Application of microRNA in prevention or treatment of hepatic failure

By using miR-19b-3p, both free and exosome, intravenously administered to patients, the treatment problem of liver failure, especially acute liver failure, has been solved, significantly improved survival rate and improved liver function and pathological conditions.

CN120227388APending Publication Date: 2025-07-01金银鹏 +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311837738.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-28
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

The effects of miRNA on liver failure in the prior art have not been disclosed, and there is a lack of effective prevention or treatment methods, especially acute liver failure.

Method used

MiR-19b-3p, both free or exosome, is administered to the patient by intravenous injection, and is used to prepare a pharmaceutical composition for the prevention or treatment of liver failure and to provide corresponding treatment methods.

Benefits of technology

It significantly improved the 24-hour survival rate of rats with acute liver failure, improved liver function and liver tissue pathological changes, and provided a new material basis for the treatment of liver failure.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0004638046670000011
    Figure HDA0004638046670000011
  • Figure HDA0004638046670000012
    Figure HDA0004638046670000012
  • Figure HDA0004638046670000021
    Figure HDA0004638046670000021
Patent Text Reader

Abstract

The invention discloses miR-19b-3p which has a treatment effect on hepatic failure, particularly acute hepatic failure. Therefore, the miR-19b-3p can be prepared into the medicine for treating the hepatic failure, particularly the acute hepatic failure, so that a brand new material basis is laid for the development of the medicine for treating the hepatic failure.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine. Specifically, the present invention relates to the application of microRNA in the prevention or treatment of liver failure, especially acute liver failure. Background Art

[0002] Acute liver failure (ALF) is a severe liver injury caused by various factors, which further leads to a liver syndrome with severe disorders in liver synthesis, detoxification, excretion, and biotransformation.

[0003] Mesenchymal stem cells (MSCs) are a type of adult stem cells with self-renewal ability and multi-directional differentiation potential. Currently, many studies believe that MSCs are a feasible and safe method for treating ALF, which has been confirmed in various clinical and animal experiments. Human adipose-derived stem cells (hASCs) are a type of MSCs, and the therapeutic effect of hASCs is significantly related to the substances secreted by them. hASCs can promote angiogenesis at the transplantation site and have a trophic paracrine effect on the internal microenvironment of the liver to promote hepatocyte regeneration by autocrine exosomes, increasing the expression and secretion of various cytokines required for revascularization by surviving cells at the transplantation site. Among them, the autocrine exosomes of hASCs have been widely studied.

[0004] MicroRNA (miRNA) is a class of non-coding single-stranded RNA molecules encoded by endogenous genes, with a length of about 22 nucleotides. They participate in the regulation of post-transcriptional gene expression in animals and plants. Most miRNA genes exist in the genome in the form of single copies, multiple copies, or gene clusters. Each miRNA can have multiple target genes, and several miRNAs can also regulate the same gene. This complex regulatory network can either regulate the expression of multiple genes through one miRNA or precisely regulate the expression of a certain gene through the combination of several miRNAs. miRNA can regulate target mRNA by disrupting the stability of target mRNA and inhibiting the translation of target mRNA.

[0005] However, the effect of miRNA on liver failure has not been revealed in the prior art. Summary of the Invention

[0006] The object of the present invention is to provide a microRNA capable of preventing or treating liver failure, especially acute liver failure.

[0007] Another object of the present invention is to provide a pharmaceutical composition for preventing or treating liver failure, especially acute liver failure.

[0008] The present invention also aims to provide a method for preventing or treating liver failure, especially acute liver failure.

[0009] In a first aspect, the present invention provides the use of miR-19b-3p in the preparation of a drug for preventing or treating liver failure.

[0010] In a specific embodiment, the sequence of the miR-19b-3p is as shown in SEQ ID NO:1.

[0011] In a specific embodiment, the liver failure is acute liver failure.

[0012] In a specific embodiment, the miR-19b-3p is in free form or exosome form.

[0013] In a second aspect, the present invention provides a pharmaceutical composition, which comprises miR-19b-3p and a pharmaceutically acceptable excipient.

[0014] In a specific embodiment, the sequence of the miR-19b-3p is as shown in SEQ ID NO:1.

[0015] In a specific embodiment, it is characterized in that the miR-19b-3p is in free form or exosome form.

[0016] In a third aspect, the present invention provides miR-19b-3p, which is used as a drug for preventing or treating liver failure.

[0017] In a preferred embodiment, the sequence of the miR-19b-3p is as shown in SEQ ID NO:1.

[0018] In a preferred embodiment, the liver failure is acute liver failure.

