Fungus mannan-based training immunity inducer and application thereof

Abstract

The invention discloses a training immunity inducer based on fungal mannan and application of the training immunity inducer. Specifically, the invention provides a flo8 gene deleted candida albicans biosynthesized mannan (FM), the FM can specifically induce the monomethylation modification of macrophage histone H3K79, and the FIM is used as a training immunity inducer; or the active ingredients are used for preparing health-care products; or the active component is used for preparing a medical instrument, and the FM provided by the invention can convert the immunosuppression state of tumor-associated macrophages into an M1-type anti-tumor state, so that the antigen-specific adaptive immunity is enhanced, the tumor development is reduced, and the tumor metastasis is controlled.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and more particularly, to a trained immunity inducer based on fungal mannan and its application. Background Art

[0002] The interaction between the tumor microenvironment and tumor cells plays a decisive role in the occurrence, progression, metastasis and response to treatment of tumors. Immunotherapy strategies targeting tumor-infiltrating T cells in the microenvironment have been widely studied and applied clinically. Tumor-associated macrophages are abundant in a variety of microenvironments and help cancer cells escape immunity, promote angiogenesis switching, and accelerate tumor cell metastasis. Given the immunosuppressive function of tumor-associated macrophages, a variety of drugs that block cell chemotaxis have entered the clinical trial stage, but the side effects caused by interfering with the migration function of normal macrophages have always been a common problem of such drugs. Therefore, the means of activating the trained immunity mechanism to change the activity of tumor-associated macrophages has been proven effective in preclinical studies and has the potential to become a new treatment strategy.

[0003] Trained immunity is the process by which innate immune cells acquire "immune memory" after experiencing pathogen stimulation. Trained immunity enables long-term functional reprogramming of innate immune cells induced by exogenous or endogenous stimulants. After returning to the inactive state, the effector factor function produced after re-stimulation is enhanced, and the body can produce an immune response more quickly and efficiently. Therefore, a trained immunity inducer can transform the immunosuppressive activity of tumor-associated macrophages into an anti-tumor state, promote the establishment and maintenance of antigen-specific adaptive immunity, and thus reduce tumor progression and control tumor metastasis. Currently, Bacille Calmette-Guérin (BCG) induces trained immunity and is widely used in the care treatment of non-muscle invasive bladder cancer (NMIBC), but its composition is complex and there are large individual differences. β-1,3-glucan can train macrophages in lung cancer and pancreatic cancer, thereby controlling cancer lung metastasis and the occurrence of pancreatic cancer, but glucan has poor water solubility, and the molecular weight ranges of different components vary greatly, and the activities are also different, which hinders its application as a drug in clinical practice.

[0004] Therefore, the development of more suitable trained immunity inducers for drug formation can significantly promote the progress of the field of tumor immunotherapy. Summary of the Invention

[0005] Aiming at the above problems, the purpose of the present invention is to provide a trained immunity inducer based on fungal mannan and its application.

[0006] The present invention for the first time reports that mannan biosynthesized by Candida albicans with flo8 gene deletion (flo8 mutant mannan, FM) can specifically induce monomethylation modification of histone H3K79 in macrophages. By using FIM as a training immunomodulator, the immunosuppressive state of tumor-associated macrophages can be transformed into an anti-tumor M1 state, thereby enhancing antigen-specific adaptive immunity, reducing tumor progression and controlling tumor metastasis.

[0007] In the first aspect of the present invention, there is provided the use of an active ingredient selected from mannan derived from Candida albicans with Flo8 gene deletion, or a pharmaceutically acceptable salt thereof, or an active derivative thereof, and the active ingredient is used for a drug or kit for preventing and / or treating tumors; or the active ingredient is used for preparing a preparation or composition for inducing trained immunity; or the active ingredient is used for preparing a trained immunity inducer; or the active ingredient is used for preparing a health product; or the active ingredient is used for preparing a medical device.

