, the annual economic loss caused by BRD in the United States is nearly 100 million US dollars, and the prevention and treatment costs exceed 300 million US dollars (Griffin et al., 1997). To address this challenge, many European countries have included bovine infectious rhinotracheitis in their eradication programs, and countries such as Germany, Denmark, Finland and Norway have successfully achieved the eradication of IBR (Iscaro et al., 2021). Since BoHV-1 was discovered in China, the virus has been widely distributed in all provinces and cities across the country. With the development of intensive farming models, BoHV-1 has become a key respiratory disease pathogen threatening the health of cattle herds.

[0003] In terms of diagnosis, the detection of BoHV-1 is crucial for disease prevention and control. Currently, the diagnostic methods for BoHV-1 mainly include etiological diagnosis, serological diagnosis and molecular biological diagnosis. Although the results of etiological diagnosis are reliable, the operation is complex, time-consuming, and requires professional equipment and experienced operators. In particular, the virus isolation from latently infected animals is particularly difficult. In contrast, although serological diagnoses such as neutralization tests and ELISA perform well in antibody detection, the neutralization test has gradually withdrawn from the clinical diagnosis stage due to its cumbersome operation and low throughput. Although ELISA has been widely used, it relies on specific monoclonal antibodies, with high upfront R & D costs and long cycles. Therefore, molecular biological methods, especially polymerase chain reaction (PCR) and deoxyribonucleic acid hybridization techniques, have become the preferred methods in the current diagnostic field due to their advantages such as fast detection speed, high accuracy and strong specificity.

[0004] On the other hand, Bovine herpesvirus 4 (BoHV-4), a newly discovered pathogen in China, belongs to the genus Varicellovirus and is mainly associated with bovine reproductive system diseases. This virus mostly causes latent infections. When co-infected with other pathogens, the clinical symptoms are exacerbated and diversified, posing great challenges to diagnosis and treatment. BoHV-4 infection can lead to severe clinical manifestations such as low conception rate, breeding disorders, habitual abortion, postpartum uterine damage, endometritis, and vulvovaginal herpes (Chastant-Maillard, 2015). Since the infection of this virus is mostly latent and the clinical manifestations are diverse, laboratory detection has become the key to diagnosis. However, the isolation and identification of BoHV-4 are difficult. Although PCR detection has been applied to the detection of milk samples, there are still problems of non-specific amplification (Wellenberg et al., 2001). At the same time, the antibody detection of BoHV-4 also faces challenges such as low sensitivity and lack of neutralizing antibodies, restricting the application of existing serological diagnostic methods.

[0005] In view of the severe harm of BoHV-1 and BoHV-4 to cattle herds and the limitations of current diagnostic methods, this study aims to develop a fluorescence quantitative PCR detection method that can simultaneously detect these two pathogens. This method will provide a rapid, accurate, and sensitive detection means for the diagnosis of pathogens and epidemiological monitoring in cattle herds, and is of great significance for ensuring the healthy development of the cattle industry. Summary of the Invention

[0006] Technical problems to be solved: Aiming at the deficiencies in the above-mentioned prior art, the present invention provides a dual fluorescence quantitative PCR primer, probe, and kit for detecting Bovine herpesvirus 1 and 4. By analyzing the genomic information of Bovine herpesvirus 1 and 4, specific primers and probes are designed. Through continuous optimization of the reaction system and reaction procedure, a sensitive, accurate, and rapid dual real-time fluorescence quantitative PCR detection method for Bovine herpesvirus 1 and 4 is provided, filling the gap in the current detection methods for Bovine herpesvirus 1 and 4, and providing technical support for the diagnosis of pathogens and epidemic detection in cattle herds.

