Breast milk oligosaccharide for improving intestinal flora environment and regulating short-chain fatty acid under constipation condition and application
By supplementing 6’-sialic acid lactose in the constipation body, the intestinal flora environment is solved, and the problem of improving constipation status is significantly improved.
Patent Information
- Application Number
- CN202510703329.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-29
- Publication Date
- 2025-07-01
- Estimated Expiration
- 2045-05-29
AI Technical Summary
In the prior art, the regulatory effect of breast milk oligosaccharides in intestinal flora in the case of constipation has rarely been reported, which makes it difficult to effectively relieve constipation.
By supplementing a certain amount of 6’-sialic acid lactose in the constipation body, the intestinal flora environment is regulated, the short-chain fatty acid content is improved, the intestinal peristalsis ability and flora diversity is improved, and the SCF/C-kit signaling pathway is regulated.
Significantly improve constipation, improve fecal moisture content, enhance intestinal peristalsis ability, restore short-chain fatty acid content in the intestine, regulate the structure of intestinal flora, improve the abundance and diversity of intestinal flora, maintain the balance of flora, and inhibit the growth of harmful bacteria.
Smart Images

Figure CN120226772A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to breast milk oligosaccharides for improving the intestinal flora environment and regulating short-chain fatty acids under constipation conditions and applications thereof, belonging to the field of food. Background Art
[0002] Constipation is a common gastrointestinal disease in infants, children and adults. Constipation can be divided into functional constipation and organic constipation according to the presence or absence of organic lesions. Functional constipation (FC) is a functional bowel disease with reduced defecation frequency, changes in stool characteristics, difficulty in defecation, abdominal discomfort, and a feeling of incomplete defecation as the main clinical features. Slow transit constipation (STC) is the most common type of functional constipation. The incidence of functional constipation in children accounts for more than 90% of childhood constipation. Long-term and repeated constipation in children can lead to intestinal dysfunction, decreased appetite, nutritional absorption disorders, mental abnormalities, and reduced immunity, such as affecting children's memory and intellectual development, and even causing enuresis and incontinence, which seriously affect children's growth and development and physical and mental health. If childhood constipation is not effectively treated, some of these children will suffer from other digestive system diseases in adulthood, which seriously affects their quality of life.
[0003] There is a complex relationship between constipation and intestinal flora, and there are significant differences between the intestinal flora of patients with constipation and healthy people. Studies have found that the abundance of certain genera such as Coprobacillus, Hungatella, Holdemanella, and Anaerostipes in the intestines of patients with constipation has increased significantly, while the abundance of genera such as Megasphaera, Paraprevotella, Prevotella, and Enterococcus has decreased. In addition, the diversity of intestinal flora in patients with constipation is usually lower than that in healthy people. In addition, intestinal flora affects intestinal function by producing metabolites such as short-chain fatty acids (SCFA). SCFA can increase fecal water content and colon contractility, reduce colon transit time, and thus relieve constipation. Intestinal flora can also indirectly affect the motility and secretory function of the intestine by regulating the host's immune system. Dysbiosis may lead to abnormal intestinal immune function, thereby affecting the normal function of the intestine.
[0004] Human milk oligosaccharides (HMOs) are the third most abundant nutrient in human milk after lactose and fat. The content of HMOs is the highest in colostrum, approximately 20 - 25 g / L, and about 5 - 20 g / L in mature milk. HMOs are mainly lactose-derived oligosaccharides composed of five basic sugar units: glucose (Glc), sialic acid (SA), fucose (Fuc), N-acetylglucosamine (GlcNAc), and galactose (Gal). Different HMOs show different fucosylation and sialylation in their structures, so HMOs in human milk can be classified into: (1) neutral fucosylated HMOs, such as 2'-fucosyllactose (2'-FL) and 3-fucosyllactose (3-FL); (2) neutral non-fucosylated HMOs, such as lacto-N-tetraose (LNT) and lacto-N-neotetraose (LNnT); (3) acidic sialylated HMOs, such as 3'-sialyllactose (3'-SL) and 6'-sialyllactose (6'-SL).
[0005] Currently, studies have shown that HMOs in human milk can regulate the intestinal flora of infants and young children.
[0006] For example, Reference 1 discloses a nutritional composition containing at least one fucosylated oligosaccharide and at least one N-acetylated oligosaccharide, which can be used in infant formula foods to play a role in regulating the intestinal flora of infants and young children, achieving the effect of inducing intestinal microorganisms similar to those of breastfed infants.
[0007] Reference 2 discloses the application of oligosaccharides, such as 2'-fucosyllactose or a combination of fructooligosaccharides, galactooligosaccharides, and 2'-fucosyllactose, in the preparation of products for regulating the intestinal flora. The regulation of the intestinal flora includes inhibiting the adhesion ability of pathogenic bacteria, and / or enhancing the competitive adhesion and antibacterial ability of Lactobacillus rhamnosus, and / or enhancing the repulsive adhesion and antibacterial ability of Lactobacillus rhamnosus.
[0008] Citation Document 3 discloses the use of human milk oligosaccharides in improving the intestinal flora of mothers and infants, specifically relating to the use of 2'-fucosyllactose in the preparation of a food that can help regulate the intestinal flora of a mother and her offspring via maternal ingestion, where the mother is in the gestational and / or lactation period. The invention proposes that supplementing a certain amount of 2'-fucosyllactose during the gestational and / or lactation period of a mother can significantly increase the abundance of beneficial bacteria in her intestine and reduce the content of harmful bacteria, and at the same time significantly increase the abundance of beneficial bacteria in the intestine of her offspring and reduce the content of harmful bacteria. In particular, it can regulate the abundance of some non-directly edible beneficial bacteria in the intestines of the mother and offspring.
[0009] Citation Document 4 discloses a human milk oligosaccharide composition and its application for improving the intestinal flora abundance and fecal odor of infants. The human milk oligosaccharide composition includes 2'-FL, 3'-FL, 3'-SL or 6'-SL and ganglioside GM3, etc. Through various different ratios of human milk oligosaccharides, this human milk oligosaccharide can increase the abundance of Actinobacteria and Firmicutes in the infant gut microbiome, increase the number of Bifidobacterium and Lactobacillus in infants, change the composition of the intestinal flora. At the same time, it can also reduce the intestinal pH value and the content of indole and skatole, reduce the content of indole and skatole in the feces of infants, improve the fecal characteristics of infants, and the concentration of odor-producing compounds.
[0010] Citation Document 5 discloses human milk oligosaccharides for regulating butyric acid and improving the health of the intestinal microenvironment and their application. The human milk oligosaccharides include 2'-FL, 3'-FL, 3'-SL or 6'-SL. Among them, the improvement of the health of the intestinal microenvironment includes: regulating the production of butyric acid in the intestinal system, increasing the overall production of short-chain fatty acids, being utilized by the intestinal flora as a prebiotic and producing gas in the intestinal system, reducing the production of isobutyric acid and isovaleric acid and / or lowering the pH to maintain the health of the intestinal microenvironment.
[0011] It is considered in Citation Document 6 that HMOs play a key role in forming and maintaining a healthy infant gut flora. The composition of the infant gut microbiota is related to the metabolized HMOs. Since HMOs are resistant to the low gastric juice pH value and enzymes in the upper digestive tract and cannot be digested in the upper part of the infant gastrointestinal tract, most HMOs reach the colon, where they affect the composition and activity of the gut microbiota as substrates for specific microorganisms (i.e., acting as prebiotics).