[0019] In a preferred embodiment, the miR-19b-3p is in free form or exosome form.

[0020] In a fourth aspect, the present invention provides a pharmaceutical composition comprising miR-19b-3p and used for preventing or treating liver failure.

[0021] In a preferred embodiment, the sequence of the miR-19b-3p is as shown in SEQ ID NO:1.

[0022] In a preferred embodiment, the liver failure is acute liver failure.

[0023] In a preferred embodiment, the miR-19b-3p is in free form or exosome form.

[0024] In a fifth aspect, the present invention provides a method for preventing or treating liver failure, the method comprising the step of administering a prophylactically or therapeutically effective amount of miR-19b-3p or a pharmaceutical composition comprising miR-19b-3p to a subject in need thereof.

[0025] In a preferred embodiment, the sequence of the miR-19b-3p is as shown in SEQ ID NO:1.

[0026] In a preferred embodiment, the liver failure is acute liver failure.

[0027] In a preferred embodiment, the miR-19b-3p is in free form or exosome form.

[0028] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as in the examples) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be repeated here one by one. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 Shows the effects of exosomes and recombinant overexpressed miR-19b-3p exosomes on the overall 24h survival rate of ALF rats; among them, control is the PBS treatment group of ALF rats; EXO is the exosome treatment group of ALF rats; miR-19EXO is the recombinant overexpressed miR-19b-3p exosome treatment group of ALF rats.

[0030] Figure 2 Shows the detection of liver function in rats of each group.

[0031] Figure 3 Shows the pathological changes of liver tissues after treating ALF rats with exosomes and recombinant overexpressed miR-19b-3p exosomes observed by HE staining.

[0032] Figure 4 Shows the uptake of exosomes by liver tissues observed under an inverted microscope.

[0033] Figure 5 Shows the overall 24h survival rate of rats in each group. Among them, control is ALF rats treated with PBS; virustreatment is ALF rats in the pretreatment group with lentivirus overexpressing miR-19b-3p.

[0034] Figure 6 Shows the detection of liver function in rats of each group.

[0035] Figure 7 Shows the pathological changes of liver tissues of rats in each group observed by HE staining.

[0036] Figure 8 It shows the viral fluorescence expression in the liver tissue of the lentivirus treatment group observed under an inverted fluorescence microscope. Specific implementation manners

[0037] Through extensive and in-depth research, the inventors unexpectedly found in the in-vivo experiments of ALF rats that overexpression of miR-19b-3p can significantly improve the 24-hour survival rate of ALF rats, improve the pathological changes of liver tissue, and has a significant therapeutic effect; at the same time, pretreatment with lentivirus overexpressing miR-19b-3p significantly improves the 24-hour survival rate of ALF rats, up to 100%. Therefore, miR-19b-3p has a preventive or therapeutic effect on liver failure, especially acute liver failure, thus laying a completely new material basis for the development of preventive or therapeutic drugs for liver failure. The present invention was completed on this basis.

[0038] miR-19b-3p

[0039] In the present invention, miR-19b-3p is a microRNA, and its sequence is shown as SEQ ID NO:1 (UGUGCAAAUCCAUGCAAAACUGA).

[0040] To visually observe the therapeutic effect of miR-19b-3p on ALF rats, the inventors of the present invention injected lentivirus overexpressing miR-19b-3p via the tail vein, constructed an ALF model after miR-19b-3p was successfully expressed in the liver tissue, observed the overall survival rate of the rats within 24 hours, and detected liver function and HE staining of liver tissue. The results showed that lentivirus overexpressing miR-19b-3p significantly improved the overall 24-hour survival rate of ALF rats, had a tendency to improve liver function, and significantly improved the pathological changes of liver tissue. Based on all the above experimental results, it can be found that miR-19b-3p in free or exosome form has a significant therapeutic effect on ALF rats, which was further confirmed in the animal experiment of treating ALF rats with lentivirus overexpressing miR-19b-3p.

[0041] Free form or exosome form

[0042] The miR-19b-3p of the present invention can be administered in free form or in exosome form. The free form refers to miR-19b-3p not encapsulated by exosomes; the exosome form refers to exosomes highly expressing miR-19b-3p produced by various methods such as gene overexpression of miR-19b-3p.

[0043] Pharmaceutical composition

[0044] Based on the discovery that miR-19b-3p has a therapeutic effect on liver failure, especially acute liver failure, the present invention further provides a pharmaceutical composition comprising miR-19b-3p and a pharmaceutically acceptable excipient.