[0007] Technical solution: A dual fluorescence quantitative PCR primer set for detecting Bovine herpesvirus 1 and 4, including specific primers and probes. The sequences of the specific primers are as follows:

[0008] BoHV-1 / gL / F: 5’-CGAAGGCGCTATTGAGGACT-3’;

[0009] BoHV-1 / gL / R: 5’-CGCTGAAGATATAAGGCGGGT-3’;

[0010] BoHV-4 / gL / F: 5’-TGACTCGTTGATGCTTTCTCAT-3’;

[0011] BoHV-4 / gL / R: 5’-TTCCTTCTGTGTTTAACCTATCAG-3’;

[0012] The sequences of the said probes are as follows:

[0013] BoHV-1 / gL Probe: 5’-TCTCGATACACTGGAGTGTCGGCAAGC-3’;

[0014] BoHV-4 / gL Probe: 5’-CCCCCTACAATTGGAATGTGCTGTGGT-3’.

[0015] Preferably, a fluorescent group is connected to the 5’ end of the above probe sequence, and a quenching group is connected to the 3’ end.

[0016] Preferably, the above fluorescent group is FAM or VIC; the quenching group is BHQ1.

[0017] The application of the above PCR primer set in the preparation of reagents or kits for detecting bovine herpesvirus 1 and 4.

[0018] A kit for detecting bovine herpesvirus 1 and 4, comprising the above dual fluorescence quantitative PCR primer set.

[0019] Preferably, the above kit also contains fluorescence quantitative PCR reagents, positive control and negative control.

[0020] The above fluorescence quantitative PCR reagent is a fluorescence PCR enzyme reaction solution, the positive control is an equal proportion mixture of 2 kinds of bovine herpesvirus nucleic acid positive sensitive quality control samples, and the negative control is cDNA extracted with ddH2O.

[0021] The concentration of the above specific primers is 100 μmol / mL, and the concentration of the probe is 100 μmol / mL.

[0022] Beneficial effects: The present invention has successfully developed a special primer, probe and supporting kit for simultaneously detecting bovine herpesvirus type 1 (BoHV-1) and type 4 (BoHV-4). The kit shows significant advantages in terms of simplicity of operation, specificity, sensitivity, repeatability and dual detection ability. Through the carefully designed primer and probe sequences, the kit can accurately identify and amplify specific gene fragments of BoHV-1 and BoHV-4, effectively avoiding interference from non-target pathogens and ensuring the accuracy of the detection results. At the same time, by adopting the advanced fluorescence quantitative PCR technology, the kit can achieve efficient detection of extremely low concentrations of the virus, and can accurately identify even at the early infection stage with a low virus load. In addition, the kit is easy to operate, and users can complete the detection process with only simple operations, and shows stable detection results under different batches, operators and experimental conditions, ensuring the reliability and consistency of the data. Most importantly, the kit innovatively realizes the simultaneous qualitative and accurate quantification of BoHV-1 and BoHV-4, providing strong technical support for the prevention and control of bovine herpesvirus, and is of extremely important significance for ensuring the healthy development of the cattle industry. Description of the Drawings

[0023] Figure 1 It is the annealing temperature amplification curve graph in Example 2 provided by the present invention, where a: BoHV-1 annealing curve, b: BoHV-4 annealing curve.

[0024] Figure 2 It is the standard curve graph of dual fluorescence quantitative PCR BoHV-1 and BoHV-4 in Example 3 provided by the present invention.

[0025] Figure 3 It is the specific detection result graph in Example 4 provided by the present invention, where 1: BoHV-4 amplification curve, 2: BOHV-1 amplification curve. Detailed Embodiments

[0026] Next, the technical solutions in the embodiments of the present invention will be clearly and completely described in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention.

[0027] The embodiments of the present invention disclose a primer, a probe and a kit for simultaneously detecting bovine herpesvirus types 1 and 4.