[0012] In Citation Document 7, the effects of 2'-FL on the composition and metabolites of the intestinal flora were studied through a simulated infant intestinal model.
[0013] Although the above-mentioned prior art has disclosed the regulatory effect of human milk oligosaccharides on the intestinal flora, most of the research directions are aimed at the intestinal flora of healthy infants, and there are few reports on the impact on the intestinal flora in the case of constipation.
[0014] Cited References
[0015] Cited Reference 1 (CN107847509B)
[0016] Cited Reference 2 (CN115836733A)
[0017] Cited Reference 3 (CN119138609A)
[0018] Cited Reference 4 (CN110839702A)
[0019] Cited Reference 5 (CN114568504A)
[0020] Cited Reference 6: Yuan Huizhi, Xun Yiping, Pu Xiaolu, et al. Research Progress on the Correlation between Human Milk Oligosaccharides and Infant Intestinal Microbiota[J]. Food Science, 2021, 42(13):7.
[0021] Cited Reference 7: Salli, K., Anglenius, H., Hirvonen, J. et al. The effect of 2′-fucosyllactose on simulated infant gut microbiome and metabolites; a pilot study in comparison to GOS and lactose. Sci Rep 9, 13232 (2019). Summary of the Invention
[0022] Problems to be Solved by the Invention:
[0023] Although the prior art has disclosed the improvement effect of human milk oligosaccharides on the intestinal flora, most of them are aimed at the intestinal flora of healthy infants, and there are few reports on the impact on the intestinal flora in the case of constipation. It is known that the intestinal condition in the case of constipation is different from that in the normal situation, and it is not easy to find the answer as to whether or how to relieve constipation by improving the intestinal condition in the case of constipation.
[0024] The present invention relates to the use of human milk oligosaccharides to improve the intestinal flora environment in a constipated organism, specifically to the use of 6′-sialyllactose in the preparation of a food that is ingested by a constipated organism and helps to regulate the intestinal flora environment. After a large number of studies, the present invention proposes that supplementing a certain amount of 6′-sialyllactose in the constipated state of the organism can improve the constipation condition, significantly increase the content of short-chain fatty acids, significantly increase the beneficial bacteria in the intestine and reduce the abundance of harmful bacteria, and the intestinal flora diversity is close to that of normal mice. In particular, it can regulate the abundance of some genera of bacteria in the intestine that are related to maintaining the balance of the flora and promoting the production of short-chain fatty acids.
[0025] Solution for solving problems:
[0026] 1. Use of human milk oligosaccharide in the preparation of a food for improving constipation, wherein the human milk oligosaccharide is 6'-sialyllactose;
[0027] The constipation is functional constipation;
[0028] The improvement of constipation includes the following improvements:
[0029] (a) Increasing the water content of feces;
[0030] (b) Enhancing intestinal motility;
[0031] (c) Regulating the SCF / C-kit signaling pathway.
[0032] 2. The use according to 1, wherein the regulation of the SCF / C-kit signaling pathway includes increasing the transcriptional levels of SCF and / or C-kit in colon tissues.
[0033] 3. The use according to 1, wherein the improvement of constipation further includes the following improvement: increasing the abundance and diversity of intestinal flora.
[0034] 4. The use according to 1, wherein the improvement of constipation further includes the following improvement: regulating the intestinal flora structure.
[0035] 5. The use according to 4, wherein the regulation of the intestinal flora structure includes at least one of reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.
[0036] 6. The use according to 1, wherein the improvement of constipation further includes the following improvement: restoring the content of short-chain fatty acids in the intestine.
[0037] 7. The use according to 6, wherein the restoration of the content of short-chain fatty acids in the intestine includes increasing the content of at least one of acetic acid, propionic acid, butyric acid and valeric acid.
[0038] 8. Use of human milk oligosaccharide in the preparation of a food for improving the intestinal flora environment, wherein the human milk oligosaccharide is 6'-sialyllactose;
[0039] The intestinal flora environment is the intestinal flora environment under constipation conditions.
[0040] 9. The use according to 8, wherein the improvement of the intestinal flora environment includes increasing the abundance and diversity of intestinal flora, and / or regulating the intestinal flora structure;
[0041] Optionally, the enhancing of the intestinal flora abundance and diversity includes enhancing the relative abundance of Verrucomicrobia;
[0042] Optionally, the enhancing of the intestinal flora abundance and diversity includes enhancing the relative abundance of one or more of the genera Lactobacillus, Bacteroides, Akkermansia, Adlercreutzia, Parabacterodes, Corynebacterium, Anaerotruncus, Anaeroplasma, and Anaerostipes;
[0043] Optionally, the modulating of the intestinal flora structure includes at least one of reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.
[0044] 10. The use according to any one of 1 to 9, wherein the food is an oral preparation; the oral preparation includes at least one of tablets, pills, granules, powders, tea preparations, capsules, and oral liquids.
[0045] 11. The use according to 10, wherein the food contains at least one of the following components: plant product components, animal dairy product components, animal meat product components, functional additive components, and any acceptable excipients in food.
[0046] 12. The use according to any one of 1 to 10, wherein the food is a confectionery, beverage, dairy product, baked food, food for special dietary use, or dietary supplement.
[0047] 13. The use according to any one of 1 to 12, wherein in the food, the mass content of the human milk oligosaccharide is at least 0.05%.
[0048] Effects of the invention:
[0049] The food containing 6'-sialyllactose provided by the present invention can significantly improve the condition of constipation, specifically including increasing the water content of feces, enhancing intestinal peristalsis ability, increasing the content of short-chain fatty acids in the intestine, enhancing the abundance and diversity of intestinal flora. More specifically, it includes: increasing the relative mRNA expression levels of SCF and C-kit in colon tissue to relieve constipation; increasing the α-diversity of intestinal flora (Chao1 index, Observed species index, Shannon index and Simpson index); reducing the difference in β-diversity analysis of intestinal flora from that of normal mice; making the intestinal flora closer to that of normal mice at the phylum level (such as Firmicutes and Bacteroidetes); making the intestinal flora closer to that of normal mice at the genus level (such as Bacteroides and Akkermansia); maintaining the balance of intestinal flora and intestinal barrier, inhibiting the growth of harmful bacteria, preventing intestinal infections and inflammations, such as the increase in the relative abundances of Lactobacillus and Akkermansia; increasing the relative abundances of Bacteroides and Ruminococcus in the intestinal flora, which can promote the production of short-chain fatty acids to maintain intestinal health and inhibit the growth of harmful microorganisms. Description of the Drawings
[0050] Figure 1 It is a diagram of the morphology of mouse feces; A: Feces of mice in group K; B: Feces of mice in group M; C: Feces of mice in group Y.
[0051] Figure 2 It is the effect of different doses of 6'-SL on the α-diversity of intestinal flora in constipated mice; A: Chao 1 index; B: Observed species index; C: Simpson index; D: Shannon index; where, * indicates p < 0.05, and ** indicates p < 0.01.
[0052] Figure 3 It is the effect of different doses of 6'-SL on the β-diversity of intestinal flora in constipated mice; A: PCoA analysis; B: NMDS analysis.