[0045] The pharmaceutically acceptable excipient can be selected from any pharmaceutically acceptable excipient as long as the selected excipient is suitable for administering miR-19b-3p in free or exosome form. The appropriate dose of miR-19b-3p in the pharmaceutical composition of the present invention can be determined by those skilled in the art according to various factors such as the age of the patient, the severity of liver failure, the gender of the patient, etc.

[0046] Treatment method

[0047] Based on the miR-19b-3p or pharmaceutical composition of the present invention, the present invention provides a method for treating liver failure, which comprises administering a therapeutically effective amount of miR-19b-3p or a pharmaceutical composition comprising miR-19b-3p to a subject in need thereof.

[0048] In the treatment, the specific administration method of the miR-19b-3p or pharmaceutical composition of the present invention can be determined independently by those skilled in the art. For example, the miR-19b-3p or pharmaceutical composition of the present invention can be administered by intravenous injection.

[0049] The main advantages of the present invention include:

[0050] 1. The inventors of the present invention first discovered that miR-19b-3p has a therapeutic effect on liver failure, especially acute liver failure;

[0051] 2. The miR-19b-3p of the present invention lays a new material foundation for the development of therapeutic drugs for liver failure.

[0052] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer.

[0053] Example 1. Exploration on the treatment of acute liver failure rats with recombinant overexpressed miR-19b-3p exosomes

[0054] 1. Materials and methods

[0055] 1.1 Materials

[0056] 1.1.1 Experimental animals

[0057] 78 healthy male SPF-grade Sprague Dawley (SD) rats (provided by Shanghai Bikai Experimental Animal Co., Ltd. and approved by the Ethics Committee of Tongji University) were 4-6 weeks old and weighed about 140-160 g. They were fed in the SPF-grade environment of the Animal Experiment Center of Tongji University at a room temperature of 18-22 °C and a humidity of 55-60%. The sterile bedding was changed once a week, and the rats were housed separately in cages with free access to food and water.

[0058] 1.1.2 Main consumables

[0059] Tissue scissors, wire scissors, surgical suture, needle holder, disposable sterile syringe, non-toothed forceps, toothed forceps, cotton, 1.5 ml EP tubes, 15 ml centrifuge tubes, 50 ml centrifuge tubes, ultrafiltration concentrator centrifuge tubes (Merk, Ireland), 10 cm culture dishes, sterile pipettes, pipettes, sterile pipette tips, rat fixator, surgical knife handle, blade.

[0060] 1.1.3 Experimental instruments

[0061] Multifunctional microplate reader (SoftMax Pro5, Molecular Devices, USA), constant temperature incubator (Thermo, USA), centrifuge (TD25-WS, Luxiangyi, Shanghai, China), Milli-Q pure water preparation device (Millipore, USA), laminar flow hood (Antai, Suzhou, China), DK-8B type electrothermal constant temperature water bath (Shanghai Hualian, Shanghai).

[0062] 1.1.4 Experimental reagents

[0063] DMEM-F12 medium (Hyclone, USA), 10% fetal bovine serum (FBS) (Gibco, USA), carbon tetrachloride (Sinopharm), 0.25% trypsin (Gibco, USA), double antibody reagent (Gibco, USA), 4% paraformaldehyde (Dingguo Changsheng Biotechnology, Beijing, China), BCA kit (Solarbio, Beijing, China), Trizol reagent (Thermo, USA), HE kit (Solarbio, Beijing, China), Sirius red kit (Solarbio, Beijing, China), Masson trichrome kit ELISA kit (Solarbio, Beijing, China).

[0064] 1.2 Methods

[0065] 1.2.1 Construction of acute liver failure rat model and experimental grouping

[0066] To avoid possible gender differences, 32 healthy male SPF-grade Sprague Dawley (SD) rats (provided by Shanghai Slack Experimental Animal Co., Ltd., license number: SC×K (Shanghai) 2007-0005), 4-6 weeks old, weighing about 120-140 g, were fed in the SPF-grade environment of the Animal Experiment Center of Tongji University, housed separately in cages, and allowed free access to food and water.

[0067] Establish an ALF rat model: D-gal combined with LPS was dissolved in 500 μl of PBS for intraperitoneal injection (containing 800 mg / kg D-gal and 8 μg LPS). The 32 rats were randomly divided into 4 groups, with 8 rats in each group.

[0068] Exosome or recombinant overexpressed miR-19b-3p exosome injection: The rats were fixed in a rat fixator, the tail was exposed, the tail vein area was disinfected with a 75% alcohol cotton ball, the tail vein was gently patted to make it full, a disposable 1 ml syringe was connected to a 30G 1 / 2 needle, and 500 μl of exosomes, recombinant overexpressed miR-19b-3p exosomes or PBS were injected according to the experimental grouping. After injection, compression hemostasis was performed.