[0028] The present invention will be further elaborated in detail below in conjunction with the accompanying drawings of the specification and specific embodiments. The embodiments are only used to explain the present invention and are not intended to limit the scope of the present invention. The test methods used in the following embodiments are all conventional methods unless otherwise specified; the materials, reagents, etc. used are all reagents and materials that can be obtained from commercial channels unless otherwise specified. Bovine herpesvirus type 1 virus (BoHV-1 ZJ01 strain) was donated by Zhejiang Academy of Agricultural Sciences. Bovine herpesvirus type 4 virus was isolated from vaginal swab specimens of a ranch in Anhui by this laboratory; 2 kinds of bovine herpesvirus nucleic acid positive sensitivity control samples (BoHV-1 / QC / DNA and BoHV-4 / QC / DNA), 5 kinds of bovine herpesvirus nucleic acid specific control samples (PRV / QC / DNA, BEFV / QC / RNA, BRSV / QC / RNA, BVDV / QC / RNA, MB / QC / DNA), and 2 kinds of bovine herpesvirus nucleic acid negative control samples (N1, N2) were all developed, produced and supplied by Qingdao Lijian Biotechnology Co., Ltd. The samples used in the clinical sample verification test came from multiple regions and ranches across the country and included various samples such as bovine respiratory tract-related tissues, bovine blood samples, respiratory swabs, and vaginal swabs.

[0029] Example 1 Preparation of Primers and Probes

[0030] The gB and gL target gene sequences of BoHV-1 and BHV-4 were downloaded through GENEBANK, and sequence alignment was performed using MEGALIGN-X. The candidate target genes (gB, gL) of 10 strains of bovine herpesvirus type 1 and 14 strains of bovine herpesvirus type 4 were aligned. Regions with conserved sequences and high homology were selected, and corresponding primers and probes were designed using Oligo 7 software. Primers and probes were designed for the corresponding conserved target sequences, and the mutual influence (formation of hairpin structures and dimers) between primers and primers, primers and probes, and probes was analyzed through primer select. Finally, primer and probe sequences targeting the conserved sequences on the gL gene fragments of BoHV-1 and BoHV-4 were screened out for the establishment of a duplex fluorescence PCR method for bovine herpesviruses type 1 and 4. The specific primer and probe sequences are shown in Table 1:

[0031] Table 1 Primer and Probe Sequences

[0032] Name Nucleotide number Sequence (5'-3') BHV1-F SEQ ID NO:1 CGAAGGCGCTATTGAGGACT, as shown in SEQ ID NO:1 BHV1-R SEQ ID NO:2 CGCTGAAGATATAAGGCGGGT, as shown in SEQ ID NO:2 BHV1-P SEQ ID NO:3 TCTCGATACACTGGAGTGTCGGCAAGC, as shown in SEQ ID NO:3 BHV4-F SEQ ID NO:4 TGACTCGTTGATGCTTTCTCAT, as shown in SEQ ID NO:4 BHV4-R SEQ ID NO:5 TTCCTTCTGTGTTTAACCTATCAG, as shown in SEQ ID NO:5 BHV4-P SEQ ID NO:6 CCCCCTACAATTGGAATGTGCTGTGGT, as shown in SEQ ID NO:6

[0033] Example 2 Optimization of the Reaction System

[0034] 1) Optimization of primer-probe concentration: Select the best primer-probe combination and optimize it in a pairwise combination manner according to the ratios of upstream and downstream primers to probes of BoHV-1 being 2:2:1 and 1:1:1 respectively, and those of BoHV-4 being 2:2:1 and 1:1:1 respectively. The concentration configuration of the reaction system is shown in Table 2-1, and the reaction program is as follows: Incubate at 37°C for 2 minutes; pre-denature at 95°C for 30 seconds; denature at 95°C for 10 seconds, anneal and extend at 60°C for 30 seconds, for 40 cycles, and collect FAM and VIC fluorescence signals at 60°C (FAM channel for BoHV-1 and VIC channel for BoHV-4). Analyze the detection Ct values and amplification curves of each group of primer-probes, and select the working concentrations of primers and probes with the smallest detection Ct value and the most typical amplification curve as the optimal working concentrations. The results are shown in Table 2-2 and Table 2-3.