[0053] Figure 4 It is the effect of different doses of 6'-SL on the relative abundances of intestinal flora in constipated mice (at the phylum level); A: Column chart of the average relative abundances of species at the phylum level in each group; B: Relative abundance of Firmicutes; C: Relative abundance of Bacteroidetes; D: Ratio of the relative abundance of Firmicutes to the relative abundance of Bacteroidetes; E: Relative abundance of Verrucomicrobia; Different letters indicate significant differences between treatment groups (P < 0.05).
[0054] Figure 5Effect of different doses of 6'-SL on the relative abundance of intestinal flora in constipated mice (at the genus level); A: Histogram of the average relative abundance of species at the genus level in each group; B: Relative abundance of Lactobacillus; C: Relative abundance of Bacteroides; D: Relative abundance of Akkermansia; E: Relative abundance of Adlercreutzia; F: Relative abundance of Parabacteroides. Different letters indicate significant differences between treatment groups (P < 0.05).
[0055] Figure 6 LEfSe species difference analysis of intestinal flora in mice intervened with different doses of 6'-SL; A: Taxonomic cladogram; B: LDA bar chart. Detailed implementation manners
[0056] The various exemplary embodiments, features and aspects of the present invention will be described in detail below. The word "exemplary" used here means "serving as an example, embodiment or illustration". Any embodiment described here as "exemplary" does not have to be construed as superior or better than other embodiments.
[0057] In addition, in order to better illustrate the present invention, numerous specific details are given in the following detailed implementation manners. Those skilled in the art should understand that the present invention can also be implemented without some specific details. In other instances, methods, means, equipment and steps well-known to those skilled in the art are not described in detail in order to highlight the gist of the present invention.
[0058] Unless otherwise stated, the units used in this specification are all international standard units, and the numerical values and numerical ranges appearing in the present invention should be understood to include the systematic errors inevitable in industrial production.
[0059] In this specification, the meaning expressed by "can" includes both the meaning of performing a certain process and the meaning of not performing a certain process.
[0060] In this specification, the so-called "some specific / preferred implementation manners", "other specific / preferred implementation manners", "implementation manners", etc. refer to the specific elements (for example, features, structures, properties and / or characteristics) related to the implementation manner described, which are included in at least one of the implementation manners described here, and may or may not exist in other implementation manners. In addition, it should be understood that the elements can be combined in various implementation manners in any suitable way.
[0061] In this specification, "optional" and "optionally" mean that the subsequently described event or situation may or may not occur, and the description includes the case where the event or situation occurs and the case where the event or situation does not occur.
[0062] In this specification, the numerical range expressed as "numerical value A to numerical value B" means a range including the endpoint numerical values A and B.
[0063] In this specification, when "normal temperature" or "room temperature" is used, the temperature can be 23 ± 2°C.
[0064] In addition, unless otherwise defined, other technical and scientific terms used in the present invention have the same meanings as those commonly understood by those of ordinary skill in the technical field to which the present invention belongs.
[0065] The present invention has been mainly completed based on the following insights:
[0066] Human milk oligosaccharides have been proven to have the effect of improving the intestinal flora of infants, but most of the research objects are aimed at the intestinal environment of healthy infants, and there is no report on the improvement of the intestinal environment in the case of constipation. The effect of human milk oligosaccharides on the intestinal environment in the constipated state is still unknown, and it is not easy to know whether and how the intestinal condition in the case of constipation can be improved to relieve constipation. The present invention constructs a constipated mouse model and administers human milk oligosaccharides to the model, and unexpectedly finds that human milk oligosaccharides can improve the constipation symptoms of mice, and have a significant promoting effect on the increase of the microbial abundance in the intestine, the decrease of the ratio of Firmicutes to Bacteroidetes, the improvement of the SCF / C-kit pathway, and the increase of the short-chain fatty acid content.
[0067] That is, the present invention relates to the use of human milk oligosaccharides in the preparation of (functional) foods for improving constipation, wherein the human milk oligosaccharide is 6'-sialyllactose, and the constipation is functional constipation.
[0068] At the same time, the present invention also relates to the application of 6'-sialyllactose in the preparation of foods having one or more of the following effects: regulating the SCF / C-kit signaling pathway, increasing the water content of feces, enhancing intestinal motility, enhancing the abundance and diversity of intestinal flora, regulating the intestinal flora structure, and restoring the short-chain fatty acid content in the intestine.
[0069] I. Human milk oligosaccharides
[0070] Human milk oligosaccharides are a class of structurally complex non-digestible carbohydrates, mainly composed of 3 to 10 monosaccharides (such as glucose, galactose, N-acetylglucosamine, fucose, sialic acid). In some specific embodiments of the present invention, the human milk oligosaccharide is 6'-sialyllactose.
[0071] The 6’-sialyllactose (6’-SL) described in the present invention is a disaccharide containing sialic acid, mainly composed of lactose (D-galactose and D-glucose) and sialic acid (N-acetylneuraminic acid) linked by an α-2,6 glycosidic bond, C 23 H 39 O 19 , with a molecular weight of 633.55 g / mol.
[0072] The present invention does not particularly limit the source of the 6’-sialyllactose. For example, it can be of natural origin, synthetic origin, microbial fermentation origin, etc. Typically, for 6’-sialyllactose, it can be synthesized through chemical reactions such as linking sialic acid (N-acetylneuraminic acid, Neu5Ac) with lactose; it can also use lactose + CMP-Neu5Ac (cytidine-5'-monophosphate-sialic acid) as a substrate, catalyzed by sialic acid synthase (such as NeuA) and CMP-sialic acid synthase (such as CSS) to generate CMP-Neu5Ac, and under the action of sialyltransferase, transfer the sialic acid of CMP-Neu5Ac to the 6'-OH position of lactose to generate 6’-sialyllactose.
[0073] In some embodiments, based on the total mass of the products from various sources of 6’-sialyllactose, the mass content of 6’-sialyllactose can be 60% or more, preferably 80% or more, more preferably 90% or more, or any other content.
[0074] II. Food
[0075] The food described in the present invention contains or uses the above-mentioned human milk oligosaccharides, especially 6’-sialyllactose.
[0076] The present invention does not particularly limit the specific form of the food. At room temperature, the edible nutrient is solid, semi-solid or liquid. Exemplarily, it can include drinkable compositions, powder or granular compositions, gels, frozen or partially frozen compositions. The food can optionally form part of a capsule filling, or can optionally form part of a beverage, dairy product, non-dairy cream, sauce or baked food.
[0077] In some specific embodiments, the food can be powdered instant foods (such as solid beverages, instant coffee, cereal flours, nut flours or lotus root starch), baked foods (such as breads, cakes or cookies), beverages (such as carbonated beverages, fruit and vegetable juice beverages, functional beverages, tea beverages, milk beverages or alcoholic beverages), candies (such as gel candies, hard candies, tablets), milk and dairy products (such as fresh milk, milk powder, whey powder, fermented milk, cheese or condensed milk derived from fresh cow (sheep) milk), etc.
[0078] In some other specific embodiments, the food of the present invention can also be a health food, such as various types of oral preparations, including but not limited to tablets, pills, granules, powders, teas, capsules, oral liquids, etc.
[0079] The present invention does not particularly limit the specific absolute content of 6'-sialyllactose in the food, as long as it meets the requirements of local food-related laws and regulations. In some embodiments, relative to the total mass of the food, the mass content of 6'-sialyllactose is at least 0.05%, preferably at least 0.1%, more preferably at least 1%, and further preferably at most 12%.