[0069] Experimental grouping:

[0070] A: SD rats + PBS (500 μl)

[0071] B: SD rats + D-gal / LPS + PBS (500 μl)

[0072] C: SD rats + D-gal / LPS + wild-type exosomes (100 μg, 500 μl)

[0073] D: SD rats + D-gal / LPS + recombinant overexpressed miR-19b-3p exosomes (100 μg, 500 μl)

[0074] 1.2.3 Rat material collection

[0075] The rats were continuously observed for 24 h. Rats that died within 24 h were immediately dissected, and rats that did not die at 24 h were sacrificed by cervical dislocation: Blood was collected from the heart, centrifuged at 13,400 rpm (the maximum centrifugation rate in the laboratory) for 20 minutes, the supernatant was aspirated into a new EP tube, and stored at -20 °C for liver function measurement; Liver tissue was cut into pieces of 1 cm × 1 cm × 1 cm, washed with PBS, and then a part was immersed in 4% paraformaldehyde and stored at 4 °C for paraffin embedding and HE staining, another part of the liver tissue was directly frozen at -80 °C after being cooled by liquid nitrogen for later use, and a part of the liver tissue was immediately prepared into tissue homogenate and stored at -20 °C for later use.

[0076] 1.2.4 Observation indicators

[0077] Observe and record the general conditions of the rats, such as their activities, food intake, urine, responses to stimuli, etc., and check for symptoms such as lethargy and coma, as well as the overall 24-hour survival rate.

[0078] 1.2.5 Liver function indicators

[0079] After each sample of rat serum was taken out from -20°C and restored to room temperature, it was diluted tenfold, and 0.2 mL was taken from each and loaded onto the sample in sequence. The levels of ALB, ALT, and AST in the rats were detected using a serum biochemical analyzer, and the measured values were multiplied by the dilution factor to obtain the liver function indicator values of each rat.

[0080] 1.2.6 Tracking of liver tissue after exosome labeling

[0081] Exosome labeling: Take 50 μL of 10x Exo-Red or Exo-Green into a 1.5 mL EP tube, add 450 μL of exosome suspension resuspended in 1×PBS to make the total volume 500 μL, mix by inverting up and down, and incubate at 37°C for 10 min; add 100 μL of ExoQuick-TC reagent and vortex 6 times to terminate the reaction. The labeled exosome suspension was placed on ice for 30 min; centrifuged at 14,000 rpm for 3 min, the supernatant was discarded, and the labeled exosomes were resuspended in 1×PBS for standby. After the ALF rats were modeled, the labeled exosomes were injected into the tail vein. When the rats died, the liver tissue was obtained, rinsed clean with PBS, fixed with 4% paraformaldehyde, and frozen sections were made for observation.

[0082] Preparation and observation of frozen sections of liver tissue: Take the liver tissue fixed with 4% paraformaldehyde, put it into 30% sucrose, and dehydrate at 4°C. When the liver tissue sinks from floating on the surface of the sucrose to the bottom of the sucrose solution, it indicates that the liver tissue is fully dehydrated, usually for 24 h; the dehydrated liver tissue is embedded in OCT, fully frozen at -20°C, and then sliced with a cryostat. The slice thickness is 5 μm. After the liver tissue is cut, it is immediately pasted onto a glass slide, and the fluorescence of exosomes inside and outside the liver tissue is observed under an inverted microscope.

[0083] 1.2.7 HE staining of liver tissue specimens of rats in each group

[0084] It should be noted that in the original text, the unit of the slice thickness in item is incorrect. It should be "μm" instead of "mm". The translation has been corrected accordingly.The liver tissues fixed with 4% paraformaldehyde were routinely embedded in paraffin and sectioned. The paraffin sections were dewaxed and hydrated: dewaxed in xylene (I) for 5 min, changed to fresh xylene (II) and dewaxed for another 5 min, absolute ethanol for 5 min, 95% ethanol for 2 min, 80% ethanol for 2 min, 70% ethanol for 2 min, distilled water for 2 min; stained with hematoxylin solution for 10 min, rinsed with tap water, differentiated with differentiating solution for 30 s and then soaked in tap water for 15 min or in warm water (about 50 °C) for 5 min; placed in eosin staining solution for 2 min, rinsed with tap water and then soaked in tap water for 2 min; dehydrated, cleared and sealed: 95% ethanol (I) for 1 min, 95% ethanol (II) for 1 min, 100% ethanol (I) for 1 min, 100% ethanol (II) for 1 min, xylene phenol (3:1) for 1 min, xylene (I) for 1 min, xylene (II) for 1 min, sealed with neutral gum, and observed under the microscope.