[0008] In another preferred embodiment, the trained immunity inducer includes: an innate immunity trainer, a non-specific immunity enhancer, an innate immunity memory activator, an epigenetic immunomodulator, a broad-spectrum immunomodulator or a macrophage memory inducer.

[0009] In another preferred embodiment, the trained immunity is an enhanced response of innate immune cells and / or non-traditional immune cells to a stimulus again.

[0010] In another preferred embodiment, the innate immune cells are selected from monocytes, macrophages, dendritic cells, natural killer cells and granulocytes, preferably macrophages.

[0011] In another preferred embodiment, the non-traditional immune cells are selected from endothelial cells and epidermal cells.

[0012] In another preferred embodiment, the drug is also used for the following purposes: (y1) Promote the up-regulation of TNF-α expression; (y2) Promote the up-regulation of CD86 expression; (y3) Promote the up-regulation of iNOS expression; (y4) Reduce Arg-1 expression; (y5) Promote the monomethylation modification of histone H3K79 (H3K79me1) in macrophages; (y6) Promote the acetylation modification of histone H3K23 (H3K23ac) in macrophages; and / or (y7) Promote the acetylation modification of histone H3K27 (H3K27ac) in macrophages.

[0013] In another preferred embodiment, the drug is also used for the following purposes: activating the ERK signaling pathway and / or promoting glycolysis.

[0014] In another preferred embodiment, the dosage of the drug is 0.1 - 100 μg / mL, preferably 1 - 50 μg / mL, more preferably 1 - 10 μg / mL, based on the concentration of mannan derived from Flo8 gene-deleted Candida albicans.

[0015] In another preferred embodiment, the dosage of the drug is 1 - 1000 mg / kg / day, preferably 20 - 500 mg / kg / day, more preferably 25 - 200 mg / kg / day, based on the dosage of mannan derived from Flo8 gene-deleted Candida albicans.

[0016] In another preferred embodiment, the tumors include: lung cancer, bladder cancer, liver cancer, gastric cancer, colon cancer, melanoma, breast cancer; The medical devices include but are not limited to: medical dressings; The health products include but are not limited to: oral health products, function-oriented health products, and health products with special forms; The medical dressings include but are not limited to: band-aids, chronic wound dressings; The dosage forms of the oral health products include but are not limited to: tablets, capsules, oral liquids, powders or granules; The function-oriented health products include but are not limited to: health products for enhancing immunity; The health products with special forms include but are not limited to: health drinks and health candies.

[0017] In another preferred embodiment, the tumors do not include colon cancer.

[0018] In another preferred embodiment, the derivatives include prodrugs.

[0019] In another preferred embodiment, the drug is administered to a subject selected from the group consisting of: rodents or primates (human or non-human primates).

[0020] In another preferred embodiment, the subject has one or more characteristics selected from the group consisting of: (y1) The subject has a low TNFα expression level; (y2) The subject has a low CD86 expression level; (y3) The subject has a low iNOS expression level; (y4) The subject has a high Arg-1 expression level; (y5) The level of H3K79 monomethylation modification (H3K79me1) of the histone of macrophages of the subject is low; (y6) The level of H3K23 acetylation modification (H3K23ac) of the histone of macrophages of the subject is low; and / or (y7) The level of H3K27 acetylation modification (H3K27ac) of the histone of macrophages of the subject is low.

[0021] In another preferred embodiment, the "low" refers to the expression level, methylation level or acetylation modification level being significantly lower than the reference value; the "high" refers to the expression level being significantly higher than the reference value.

[0022] In another preferred embodiment, the reference value is the expression level, methylation level or acetylation modification level of the corresponding gene in normal subjects (subjects without tumors).

[0023] In another preferred embodiment, the "significantly lower" means that the expression level ≤ 2 / 3 of the reference value, preferably ≤ 1 / 2 of the reference value, more preferably ≤ 1 / 3 of the reference value.