[0080] In addition to the 6'-sialyllactose, other components can also be included, such as components often contained in food, such as proteins / amino acids, carbohydrates, fats, vitamins, minerals, etc. In addition, according to the type of food and the ultimate needs of the applicable objects, in some embodiments, the food of the present invention also contains any one or more of the following components: plant product components, animal dairy product components, animal meat product components, functional additive components, and any acceptable excipients.
[0081] For plant product components, examples include fruits such as figs, pomegranates, kiwifruits, oranges, oranges, pineapples, strawberries, apples, bananas, grapes, pears, cherries, blueberries, blackberries, blackcurrants, cranberries, raspberries, melons, phyllanthus emblica, and cornelian cherries, or their extracts; vegetable substances such as onions, cucumbers, tomatoes, cauliflower, carrots, spinach, kale, Brussels sprouts, garlic, basil, oregano, or their extracts; grains such as rice (indica rice, japonica rice, glutinous rice), wheat (wheat, barley, oats, rye), corn, sorghum, millet, broomcorn millet, buckwheat, soybeans, broad beans, peas, mung beans, adzuki beans, kidney beans, or their extracts; nuts such as walnuts, pistachios, cashews, hazelnuts, almonds, pine nuts, peanuts, sunflower seeds, chestnuts, macadamia nuts, ginkgo nuts, or their extracts; coffee or its extract; and some medicinal and edible plant-based Chinese medicinal materials or their extracts.
[0082] For animal dairy product components, examples include fresh milk from mammals such as cows, sheep, and camels, as well as reprocessed dairy products such as whole milk powder, skim milk powder, concentrated whey protein powder, demineralized whey powder, whey protein powder, and hydrolyzed whey protein powder.
[0083] For animal meat product components, examples include meat product components of pigs, cows, sheep, aquatic products, or poultry, etc.
[0084] For functional additive components, examples include vitamin supplements, mineral supplements, nucleotide supplements, dietary fiber, functional polyunsaturated fatty acid supplements, etc.
[0085] For any acceptable excipients, examples include solvents, antioxidants, antibacterial agents, thickeners, diluents, cosolvents, stabilizers, emulsifiers, fillers, disintegrants, lubricants, coating materials, anti-caking agents, flavoring agents, sweeteners, edible flavors, edible pigments, etc.
[0086] III. Use for improving constipation
[0087] The present invention unexpectedly discovers that 6'-sialyllactose can effectively improve constipation, especially functional constipation. The improvement of constipation includes one or more of regulating the SCF / C-kit signaling pathway, increasing the water content of feces, enhancing intestinal peristalsis ability, increasing the abundance of intestinal flora, regulating the structure of intestinal flora, and restoring the content of short-chain fatty acids in the intestine.
[0088] In some embodiments, the SCF (stem cell factor) / C-kit signaling pathway plays a key role in the regulation of gastrointestinal motility. Its abnormal function is closely related to the occurrence of constipation. It mainly acts on interstitial cells of Cajal (ICC), regulates the rhythmic contraction of smooth muscle by generating slow-wave potentials, and directly affects gastrointestinal motility. In the colon tissue of constipated mice, the mRNA levels of SCF and C-kit are significantly decreased compared with the blank control group. After administration of 6'-sialyllactose, the mRNA expression levels of SCF and C-kit in the colon tissue of constipated mice are significantly increased.
[0089] In some embodiments, the improvement of intestinal peristalsis ability includes an increase in intestinal transit rate and a shortening of the time to the first black feces.
[0090] In some embodiments, the present invention conducts α-diversity analysis, β-diversity analysis, differential analysis at the phylum level, differential analysis at the genus level, and LEfSe species differential analysis on the intestinal flora of mice, and thus discovers that the 6'-sialyllactose provided in the present invention can improve the decrease in the abundance and diversity of intestinal flora in constipated mice.
[0091] In some specific embodiments, the improvement of the decrease in the abundance and diversity of intestinal flora in constipated mice includes an increase in the Chao1 index, Observed species index, Shannon index, and Simpson index; reducing the difference in flora diversity from normal mice and alleviating the change in β-diversity of the intestinal flora in constipated mice.
[0092] In some specific embodiments, at the phylum level of the gut microbiota, 6'-sialyllactose can reduce the relative abundance of Firmicutes in the gut of constipated mice, increase the relative abundances of Bacteroidetes and Verrucomicrobia. The increase in the relative abundance of Firmicutes and the decrease in the relative abundance of Bacteroidetes in the gut of constipated mice lead to an increase in the ratio of Firmicutes to Bacteroidetes (F / B ratio). The F / B ratio is an important indicator of the gut microbiota composition, and its imbalance is closely related to the occurrence and development of constipation. After administration of 6'-sialyllactose, the increase in the F / B ratio can also be significantly improved, making the F / B ratio close to that of normal mice and improving the constipation condition.
[0093] In some specific embodiments, 6'-sialyllactose also improves the relative abundances of the gut microbiota at the genus level.
[0094] In some exemplary embodiments, 6'-sialyllactose can increase the relative abundances of Lactobacillus and Akkermansia, which are related to maintaining the balance of the gut microbiota and the intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infections and inflammation.
[0095] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Bacteroides, which is related to promoting the production of short-chain fatty acids, maintaining intestinal health, and inhibiting the growth of harmful microorganisms in the gut microbiota.
[0096] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Corynebacterium and decrease the relative abundance of Adlercreutzia.
[0097] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Parabacteroides, which is related to sugar metabolism and short-chain fatty acid secretion.
[0098] In some specific embodiments, 6'-sialyllactose can increase the relative abundances of Anaerotruncus, Anaeroplasma, and Anaerostipes, which are related to short-chain fatty acid secretion in the intestine.
[0099] In some embodiments of the present invention, 6'-sialyllactose improves the condition of constipation by improving the intestinal flora. In particular, high-dose 6'-sialyllactose has a more significant effect on improving the abundance and diversity of the intestinal flora, and also has a more significant effect on improving constipation.
[0100] Furthermore, the present invention also found that consistent with the improvement of the intestinal flora abundance and intestinal flora structure, 6'-sialyllactose has a significant promoting effect on restoring the content of short-chain fatty acids in the intestines of constipated mice. The present invention found that the contents of short-chain fatty acids including formic acid, acetic acid, propionic acid, butyric acid, etc. in the intestines of constipated mice were significantly decreased. After administering 6'-sialyllactose, the content of short-chain fatty acids can be restored. In particular, high-dose 6'-sialyllactose has a better restoring effect.
[0101] Therefore, the foods provided by the present invention containing human milk oligosaccharides, especially 6'-sialyllactose, are all helpful for relieving constipation, especially functional constipation. The improvement of constipation by the present invention is not for the purpose of preventing and treating diseases.
[0102] IV. Use for improving the intestinal flora environment
[0103] The present invention found that 6'-sialyllactose can improve the intestinal flora environment under constipation conditions, especially functional constipation. The improvement of the intestinal flora under constipation conditions includes the promotion of the abundance and diversity of the intestinal flora and the regulation of the intestinal flora structure.
[0104] In some specific embodiments, at the phylum level of the intestinal flora, the promotion of the abundance and diversity of the intestinal flora includes the increase in the relative abundance of Verrucomicrobia.