[0035] According to the test results, there is no mutual interference in the FAM and VIC channels detected by the reaction solutions with 4 concentration ratios, that is, the blank controls are all negative. The reaction solutions with 4 concentration ratios can all detect BoHV-1 in the sensitive quality control sample at 10 -4 , but the detection Ct value of the reaction solution with concentration 1 for the sensitive quality control sample BoHV-1 / QC / DNA is about 0.5 smaller than those of concentrations 2, 3, and 4. There is no significant difference in the detection Ct values of the reaction solutions with 4 concentration ratios for the sensitive quality control sample BoHV-4 / QC / DNA. Additionally, from the aspect of amplification curves, the amplification curves of the two sensitive quality control samples detected at 4 concentrations are all typically S-shaped. Based on the above description, the final determination is that concentration 1 is the optimal concentration: the final concentration of the upstream and downstream primers is 0.4 μmol / μL, and the final concentration of the probe is 0.2 μmol / μL.

[0036] Table 2-1 Configuration of the reaction solution system

[0037]

[0038] Table 2-2 Optimization of BoHV-1 primer-probe concentration

[0039]

[0040] Table 2-3 Optimization of BoHV-4 primer-probe concentration

[0041]

[0042] 2) Optimization of annealing temperature: Select the optimized primer-probe combination and the determined primer-probe concentration. Prepare a system with 20 μL of reaction solution + 5 μL of nucleic acid template. The reaction program is as follows: Incubate at 37 °C for 2 minutes; pre-denature at 95 °C for 30 seconds; denature at 95 °C for 10 seconds, set 8 temperature gradients within the temperature range of 56 - 66 °C, anneal and extend for 30 seconds, for 40 cycles, collect FAM and VIC fluorescence signals at 60 °C (FAM channel for BoHV-1 and VIC channel for BoHV-4), and select the annealing temperature with the minimum CT value and the most typical amplification curve. According to the experimental results analysis: When the temperature is 60 °C, the Ct values corresponding to different dilutions show relatively good gradient, and the Ct values are relatively small. Therefore, the annealing temperature of this fluorescence PCR system is determined to be 60 °C, and the results are as shown in Figure 1 .

[0043] 3) Optimization of extension time: Select the optimized primer-probe combination and the determined primer-probe concentration. Prepare a system with 20 μL of reaction solution + 5 μL of nucleic acid template. The reaction program is as follows: Incubate at 37 °C for 2 minutes; pre-denature at 95 °C for 30 seconds; denature at 95 °C for 10 seconds, at the determined annealing temperature, set the annealing extension time to 20 seconds, 30 seconds, and 60 seconds, for 40 cycles, collect FAM and VIC fluorescence signals at 60 °C (FAM channel for BoHV-1 and VIC channel for BoHV-4), and select the extension time with the minimum CT value and the most typical amplification curve. The results are shown in Table 3. According to the results analysis: When the extension time is 30 seconds and 60 seconds, 1 Ct value is detected at the 10 4 dilution of the sensitive quality control sample BoHV-1 / QC / DNA, and the detected Ct values are relatively consistent; for the 3 extension times, the 10 3 dilution of the sensitive quality control sample BoHV-4 / QC / DNA can be stably detected, and the detected Ct values are relatively consistent. Therefore, the extension time is determined to be 30 seconds.