[0085] 2. Results

[0086] 2.1 General conditions of rats

[0087] After 4 h of intraperitoneal injection of D-gal / LPS in the model group, the activities and food intake of rats began to decrease, deep yellow jaundiced urine began to appear, and the response to stimuli gradually declined. At 6 h, symptoms such as lethargy appeared in rats, indicating that the ALF rat model was successfully constructed. The above symptoms gradually appeared in the rats with successfully constructed ALF model after 7 h of exosome treatment, and in the group of ALF rats treated with overexpressed miR-19b-3p exosomes, the above symptoms gradually appeared at 15 h, and the severity was lighter than that of the PBS and exosome treatment groups.

[0088] 2.2 Overall survival rate of ALF rats observed for 24 h after treatment with exosomes or recombinant overexpressed miR-19b-3p exosomes

[0089] As Figure 1 shown, after successfully constructing the ALF rat model by intraperitoneal injection of D-gal / LPS, the overall 24-h survival rate of rats in the PBS treatment group was only 27.1%, suggesting that rats had fulminant liver failure. The overall 24-h survival rate of ALF rats in the exosome treatment group was 24.7%, showing no difference from the control group, suggesting that exosomes had no effect on the 24-h survival rate of ALF rats. The survival rate of ALF rats in the recombinant overexpressed miR-19b-3p exosome treatment group increased significantly (66.7%), suggesting that miR-19b-3p in the form of exosomes had a significant improvement effect on the 24-h survival rate of ALF rats.

[0090] 2.3 Detection of liver function in rats of each group

[0091] As Figure 2As shown, the liver function indices ALT and AST of ALF rats increased significantly, and the rats developed severe fulminant liver failure. Albumin decreased somewhat, but there was no significant difference. Both exosomes and exosomes recombinantly overexpressing miR-19b-3p decreased the expression of ALT and AST in ALF rats and reduced liver tissue damage. Compared with the exosome group, the exosomes recombinantly overexpressing miR-19b-3p had a stronger improving effect on ALT and AST, but there was no statistical difference between the two, indicating that exosomes and exosomes recombinantly overexpressing miR-19b-3p had a tendency to improve liver function. Moreover, there was no difference in the improvement of ALB between exosomes and exosomes recombinantly overexpressing miR-19b-3p. The possible mechanism was that the half-life of ALB was 2 weeks, and the liver function test samples in this study were taken at 24 h, which was too short to show the improving tendency of exosomes or exosomes recombinantly overexpressing miR-19b-3p on the liver function index ALB of ALF rats.

[0092] 2.4 Effects of exosomes or exosomes recombinantly overexpressing miR-19b-3p on the pathological changes of liver tissues in each group of ALF rats

[0093] As Figure 3 shown, the normal hepatic lobule structure of ALF rats in the PBS treatment group disappeared, and a large number of inflammatory cells infiltrated. The hepatic lobule structure of the liver tissue of ALF rats in the wild-type exosome treatment group still existed, but there were still a large number of inflammatory cells infiltrating, indicating that exosomes could improve the pathological changes of liver tissues in ALF rats. The hepatic lobule structure of the liver tissue of ALF rats in the exosomes recombinantly overexpressing miR-19b-3p treatment group was still clearly visible, and only a small number of inflammatory cells infiltrated, indicating that the exosomes recombinantly overexpressing miR-19b-3p could significantly improve the pathological changes of liver tissues in ALF rats, and the improvement degree was more significant than that of the exosome treatment group, indicating that miR-19b-3p in the form of exosomes could significantly improve the pathological changes of liver tissues in ALF rats.

[0094] 2.5 Tracking of fluorescently labeled exosomes in liver tissues

[0095] As Figure 4 shown, ALF rats were injected with fluorescently labeled exosomes via the tail vein, and frozen sections of liver tissues were made and observed for fluorescence expression under an inverted microscope. Exosome proteins labeled with green fluorescence were visible in the hepatic lobules, and exosome nucleic acids labeled with red fluorescence could be observed at the same site, indicating that the exosomes entered the liver tissues after being injected via the tail vein and played a therapeutic role.