[0105] In some specific embodiments, at the genus level of the intestinal flora, the promotion of the abundance and diversity of the intestinal flora includes the increase in the abundance and diversity of beneficial bacteria.
[0106] In some exemplary embodiments, 6'-sialyllactose can increase the relative abundances of Lactobacillus and Akkermansia, which are related to maintaining the balance of the intestinal flora and the intestinal barrier, inhibiting the growth of harmful bacteria, and preventing intestinal infections and inflammation.
[0107] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Bacteroides, which is related to promoting the production of short-chain fatty acids, maintaining intestinal health, and inhibiting the growth of harmful microorganisms in the intestinal flora.
[0108] In some specific embodiments, 6'-sialyllactose can increase the relative abundance of Parabacteroides, which is related to sugar metabolism and short-chain fatty acid secretion.
[0109] In some specific embodiments, 6'-sialyllactose can increase the relative abundances of Anaerotruncus, Anaeroplasma, and Anaerostipes in the intestine, which are related to short-chain fatty acid secretion.
[0110] In some specific embodiments, 6'-sialyllactose can also increase the relative abundance of Corynebacterium.
[0111] In some specific embodiments, 6'-sialyllactose can reduce the relative abundance of Firmicutes and increase the relative abundance of Bacteroidetes in the intestines of constipated mice. The increase in the relative abundance of Firmicutes and the decrease in the relative abundance of Bacteroidetes in the intestines of constipated mice lead to an increase in the ratio of Firmicutes to Bacteroidetes (F / B ratio), and the F / B ratio is an important indicator of the intestinal flora composition, and its imbalance is closely related to the occurrence and development of constipation. After administration of 6'-sialyllactose, the increase in the F / B ratio can be significantly improved, and the constipation condition can be improved.
[0112] In some specific embodiments, 6'-sialyllactose can reduce the relative abundance of Adlercreutzia.
[0113] On this basis, the food containing 6'-sialyllactose provided by the present invention helps to alleviate the intestinal flora environment under constipation conditions, especially functional constipation conditions. The improvement of the intestinal flora environment by the present invention is not for the purpose of prevention and disease treatment.
[0114] Examples
[0115] The embodiments of the present invention will be described in detail below in conjunction with the examples. However, those skilled in the art will understand that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention. Those not specified in the examples are carried out under conventional conditions or conditions recommended by the manufacturer. Those reagents or instruments not specified by the manufacturer can be obtained as conventional products through commercial purchase.
[0116] 1 Materials and Methods
[0117] 1.1 Raw materials:
[0118] Table 1 Experimental raw materials
[0119]
[0120] 1.2 Animal experiment design:
[0121] Sixty healthy male BALB / c mice (6 weeks old, 20 g) were housed under a 12 h light / dark cycle, at a temperature of 25 ± 2 °C, and a humidity of 55%−65%. During the whole experiment, they had free access to sterile water and normal feed. After one week of adaptive feeding, they were randomly divided into 6 groups of 10 mice each, namely the blank group (K), the constipation model group (M), the positive control group (Y), the high-dose 6'-SL group (H6), the medium-dose 6'-SL group (M6), and the low-dose 6'-SL group (L6). Except for the blank group, mice in other groups were intragastrically administered loperamide at 10 mg / kg bw every morning at 9:00, once a day. The blank group was intragastrically administered an equal volume of normal saline, and this was done for 7 days. Starting from the 8th day, the K group was intragastrically administered normal saline every day, while the remaining groups were intragastrically administered loperamide at 10 mg / kg·bw. 2 h after intragastrically administering loperamide, the M group was intragastrically administered normal saline, the Y group was intragastrically administered mosapride at 2.5 mg / kg·bw, and the H6 group, M6 group, and L6 group were intragastrically administered 6'-SL at 500 mg / kg·bw, 300 mg / kg·bw, and 100 mg / kg·bw, respectively. On the 29th day, the mice were fasted (with free access to water) for 12 h, and the cecal contents of the colon were collected and placed in a sterilized centrifuge tube for subsequent microbiota sequencing analysis. All the remaining animal tissues were stored in an ultra-low temperature freezer at -80 °C for later use.
[0122] Table 2 Experimental grouping
[0123]
[0124] 1.3 Health index
[0125] During the period of mouse rearing, the defecation, activity status, and whether the mice died were observed every day. In addition, the body weight, water intake, and food intake of the mice were recorded at the same time every day.
[0126] 1.4 Determination of constipation-related indicators
[0127] Fecal water content: Feces were collected on the 14th day and 28th day of feeding. After the feces were dried until the weight remained unchanged, the dry weight and moisture content of the feces were obtained. At the same time, the fecal samples collected on the 28th day were stored at -80 °C for the analysis of short-chain fatty acids and gut microbiota. The fresh feces of the obtained mice were weighed and recorded as the wet weight. Then, the feces were dried at 105 °C for 5 h until a constant weight was reached, and then weighed and recorded as the dry weight:
[0128] Fecal water content = (wet weight - dry weight) / dry weight × 100%
[0129] Determination of defecation time: On the 28th day, after all mice were fasted overnight for 12 h, they were intragastrically administered an activated carbon solution (10% activated carbon, 0.5% carboxymethyl cellulose suspension), and then placed in metabolic cages separately. The time between the ingestion of activated carbon and the defecation of dark feces by the mice was recorded.
[0130] Gastrointestinal transit rate: On the 29th day, an activated carbon solution was intragastrically administered. After 30 min, all mice were euthanized by cervical dislocation, and the small intestine was dissected and collected. The distance from the pylorus to the activated carbon boundary was regarded as the migration distance. After measuring the length, the gastrointestinal transit rate was calculated using the following formula:
[0131] Gastrointestinal transit rate = activated carbon migration distance / total length of small intestine × 100%
[0132] Total mRNA was extracted from the colon of mice using an RNA extraction kit, and cDNA was synthesized using a reverse transcription kit according to the manufacturer's instructions. PCR was performed using SYBR Green Master Mix. The genes detected included SCF and C-kit in colon tissue.
[0133] SCF-F: AGCTTGACTACTCTTCTGGACA (SEQ ID NO:1)
[0134] SCF-R: TGGCCTCTTCGGAGATTCTTTT (SEQ ID NO:2)
[0135] C-kit-F: GGCCTCACGAGTTCTATTTACG (SEQ ID NO:3)
[0136] C-kit-R: GGGGAGAGATTTCCCATCACAC (SEQ ID NO:4)
[0137] Actin-F: GATATCGCTGCGCTGGTCG (SEQ ID NO:5)
[0138] Actin-R: CATTCCCACCATCACACCCT (SEQ ID NO:6)
[0139] 1.5 High-throughput analysis of the colonic contents flora
[0140] After decapitating and sacrificing the mice in each group, the intestinal contents of the mice were collected in a sterilized cryotube, quickly placed in liquid nitrogen for preservation, and then stored in a -80°C refrigerator. First, a DNA kit was used to extract the total DNA in the sample and perform quality detection. After passing the detection, the hypervariable region (V3-V4 region) of 16S rDNA was sequenced. Classification was carried out according to the similarity of 16S rDNA of microbial populations. The construction of the MiSeq library and the 16S rDNA sequencing process were completed by a sequencing company. Then, bioinformatics analysis was performed on the raw data, and clustering analysis was performed on the effective tags obtained after filtering to obtain the representative sequences of Operational Taxonomic Units (OTUs). Annotation of the OTU sequences was performed to obtain the corresponding microbial species, and the abundance and structural changes of the intestinal flora species of the mice in each group were analyzed at the phylum and genus levels. Species differences were found through LEfSe analysis.