[0044] Table 3 Extension time of BoHV-1 and BoHV-4

[0045]

[0046] Example 3 Qualitative and quantitative detection method for simultaneously detecting bovine herpesvirus type 1 and bovine herpesvirus type 4 based on the kit provided in the example

[0047] 1) Establishment of standard curve

[0048] Select the nucleic acid standard quality control samples of BoHV-1 and BoHV-4, and perform digital PCR detection using the QIAcuity TM Probe PCR Kit. Calculate the copy number of BoHV-1 as 4.13×10 3Copies / μL, the copy number of BoHV-4 is 2.27×10 3 Copies / μL (the fixed value data is from Qingdao Lijian Biotechnology Co., Ltd.). Dilute the two quality control products by 10 times, 100 times, and 1000 times respectively. Take the CT value as the ordinate and lg(10 n ) as the abscissa to draw a standard curve, and calculate the slope amplification efficiency, R2 value, and standard curve equation. The real-time fluorescence quantitative PCR amplification curves of the nucleic acid standard quality control samples of BoHV-1 and BoHV-4 are as Figure 2 shown.

[0049] From Figure 2 it can be obtained that the standard curve equation of BoHV-1 is: Y = 37.41 - 3.32×X, and the standard curve equation of BoHV-4 is: Y = 37.25 - 3.37×X. The correlation coefficient (R2) is 0.99 for both, and the amplification efficiencies (E) are 100% and 98% respectively. This indicates that the detection method established in the present invention has a good linear relationship.

[0050] 2) Sample processing

[0051] Use an automatic nucleic acid extractor to extract nucleic acid. It is recommended to detect the extracted nucleic acid immediately. Otherwise, store it at -20°C or below.

[0052] Nucleic acid amplification: After centrifuging the dual primer-probe and fluorescent PCR enzyme reaction solution (probe method) of bovine herpesvirus types 1 and 4 instantaneously, transfer all the fluorescent PCR enzyme reaction solution to the primer-probe, invert and mix 6 times to mix well, and prepare the PCR reaction solution. Add 20 μL of the PCR reaction solution to each PCR reaction tube according to the number of test samples; first take 5 μL of the negative control, then take 5 μL of the DNA to be tested, and finally take 5 μL of the positive control (mix well) and add them to different PCR reaction tubes respectively. After adding the samples, tighten the PCR reaction tubes. The volume of the liquid in each PCR reaction tube is 25 μL. After adding the samples, centrifuge the PCR reaction tubes instantaneously, and then place them in a fluorescent PCR instrument for the following reaction: Incubate at 37°C for 2 min; pre-denature at 95°C for 20 s; then denature at 95°C for 10 s and collect fluorescence at 60°C for 30 s, for a total of 40 cycles.

[0053] 3) Detection result determination criteria:

[0054] Use the obtained CT value or the change in fluorescence signal to achieve qualitative detection of BoHV-1 and BoHV-4. The appearance of a standard "S"-shaped amplification curve in different fluorescence channels indicates that the test sample contains BoHV-1 and / or BoHV-4 virus. Then, according to the intensity of the fluorescence signal and the standard curve provided above, obtain the copy number of BoHV-1 and / or BoHV-4 virus contained in the test sample to achieve quantitative detection.

[0055] Specific determination method:

[0056] Under the FAM signal pathway, when the amplification result of the sample has a specific curve and the Ct value < 38, it can be determined as positive for bovine herpesvirus 1 nucleic acid; when the amplification result of the sample has no specific amplification curve or no Ct value, it can be determined as negative for bovine herpesvirus 1 nucleic acid; when the amplification result of the sample has a specific curve and 38 ≤ Ct value ≤ 40, it can be preliminarily determined as suspicious for bovine herpesvirus 1 nucleic acid. Samples initially determined to be suspicious can be retested. If the Ct value of the retest ≤ 40 and a specific amplification curve appears, it is finally determined as positive for bovine herpesvirus 1 nucleic acid; when the amplification result has no Ct value or no specific amplification curve, it is finally determined as negative for bovine herpesvirus 1 nucleic acid.