[0096] 3 Discussion

[0097] The liver performs a series of life activities in the body, such as biosynthesis, biotransformation, and detoxification. It not only participates in the metabolism of substances such as carbohydrates, lipids, and proteins but also in the metabolism of substances such as drugs, alcohol, and poisons. Various pathogenic factors such as abnormal metabolism of drugs and microorganisms can cause liver damage, often accompanied by inflammation, liver fibrosis, and cirrhosis, and even the occurrence of ALF and HCC. Liver transplantation is the only effective treatment for the end stage of various liver diseases such as fulminant hepatic failure. However, due to the shortage of liver donors and the huge cost of surgery and postoperative treatment, many patients with surgical indications have not received treatment. Therefore, new treatment methods are urgently needed. Since stem cells have strong regeneration and differentiation potential and can be used for the restoration of the functions of various damaged organs, the mechanism of their repair of organ functions mainly tends to two aspects: the transformation of stem cells into parenchymal tissue cells and paracrine substances. Among them, the role of paracrine exosomes has been widely studied.

[0098] Exosomes injected via the tail vein can enter the liver tissue through the blood circulation and play a therapeutic role in the liver tissue. Recombinant overexpressed miR-19b-3p exosomes significantly increase the overall 24h survival rate of ALF rats, indicating that miR-19b-3p in the form of exosomes has a significant therapeutic effect on ALF rats. Both exosomes and recombinant overexpressed miR-19b-3p exosomes tend to improve liver function. The improvement of liver function in ALF rats is affected by many factors, and the treatment time of exosomes in this experiment is relatively short, so there is no obvious change in the improvement of liver function in a short time.

[0099] 4. Conclusions

[0100] 4.1 Effects of exosomes and recombinant overexpressed miR-19b-3p exosomes on the general condition, liver function, and overall survival rate of rats

[0101] MiR-19b-3p in the form of exosomes can significantly improve the general conditions of rats such as food intake and mental state, has a tendency to improve liver function, and significantly increases the overall 24h survival rate of ALF rats, showing a significant therapeutic effect on ALF rats.

[0102] 4.2 Effects of exosomes and recombinant overexpressed miR-19b-3p exosomes on the pathological changes of liver tissue in ALF rats

[0103] Both wild-type and recombinant overexpressed miR-19b-3p exosomes can relieve the pathological damage of ALF liver tissue, and the recombinant overexpressed miR-19b-3p exosomes have a more significant pathological improvement effect on the liver tissue of ALF rats.

[0104] Example 2. Exploration of the treatment of ALF rats by pretreatment with lentivirus overexpressing miR-19b-3p

[0105] 1. Materials and methods

[0106] 1.1 The materials are the same as before.

[0107] 1.2 Methods

[0108] 1.2.1 Construction of acute liver failure model

[0109] Rats: To avoid possible gender differences, 24 healthy male SPF-grade Sprague Dawley (SD) rats (provided by Shanghai Slake Laboratory Animal Co., Ltd., license number: SC×K (Shanghai) 2007-0005), 4-6 weeks old, weighing about 120-140 g, were fed in the SPF-grade environment of the Animal Experiment Center of Tongji University, housed separately in cages, and allowed free access to food and water.

[0110] Construction of lentivirus overexpressing miR-19b-3p:

[0111] Packaging of lentivirus overexpressing miR-19b-3p: When 293T cells were cultured in a 10 cm culture dish until 80-90% confluent, they were seeded into a 15 cm culture dish. The culture medium was removed, and the cells were washed twice with 1 ml of D-Hank’s solution. 1 ml of Trypsin-EDTA solution was added, mixed well, and placed at 37 °C for 2-3 minutes. The trypsin solution was carefully aspirated, and 2 ml of DMEM culture medium containing 10% FBS was added. The cells were pipetted to form a single-cell suspension. The cell suspension was seeded into a 15 cm culture dish, and 18 ml of DMEM culture medium containing 10% FBS was added. After mixing, the cells were cultured overnight in a 37 °C, 5% CO2 cell culture incubator. 1.5 ml of serum-free DMEM was added to a sterile 5 ml centrifuge tube, and the shuttle plasmid C9638 and packaging plasmids (pGag / Pol, pRev, pVSV-G) were added in proportion and mixed well. Another sterile 5 ml centrifuge tube was taken, 1.5 ml of serum-free DMEM was added, and 300 μl of RNAi-mate was added and mixed well. After standing at room temperature for 5 minutes, the two tubes were mixed and left at room temperature for 20-25 minutes. The culture medium in the 15 cm culture dish was removed, and 8 ml of serum-free DMEM culture medium was added. The transfection mixture was added dropwise to the 15 cm culture dish, and the culture dish was gently shaken back and forth to mix the complex. The cells were incubated in a 37 °C, 5% CO2 culture incubator for 4-6 hours. The transfection solution was aspirated, and 18 ml of DMEM culture medium containing 10% FBS was added. The cells were continued to be cultured in a 37 °C, 5% CO2 cell culture incubator for 72 hours.