[0141] V3-V4 region amplification primer - F: ACTCCTACGGGAGGCAGCA (SEQ ID NO:7)
[0142] V3-V4 region amplification primer - R: GGACTACHVGGGTWTCTAAT (SEQ ID NO:8)
[0143] 1.6 Determination of fecal short-chain fatty acid content
[0144] Gas chromatography-mass spectrometry (GC-MS) was used to analyze and determine the levels of acetic acid, propionic acid, butyric acid, and valeric acid in the feces of mice. Briefly, 100 mg of fecal samples were homogenized with 1 mL of 0.5% phosphoric acid and centrifuged at 12000 × g for 10 min. The collected supernatant was mixed with 500 μL of ethyl acetate and then analyzed through a 0.22 μm PVDF membrane. SCFAs were separated using a gas chromatography-mass spectrometry system equipped with an Agilent DB-WAX capillary column (30 m × 0.25 mm ID × 0.25 μm, 0.25 μm film thickness, 5% phenylmethylsiloxane). Helium was used as the carrier gas (99.999%) at a rate of 1.00 mL / min. The column temperature was initially set at 90°C, gradually increased to 150°C at 10°C / min, then gradually increased to 230°C at 20°C / min, and finally held for 3 min. The ion source temperature, front sample orifice temperature, and interface temperature were set at 230, 250, and 280°C, respectively. The detector operated in the electron impact ionization mode (electron energy 70 eV), and the scanning range was 30−250 m / z.
[0145] 1.7 Statistical analysis:
[0146] The experimental data are presented as mean ± standard deviation. Statistical analysis was performed using SPSS 26.0 software. One-way ANOVA was used, and the Tukey test was used to compare the differences between groups. A P value < 0.05 was considered to indicate a significant difference between the data, while a P value > 0.05 was considered to indicate no significant difference between the data.
[0147] 2 Experimental results
[0148] 2.1 Effects of human milk oligosaccharides on constipation indices in mice
[0149] The characteristics of mouse feces are one of the important indicators for successfully establishing a constipation model. As Figure 1 shown in A, the feces of mice in the blank group were cylindrical and had a smooth surface. Compared with the mice in the blank group, the feces of mice in the model group had a dull luster, were hard, dry, and granular ( Figure 1 shown in B). Compared with the model group, the feces of mice in the positive drug group were moist, cylindrical, and the fecal length was close to that of the blank group ( Figure 1 shown in C). Fecal moisture content is one of the important indicators reflecting the degree of constipation in mice. The effects of human milk oligosaccharides on fecal moisture content in mice are shown in Table 3. Compared with the K group, the fecal moisture content of mice in the M group was significantly reduced (P < 0.05), indicating that the administration of loperamide caused a dry and hard state of the feces. Compared with the M group, the fecal water content of mice in the Y group was significantly increased (P < 0.05). After intervention with different doses of 6'-SL, the fecal moisture content was significantly higher than that of the M group (P < 0.05). The time to the first black feces can reflect the peristaltic ability of the entire gastrointestinal tract. The longer the time to the first black feces, the weaker the peristaltic ability of the mouse gastrointestinal tract. As shown in Table 3, the time to the first black feces in the M group was significantly higher than that in the K group. Compared with the M group, the time to the first black feces in mice in the Y group was significantly reduced (P < 0.05), indicating that mosapride can effectively improve the peristaltic ability of the gastrointestinal tract. Compared with the M group, after intervention with different doses of 6'-SL, the time to the first black feces was significantly reduced (P < 0.05). Intestinal transit rate can reflect the peristaltic ability of the entire gastrointestinal tract and is an important indicator for evaluating constipation. The faster the intestinal transit rate, the more conducive it is to the excretion of feces. As shown in Table 3, compared with the K group, the intestinal transit rate of mice in the M group was significantly reduced (P < 0.05), similar to the results of the time to the first black feces and fecal water content in mice, indicating that the constipation model was successfully established. Compared with the M group, after intervention with the positive drug and different doses of 6'-SL, the intestinal transit rate of mice was significantly increased (P < 0.05). The above results indicate that 6'-SL can significantly improve loperamide-induced constipation in mice.
[0150] The SCF / C-kit pathway plays a crucial role in the treatment of constipation. The SCF / C-kit signal is essential for the development, differentiation, and phenotypic maintenance of interstitial cells of Cajal (ICC). Abnormalities in the SCF / C-kit signaling pathway may lead to impaired quantity and function of ICC, thereby affecting the conduction of intestinal nerve signals and the motor function of intestinal smooth muscle, resulting in a slowed transmission speed of intestinal contents and triggering constipation symptoms. In this invention, RT-qPCR was used to study the effects of 6'-SL on the mRNA expression levels of SCF and C-kit in the colon tissues of constipated mice, and the results are shown in Table 4. Compared with the blank K group, the relative mRNA expression levels of SCF and C-kit in group M of mice after loperamide intervention were significantly decreased (P<0.05). Compared with the model M group, after treatment with different doses of 6'-FL, the mRNA expression level of C-kit in the colon tissues of mice was significantly increased (P<0.05). After treatment with different doses of 6'-SL, the mRNA expression level of C-kit in the colon tissues of mice was significantly increased (P<0.05). After treatment with high and medium doses of 6'-SL, the mRNA expression level of SCF in the colon tissues of mice was significantly increased (P<0.05). These results indicate that 6'-SL can significantly regulate the mRNA expression level of SCF / C-kit, thereby alleviating loperamide-induced constipation.
[0151] Table 3 Effects of human milk oligosaccharides on defecation indexes of mice
[0152]
[0153] Note: * P<0.05 compared with the blank control K group; # P<0.05 compared with the model M group
[0154] Table 4 Effects of human milk oligosaccharides on relative mRNA expression levels of SCF and C-kit in colon tissues of mice
[0155]
[0156] Note: * P<0.05 compared with the blank control K group; # P<0.05 compared with the model M group
[0157] 2.2 Intestinal flora:
[0158] 2.2.1: Effects of 6'-SL on intestinal flora of constipated mice
[0159] (1) Analysis of α-diversity of intestinal flora in each group of mice intervened with different doses of 6'-SL
[0160] Alpha diversity (α-diversity) refers to the diversity of microbial species within a specific region or ecosystem and is a comprehensive index reflecting the richness and evenness of microbial species. The Chao1 index and the Observed species index are often used to evaluate the species richness of microorganisms. The larger the Chao1 index and the Observed species index, the higher the species richness. The Simpson index and the Shannon index are often used to evaluate the species diversity of microorganisms. The larger the values of the Simpson index and the Shannon index, the higher the species diversity.