[0057] Under the VIC signal pathway, when the amplification result of the sample has a specific curve and the Ct value < 38, it can be determined as positive for bovine herpesvirus 4 nucleic acid; when the amplification result of the sample has no specific amplification curve or no Ct value, it can be determined as negative for bovine herpesvirus 4 nucleic acid; when the amplification result of the sample has a specific curve and 38 ≤ Ct value ≤ 40, it can be preliminarily determined as suspicious for bovine herpesvirus 4 nucleic acid. Samples initially determined to be suspicious can be retested. If the Ct value of the retest ≤ 40 and a specific amplification curve appears, it is finally determined as positive for bovine herpesvirus 4 nucleic acid; when the amplification result has no Ct value or no specific amplification curve, it is finally determined as negative for bovine herpesvirus 4 nucleic acid.

[0058] Example 4 Specificity test

[0059] Using the positive nucleic acids of bovine herpesvirus 1 and 4, porcine pseudorabies virus, bovine ephemeral fever virus, bovine respiratory syncytial virus, bovine viral diarrhea virus nucleic acid, and bovine mycoplasma positive nucleic acid as templates, with ddH2O as the negative control, amplified by the dual fluorescence quantitative PCR method established in this study to evaluate the specificity of this method. The experimental results are as Figure 3 shown.

[0060] From Figure 3 it can be seen that except for the positive nucleic acids of BoHV-1 and BoHV-4 which produced amplification curves, the nucleic acids of other viruses did not produce amplification curves, indicating that the established dual fluorescence quantitative PCR method has good specificity.

[0061] Example 5 Sensitivity test

[0062] After extracting nucleic acids from the bovine herpesvirus nucleic acid positive sensitivity control samples BoHV-1 / QC / DNA and BoHV-4 / QC / DNA, they were serially diluted 10-fold with DEPC water (10 1 -10 4)As a template, eight replicates of each quality control sample were used to perform amplification with the established fluorescence quantitative method, and the Ct values of the fluorescence PCR reactions were calculated. When the Ct value < 38, it was determined as positive, and the sensitivity of the method for detecting positive quality control samples was evaluated.

[0063] The experimental results showed that the minimum detection limits for the two nucleic acid standards of BoHV-1 and BoHV-4 were 4.13 copies / μL and 2.27 copies / μL respectively, indicating that the method had high sensitivity.

[0064] Example 6 Repeatability test

[0065] Sensitive quality control samples BoHV-1 / QC / DNA and BoHV-4 / QC / DNA nucleic acids were taken and diluted 10-fold and 100-fold with DEPC-treated water respectively as templates. Eight replicates were made for each dilution as within-batch repeats. Under the same reaction conditions at different times, three people simultaneously amplified the sensitive quality control samples at the above dilutions by this fluorescence quantitative method. Eight replicates were made for each dilution as between-batch repeat tests. At the same time, water was used as the negative control. The average CT value, standard deviation and coefficient of variation were calculated according to the results to verify the repeatability of the established method. The experimental results are shown in Tables 4-1 to 4-6.

[0066] The results showed that the coefficient of variation (CV) of BoHV-1 and BoHV-4 at each concentration was less than 1.5%, indicating that the established duplex fluorescence quantitative PCR method had good repeatability.

[0067] Table 4-1 Repeatability test results of BoHV-1 at the original concentration

[0068]

[0069] Table 4-2 Repeatability test results of BoHV-1 diluted 10-fold

[0070]

[0071] Table 4-3 Repeatability test results of BoHV-1 diluted 100-fold

[0072]

[0073] Table 4-4 Repeatability test results of BoHV-4 at the original concentration

[0074]

[0075] Table 4-5 Repeatability test results of BoHV-4 diluted 10-fold

[0076]

[0077] Table 4-6 Results of the repeatability test when BoHV-4 was diluted 100 times

[0078]