[0112] Lentivirus collection: Aspirate the cell supernatant in the culture dish into a 50-ml centrifuge tube and centrifuge at 4000 rpm for 4 min at 4°C. After centrifugation, pour the supernatant of the centrifuge tube into a 50-ml syringe and filter it through a 0.45-μm filter. The filtrate is ultracentrifuged in a centrifuge at 20000 rpm for 2 h at 4°C. Collect the concentrated solution into a 1.5-ml EP tube and store it in a -80°C refrigerator for later use.

[0113] Construction of ALF rat model, lentivirus injection and experimental grouping:

[0114] A: Normal rats + PBS

[0115] B: Normal rats + pretreatment with lentivirus overexpressing miR-19b-3p for 72 h + D-gal / LPS

[0116] C: Normal rats + D-gal / LPS + PBS (the drug injection time is the same as that in group B)

[0117] Lentivirus injection via the tail vein: The method is the same as that for exosome injection via the tail vein. Inject 500 μl of lentivirus with a titer of 7×10^8 U / ml per rat via the tail vein. The in vivo expression time of the lentivirus is usually 72 h. The subsequent experiments are carried out 72 h after the lentivirus injection via the tail vein in this experiment.

[0118] Construction of ALF rat model: The drug dosage and method for constructing the ALF rat model are the same as those in the first part of the animal experiment. After 72 h of lentivirus injection via the tail vein in the rats of the lentivirus pretreatment group, all groups of rats are simultaneously injected with D-gal / LPS to construct an ALF animal model and injected with an equal volume of PBS. The remaining treatment methods are the same as above.

[0119] 1.2.2 Rat sampling

[0120] The sampling content and method are the same as those in the first part of the animal experiment. If the ALF rats do not die within 24 h, they are sacrificed by cervical dislocation for sampling.

[0121] 1.2.3 Observation indicators:

[0122] Tracking of lentivirus in liver tissue, HE staining of liver tissue.

[0123] 2. Results

[0124] 2.1 General conditions of rats

[0125] During the 72 hours after tail vein injection of lentivirus, the activities and food intake of the rats were normal, they were sensitive to stimuli, and their mental state was good. In each experimental group, an ALF rat model was constructed by intraperitoneal injection of D-gal / LPS. In the PBS-treated ALF rat control group, the rats began to show reduced activity and food intake at 6 hours, developed dark yellow jaundiced urine, and the sensitivity to stimuli decreased. At 10 hours, they began to show lethargy and other conditions. However, the rats pretreated with lentivirus did not show reduced activity and food intake until 17 hours after the ALF model was constructed, but the reduction was not obvious, there was mild jaundiced urine, and there was no obvious change in the sensitivity to stimuli. None of the ALF rats in the lentivirus treatment pretreatment group showed symptoms such as lethargy within 24 hours.

[0126] 2.2 Overall survival rate of rats in each group at 24 h

[0127] As Figure 5 shown, the overall survival rate of ALF rats in the PBS treatment group at 24 h was only 31.25%, and the ALF rat model was successfully constructed. The overall survival rate of ALF rats in the lentivirus pretreatment group overexpressing miR-19b-3p was as high as 100% at 24 h, indicating that lentivirus pretreatment significantly improved the overall survival rate of ALF rats at 24 h, more intuitively reflecting the therapeutic effect of miR-19b-3p on ALF rats.

[0128] 2.3 Liver function tests of rats in each group

[0129] As Figure 6 shown, when rats developed ALF, the liver function indexes AST and ALT increased significantly, indicating liver function impairment. Lentivirus pretreatment overexpressing miR-19b-3p reduced the expression of AST and ALT, but there was no statistical difference compared with the control group, suggesting that lentivirus has a tendency to improve the liver function of ALF rats.

[0130] 2.4 HE staining of liver tissues of rats in each group

[0131] As Figure 7 shown, in the liver tissues of ALF rats, the normal hepatic lobule structure disappeared, and a large number of inflammatory cells such as eosinophils infiltrated, indicating that the ALF rat model was successfully constructed. When ALF occurred in the rats in the lentivirus pretreatment group overexpressing miR-19b-3p, the hepatic plate structure composed of hepatocytes was still clearly visible in the liver tissue, and only a small amount of inflammatory cells infiltrated, indicating that lentivirus pretreatment overexpressing miR-19b-3p could significantly improve the pathological damage of the liver tissues of ALF rats.