[0161] In this invention, the Chao1 index and the Observed species index are used to characterize the species richness, and the Shannon index and the Simpson index are used to characterize the species diversity. The effect of human milk oligosaccharide 6'-SL on the alpha diversity of the intestinal flora of constipated mice is as Figure 2 shown. The Chao1 index, the Observed species index, the Shannon index, and the Simpson index of the constipation model group (M) were significantly lower than those of the K group (P < 0.05), indicating that constipation has a negative impact on the species richness and diversity of the intestinal flora of mice. After intervention with different doses of human milk oligosaccharide 6'-SL, this negative impact was alleviated to varying degrees (P > 0.05), and the species richness and diversity of the intestinal flora of constipated mice were improved. Among them, as Figure 2 shown in A of Figure 2 and D of , the Chao1 indices of the L6 group, the M6 group, and the H6 group were 691.45, 774, and 857.79, respectively. The Observed species indices of the L6 group, the M6 group, and the H6 group were 650.75, 737, and 811.25, respectively. As the dose of human milk oligosaccharide 6'-SL increased, the Chao1 index and the Observed species index also increased (P > 0.05), showing a certain dose-dependent effect. The results of alpha diversity indicate that human milk oligosaccharide 6'-SL can alleviate the changes in the species richness and diversity of the intestinal flora caused by constipation, and the high-dose 6'-SL group (H6) has the best effect.
[0162] (2) Analysis of the beta diversity of the intestinal flora of mice in each group intervened with different doses of 6'-SL
[0163] Beta diversity (β-diversity) is commonly used to visually characterize gut microbiota data by means such as PCoA and NMDS based on Bray-Curtis distance. Both PCoA and NMDS can reflect the similarity of gut microbiota structure among samples. The difference is that NMDS focuses more on reflecting the ranking of values in the distance matrix and weakens the absolute differences in values. The effects of different doses of human milk oligosaccharide 6'-SL on the beta diversity of the gut microbiota in constipated mice are as Figure 3 shown. The PCoA analysis of each group of mice is as Figure 3 shown in A of Figure 3 . The contribution rate of PC1 is 24.8%, and the contribution rate of PC2 is 19.2%. The sum of the contribution rates of PC1 and PC2 is greater than 30%, indicating that the constipation model in this experiment was successfully established. The PCoA plot shows that there are significant differences in the gut microbiota between the K group and the M group. The data points of the L6 group, M6 group, and H6 group are between the K group and the M group, and the H6 group is closest to the K group. As Figure 3 shown in B of Figure 3 , the NMDS analysis also shows similar results. There are significant differences in the gut microbiota between the K group and the M group, and the data points move closer to the K group after intervention with different doses of human milk oligosaccharide 6'-SL. The results indicate that the beta diversity of the gut microbiota in constipated mice induced by loperamide has changed, and different doses of human milk oligosaccharide 6'-SL have alleviated the change in the beta diversity of the gut microbiota in constipated mice to varying degrees, among which the high-dose group (H6) has a better alleviating effect.
[0164] (3) Differences in the gut microbiota of each group of mice intervened with different doses of 6'-SL at the phylum level
[0165] The composition of the gut microbiota of each group of mice at the phylum level is as Figure 4 shown. A total of 10 major bacterial groups were detected, including Bacteroidetes, Firmicutes, Actinobacteria, Proteobacteria, TM7, Verrucomicrobia, Tenericutes, Deferribacteres, Cyanobacieria, and Acidobacteria. These 10 phyla account for more than 99% of the total gut microbiota of each group of mice. Among them, the relative abundances of Bacteroidetes and Firmicutes are relatively high, occupying an absolute dominant position in terms of quantity. The gut microbiota structures of each group of mice intervened with different doses of 6'-SL are similar, but the proportions of each phylum are different. As Figure 4 shown:
[0166] ① The average relative abundance of Bacteroidetes in the intestinal contents of group K mice accounted for 61.31%; while in group M mice, it accounted for 47.36%. Compared with group K, the relative abundance of Bacteroidetes in the intestinal contents of group M mice was significantly decreased (P < 0.05); in addition, after intervention with low, medium, and high doses of 6'-SL (groups L6, M6, and H6), the relative abundance of Bacteroidetes showed varying degrees of increase (P > 0.05), accounting for 55.54%, 54.53%, and 58.42% respectively. In addition, compared with the blank group K, the relative abundance of Firmicutes in the intestinal flora of the constipation model group (M) induced by loperamide was significantly increased (P < 0.05), an increase of 14.78%, and the ratio of Firmicutes to Bacteroidetes was significantly increased (P < 0.05), rising from 0.52 to 1.02. Compared with group M, after intervention with different doses of 6'-SL, the relative abundance of Firmicutes decreased, and the ratio of Firmicutes to Bacteroidetes decreased, showing a certain dose-dependence (P > 0.05). It should be noted that the relative abundance of Firmicutes in the intestinal flora of the mice in the high-dose 6'-SL intervention group and the ratio of Firmicutes to Bacteroidetes were significantly lower than those in group M (P < 0.05), and there was no significant difference compared with group K (P > 0.05).
[0167] ② Compared with group K, after intervention with low, medium, and high doses of 6'-SL (groups L6, M6, and H6), the relative abundance of Verrucomicrobia showed varying degrees of increase, and the proportion increased from 0% to 0.2%, 1.62%, and 3.22%. Compared with group M, after intervention with medium and high doses of 6'-SL (groups M6 and H6), the proportion of the relative abundance of Verrucomicrobia increased from 0.38% to 1.62% and 3.22%. Thus, it can be seen that the proportion of Verrucomicrobia increased significantly after intervention with medium and high doses of 6'-SL (P < 0.05).
[0168] (4)Differences in the intestinal flora of mice in each group intervened with different doses of 6'-SL at the genus level
[0169] At the genus level, in this study, the top 20 genera with relative abundance were selected, and their relative abundance maps at the genus level were drawn by classifying them.
[0170] As Figure 5 shown in A of, compared with group K, there were certain differences in the species composition of group M mice at the genus level, indicating that constipation can lead to changes in the intestinal flora structure of mice.
[0171] Among them, the relative abundances of Lactobacillus, Bacteroides, Akkermansia, Adlercreutzia, and Parabacteroides were significantly improved after 6'-SL intervention.
[0172] ① As shown in Figure 5 B- of Figure 5 C shown, compared with the mice in the K group, the relative abundances of Lactobacillus and Bacteroides in the mice of the M group were significantly decreased (P < 0.05). After the intervention of human milk oligosaccharide 6'-SL, the relative abundance of Lactobacillus in the M6 group of mice was significantly higher than that in the M group (P < 0.05). The relative abundance of Lactobacillus in the H6 group of mice was 7.56% higher than that in the M group, but there was no significant difference (P > 0.05). The relative abundance of Bacteroides in the H6 group was significantly higher than that in the M group (P < 0.05). In particular, the relative abundance of Bacteroides in the H6 group was significantly higher than that in the L6 group and the M6 group (P < 0.05).
[0173] ② As shown in Figure 5 D shown, compared with the K group, after the intervention of different doses of human milk oligosaccharide 6'-SL, the relative abundance of Akkermansia showed different degrees of increase (P > 0.05), and the relative abundance of Akkermansia in the H6 group was the highest at 3.22%.
[0174] ③ The relative abundances of Adlercreutzia in each group of mice were as shown in Figure 5 E shown, the relative abundance of Adlercreutzia in the mice of the M group was higher than that in the K group (P > 0.05). After the intervention of different doses of human milk oligosaccharide 6'-SL, the relative abundance of Adlercreutzia showed different degrees of decrease (P > 0.05). Among them, the relative abundance of Adlercreutzia in the H6 group was the lowest at 0.77%.