[0079] Example 7 Detection of clinical samples

[0080] Forty clinical samples of BoHV-1 and BoHV-4 each, as well as twenty samples each that were negative for both BoHV-1 and BoHV-4, sent to this laboratory from multiple ranches across the country were processed. After sample processing, nucleic acids were extracted using an automatic nucleic acid extractor, and the dual fluorescence quantitative PCR method established in this study was used for detection. At the same time, the current diagnostic criteria of "Quarantine Technical Specifications for Infectious Bovine Rhinotracheitis" (etal., 2011) and the detection method of BoHV-4 established in Russia (Nef edchenko et al., 2019) were used for detection. Standard quality control products were used as positive controls, and two nucleic acid negative samples (N1 and N2) prepared by Qingdao Lijian Biotechnology Co., Ltd. were used as negative controls to compare the coincidence rate with the method of this study. The experimental results are shown in Table 5. The results show that the coincidence rates of the method established in this study with the national standard method and the method established in Russia are both 100%.

[0081] Table 5

[0082]

[0083] The above detection results show that the present invention designs specific primer-probes based on the conserved sequence regions of the conserved genes of bovine herpesvirus types 1 and 4. Through the optimization of the primer-probe concentration, annealing temperature, and extension time, the optimal PCR reaction system and reaction program are obtained, and a real-time fluorescence PCR detection method is constructed based on them. It does not produce non-specific bands during the amplification of porcine pseudorabies virus, bovine epizootic fever virus, bovine respiratory syncytial virus, bovine virus diarrhea virus, and Mycoplasma bovis, and has high sensitivity and good repeatability, meeting the needs of daily detection. It fills the defects of the current detection methods for bovine herpesvirus types 1 and 4, and has important significance for the detection and prevention and control of bovine pathogens.

[0084] Finally, it should be noted that the above specific embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to the examples, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the spirit and scope of the technical solutions of the present invention, and they should all be covered within the scope of the claims of the present invention.

Claims

1. A dual fluorescence quantitative PCR primer set for detecting bovine herpesvirus type 1 and 4, characterized in that: It includes specific primers and probes, and the sequences of the specific primers are as follows: BoHV- 1 / gL / F: 5'-CGAAGGCGCTATTGAGGACT-3'; BoHV- 1 / gL / R: 5'-CGCTGAAGATATAAGGCGGGT-3'; BoHV-4 / gL / F: 5'-TGACTCGTTGATGCTTTCTCAT-3'; BoHV-4 / gL / R: 5'-TTCCTTCTGTGTTTAACCTATCAG-3'; The sequence of the probe is as follows: BoHV- 1 / gL Probe: 5'-TCTCGATACACTGGAGTGTCGGCAAGC-3'; BoHV-4 / gL Probe: 5'-CCCCCTACAATTGGAATGTGCTGTGGT-3'.

2. The dual fluorescence quantitative PCR primer set for detecting bovine herpesvirus type 1 and 4 according to claim 1, characterized in that: The 5' end of the probe sequence is connected to a fluorescent group, and the 3' end is connected to a quenching group.

3. The dual fluorescence quantitative PCR primer set for detecting bovine herpesvirus type 1 and 4 according to claim 2, characterized in that: The fluorescent group is FAM or VIC; the quenching group is BHQ1.

4. Use of the PCR primer set according to any one of claims 1 to 3 in the preparation of a reagent or kit for detecting bovine herpesvirus type 1 or 4.

5. A kit for detecting bovine herpesvirus type 1 and 4, characterized in that: The invention comprises the dual fluorescence quantitative PCR primer set according to any one of claims 1 to 3.

6. The kit according to claim 5, characterized in that It also contains fluorescent quantitative PCR reagents, positive controls and negative controls.

7. The kit according to claim 6, characterized in that The fluorescent quantitative PCR reagent is a fluorescent PCR enzyme reaction solution, the positive control is an equal proportion mixture of two bovine herpes virus nucleic acid positive sensitivity quality control samples, and the negative control is cDNA extracted with ddH2O.

8. The kit according to claim 6, characterized in that The concentration of the specific primers was 100 μmol / mL, and the concentration of the probe was 100 μmol / mL.

Images