[0132] 2.5 Lentivirus tracking in liver tissues

[0133] As Figure 8As shown, the lentivirus overexpressing miR-19b-3p carried GFP fluorescence. After treating ALF rats by injecting the lentivirus via the tail vein, frozen sections of liver tissues were made, and green fluorescence expression could be observed in the liver lobules under an inverted fluorescence microscope, indicating that after the lentivirus was injected via the tail vein, it entered the liver tissues with the blood to exert its therapeutic effect.

[0134] 3. Discussion

[0135] The research in this example mainly explored the therapeutic effect of pretreatment with lentivirus overexpressing miR-19b-3p on ALF rats.

[0136] To further visually observe the therapeutic mechanism of miR-19b-3p on ALF rats, in this example of research, after pretreating rats with lentivirus overexpressing miR-19b-3p, its protective effect on ALF rats was observed.

[0137] Normal rats were injected with a lentiviral vector encoding miR-19b-3p via the tail vein. After 72 hours of expression, an ALF rat model was constructed to observe its therapeutic effect. Green fluorescence was visible in the liver tissues in frozen sections of the liver, indicating that the lentivirus overexpressing miR-29b-3p entered the liver tissues with the blood circulation after being injected via the tail vein to exert its therapeutic effect. When ALF occurred in the rats in the lentivirus overexpressing miR-29b-3p pretreatment group, the liver lobule structure in the liver tissues was still clearly visible, with only a small amount of inflammatory cell infiltration, indicating that pretreatment with lentivirus overexpressing miR-29b-3p could significantly improve the pathological changes of the liver tissues in ALF rats. The results of this example showed that exosomes overexpressing miR-19b-3p could significantly improve the overall 24-hour survival rate of ALF rats (66.7%), while pretreatment with lentivirus expressing miR-19b-3p more significantly improved the overall 24-hour survival rate of ALF rats (100%). It can be seen that miR-19b-3p has a significant effect on improving the overall 24-hour survival rate of ALF rats. The difference in the survival rates between the two groups of animal experiments may be due to the complex substances in the exosomes, and the specific mechanism of action is relatively complex. More mechanisms need to be explored through more research.

[0138] Based on all the above test results, exosomes derived from hASCs overexpressing miR-19b-3p have a therapeutic effect on ALF rats, and pretreatment with lentivirus overexpressing miR-19b-3p on ALF rats more intuitively reflects its therapeutic mechanism. There may be multiple mechanisms for the therapeutic effect of miR-19b-3p on ALF rats, and more mechanisms need to be explored in further research in the future.

[0139] 4. Conclusion

[0140] 4.1 Effects of lentivirus pre-treatment overexpressing miR-19b-3p on the general condition, liver function and survival rate of ALF rats

[0141] Lentivirus pre-treatment overexpressing miR-19b-3p significantly improved the general condition of ALF rats, showing a tendency to improve liver function. The 24-hour survival rate of rats in the lentivirus pre-treatment group overexpressing miR-19b-3p was as high as 100%, more intuitively revealing that miR-19b-3p could significantly increase the 24-hour survival rate of ALF rats.

[0142] 4.2 Effects of lentivirus pre-treatment overexpressing miR-19b-3p on the pathological changes of liver tissues in ALF rats

[0143] In the ALF rats in the lentivirus pre-treatment group overexpressing miR-19b-3p, the hepatic lobule structure of the liver tissue was clearly visible, with only a small amount of inflammatory cell infiltration, indicating that miR-19b-3p could significantly improve the pathological changes of liver tissues in ALF rats.

[0144] All the documents mentioned in the present invention are cited herein as references, as if each document was individually cited as a reference. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

1. Use of miR-19b-3p in the preparation of a drug for preventing or treating liver failure.

2. The use according to claim 1, characterized in that, The sequence of the miR-19b-3p is as shown in SEQ ID NO:

1.

3. The use according to claim 1 or 2, characterized in that, The liver failure is acute liver failure.

4. The use according to claim 1 or 2, characterized in that, The miR-19b-3p is in free form or exosome form.

5. A pharmaceutical composition, which comprises miR-19b-3p and a pharmaceutically acceptable excipient.

6. The pharmaceutical composition according to claim 5, characterized in that, The sequence of the miR-19b-3p is as shown in SEQ ID NO:

1.

7. The pharmaceutical composition according to claim 5 or 6, characterized in that The miR-19b-3p is in free form or exosome form.

8. miR-19b-3p, used as a drug for preventing or treating liver failure.

9. A pharmaceutical composition comprising miR-19b-3p and used for preventing or treating liver failure.

10. A method for preventing or treating liver failure, which comprises the step of administering a prophylactically or therapeutically effective amount of miR-19b-3p or a pharmaceutical composition comprising miR-19b-3p to a subject in need thereof.