[0175] ④ As shown in Figure 5 F shown, compared with the K group, the relative abundance of Parabacteroides in the mice of the M group was significantly decreased (P < 0.05). Compared with the mice in the M group, after the intervention of low, medium, and high doses of 6'-SL (L6, M6, H6 groups), the relative abundances of Parabacteroides showed different degrees of increase. Among them, the relative abundances of Parabacteroides in the L6 group and the M6 group of mice were 1.48% and 1.42% respectively, which were significantly higher than that in the M group (P < 0.05).
[0176] The above results indicate that 6'-SL can effectively relieve constipation by regulating the relative abundances of gut microbiota at the genus level in constipated mice. Notably, high-dose 6'-SL intervention is more effective in regulating the relative abundances of Bacteroides, Akkermansia, and Adlercreutzia.
[0177] (5)Analysis of species differences in gut microbiota of mice in each group intervened with different doses of 6'-SL
[0178] Furthermore, LEfSe analysis was used to explore the key differential microorganisms in the gut microbiota of each group of mice. Linear discriminant analysis (LDA) was used to analyze the impact of the abundances of differential species on the differences between groups, and the LDA threshold was set at 3. As Figure 6 shown, at the genus level:
[0179] ① Lactobacillus and Streptococcus were significantly enriched in group K;
[0180] ② Ruminococcus, Allobaculum, Coprococcus, and Turicibacter were significantly enriched in group M;
[0181] ③ Bacteroides, Anaerotruncus, and Corynebacterium were significantly enriched in group L6;
[0182] ④ Anaeroplasma and Anaerostipes were significantly enriched in group M6, and Akkermansia was significantly enriched in group H6.
[0183] Among them, Bacteroides, Anaerotruncus, Anaeroplasma, and Anaerostipes are producers of short-chain fatty acids (SCFAs), which can regulate energy homeostasis, glucose / lipid metabolism, inflammation, and even immunity to improve the health of the host. Akkermansia plays an important role in the intestine, especially in participating in the metabolism of the intestinal mucus layer and promoting the health of intestinal epithelial cells. This helps to maintain the integrity of the intestinal barrier and prevent the invasion of pathogenic bacteria. The results indicate that intervention with different doses of 6'-SL can improve the symptoms of loperamide-induced constipation by increasing the relative abundances of some beneficial bacterial genera in the intestine.
[0184] 2.3 Short-chain fatty acids:
[0185] Short-chain fatty acids are short-chain fatty acid substances produced by the fermentation of carbohydrates such as dietary fiber by gut microbiota, mainly including acetic acid, propionic acid, butyric acid, valeric acid, etc. Short-chain fatty acids play an important role in maintaining the integrity of the intestinal barrier and the balance of the intestinal environment. Acetic acid is mainly involved in the metabolism of the brain, heart, kidneys and muscles in the body; propionic acid can inhibit the synthesis of hepatic cholesterol and reduce the cholesterol level in the serum; butyric acid has the functions of protecting the intestinal mucosa, anti-inflammation, enhancing gastrointestinal function, inhibiting the proliferation of tumor cells, inducing differentiation and apoptosis. In addition, the production of short-chain fatty acids can promote intestinal peristalsis, thus relieving constipation.
[0186] This invention studied the effects of different doses of 6'-SL on the levels of short-chain fatty acids including acetic acid, propionic acid, butyric acid and valeric acid in the intestinal contents of constipated mice. The results are shown in Table 5. Compared with the normal mice in the blank K group, the levels of acetic acid, propionic acid, butyric acid and valeric acid in the intestinal contents of the mice in the model M group intervened with loperamide were significantly decreased (P<0.05). Compared with the mice in the model M group, the contents of propionic acid and butyric acid in the intestinal contents of the mice intervened with high, medium and low doses of 6'-SL were significantly increased (P<0.05). The results indicate that 6'-SL has the efficacy of restoring the content of short-chain fatty acids in the intestines of constipated mice.
[0187] Table 5 Effects of nutrients on the content of short-chain fatty acids in mouse feces
[0188]
[0189] Note: *P<0.05 compared with the blank control K group; # P<0.05 compared with the model M group.
Claims
1. Use of human milk oligosaccharides in the preparation of a food for improving constipation, characterized in that, The milk oligosaccharide is 6'-sialyllactose; The constipation is functional constipation; The improvement of constipation includes the following improvements: (a) Increasing the water content of feces; (b) Enhancing intestinal motility; and / or (c) Regulating the SCF / C-kit signaling pathway.
2. The use according to claim 1, characterized in that, The regulation of the SCF / C-kit signaling pathway includes increasing the transcriptional levels of SCF and / or C-kit in colon tissue.
3. The use according to claim 1, characterized in that, The improvement of constipation also includes the following improvement: increasing the abundance and diversity of the intestinal flora.
4. The use according to claim 1, characterized in that, The improvement of constipation also includes the following improvement: regulating the structure of the intestinal flora.
5. The use according to claim 4, wherein The regulation of the intestinal flora structure includes at least one of reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.
6. The use according to claim 1, characterized in that, The improvement of constipation also includes the following improvement: restoring the content of short-chain fatty acids in the intestine.
7. The use according to claim 6, wherein The restoration of the content of short-chain fatty acids in the intestine includes increasing the content of at least one of acetic acid, propionic acid, butyric acid, and valeric acid.
8. Use of human milk oligosaccharides in the preparation of a food for improving the intestinal flora environment, characterized in that, The milk oligosaccharide is 6'-sialyllactose; The intestinal flora environment is the intestinal flora environment under constipation conditions.
9. The use according to claim 8, characterized in that, The improvement of the intestinal flora environment includes increasing the abundance and diversity of the intestinal flora and / or regulating the structure of the intestinal flora.
10. The use according to claim 9, wherein The increase in the abundance and diversity of the intestinal flora includes increasing the relative abundance of Verrucomicrobia.
11. The use according to claim 9, characterized in that, The increase in the abundance and diversity of the intestinal flora includes increasing the relative abundance of one or more genera of bacteria among Lactobacillus, Bacteroides, Akkermansia, Adlercreutzia, Parabacteroides, Corynebacterium, Anaerotruncus, Anaeroplasma, and Anaerostipes.
12. The use according to claim 9, characterized in that, The regulation of the intestinal flora structure includes at least one of reducing the ratio of Firmicutes to Bacteroidetes and reducing the relative abundance of Adlercreutzia.
13. The use according to any one of claims 1 to 12, characterized in that, The food is an oral preparation; the oral preparation includes at least one of tablets, pills, granules, powders, tea preparations, capsules, and oral liquids.
14. The use according to any one of claims 1 to 12, characterized in that, The food is confectionery, beverages, dairy products, baked foods, foods for special dietary uses, or dietary supplements.
15. The use according to any one of claims 1 to 12, characterized in that, In the food, the mass content of the milk oligosaccharide is at least 0.05%.
Citation Information
Patent Citations
Nutritional composition containing 2FL and LNnT
CN107847509B
Breast milk oligosaccharide composition for improving intestinal flora abundance and fecal odor of infants and application thereof
CN110839702A
Breast milk oligosaccharide for regulating butyric acid and improving intestinal microenvironment health and application thereof
CN114568504A
Application of oligosaccharide in preparation of product for regulating intestinal flora
CN115836733A
Application of breast milk oligosaccharide to improvement of intestinal flora of mothers and infants
CN119138609A