[0024] In another preferred embodiment, the "significantly higher" means that the expression level ≥ 4 / 3 of the reference value, preferably ≥ 3 / 2 of the reference value, more preferably ≥ 2 times of the reference value.

[0025] In another preferred embodiment, the drug is administered before tumor modeling in tumor patients.

[0026] In another preferred embodiment, the drug includes: (z1) A first active ingredient, mannan derived from Candida albicans with Flo8 gene deletion, or a pharmaceutically acceptable salt thereof, or a derivative thereof; (z2) Optionally, a second active ingredient, other drugs for preventing and / or treating tumors or immune induction agents; and (z3) A pharmaceutically acceptable carrier.

[0027] In another preferred embodiment, in the drug, the component (z1) accounts for 1-99 wt% of the total weight of the drug, preferably 10-90 wt%, more preferably 30-70 wt%.

[0028] In another preferred embodiment, the other drugs for preventing and / or treating tumors include (but are not limited to): paclitaxel, cisplatin, dacarbazine, gemcitabine, fluorouracil, oxaliplatin, doxorubicin, pemetrexed.

[0029] In another preferred embodiment, the training immune inducer includes (but is not limited to): β-glucan, wild-type Candida albicans-derived mannan (WYM), Bacille Calmette-Guérin (BCG), oxidized low-density lipoprotein, uric acid crystals, succinate, influenza virus vaccine.

[0030] In another preferred embodiment, the drug can be a single compound or a pharmaceutical composition composed of a mixture of multiple compounds.

[0031] In another preferred embodiment, the drug is used to prepare a drug or preparation for preventing and / or treating tumors.

[0032] In another preferred embodiment, the dosage form of the drug is an oral dosage form or a non-oral dosage form.

[0033] In another preferred embodiment, the oral dosage form is a tablet, powder, granule or capsule, or an emulsion or syrup.

[0034] In another preferred embodiment, the non-oral dosage form is an injection or a syringe.

[0035] In another preferred embodiment, the drug is selected from the group consisting of: injection, inhalant, tincture, powder, granule, capsule, oral liquid, tablet, pill, suspension, emulsion, lozenge, or dripping pill.

[0036] In another preferred embodiment, the administration method of the drug is intravenous injection or intraperitoneal injection.

[0037] In another preferred embodiment, the subject to which the drug is administered is a human or a non-human mammal.

[0038] In another preferred embodiment, the kit includes: (f1) A first pharmaceutical composition, the pharmaceutical composition containing (i) mannan derived from Flo8 gene-deleted Candida albicans as a first active ingredient, or a pharmaceutically acceptable salt thereof, or a derivative thereof; and (ii) a pharmaceutically acceptable carrier; and (f2) A reagent for detecting the TNFα level.

[0039] In the second aspect of the present invention, a training immune inducer is provided, the training immune inducer including mannan derived from Flo8 gene-deleted Candida albicans, or a pharmaceutically acceptable salt thereof, or a derivative thereof.

[0040] In the third aspect of the present invention, a use of the training immune inducer described in the second aspect of the present invention is provided, for preparing a drug for preventing and / or treating tumors; or for preparing a health product; or for preparing a medical device.

[0041] In another preferred embodiment, the tumors include: lung cancer, bladder cancer, liver cancer, gastric cancer, colon cancer, melanoma, breast cancer.

[0042] In the fourth aspect of the present invention, a method for preventing and / or treating tumors is provided, comprising the steps of: administering a safe and effective amount of mannan derived from Flo8 gene-deleted Candida albicans, or a pharmaceutically acceptable salt thereof, or a derivative thereof, to a subject in need thereof.

[0043] In another preferred embodiment, the administration includes oral administration, intravenous injection or intraperitoneal injection.

[0044] In another preferred embodiment, the subject includes a human or a non-human mammal.

[0045] In another preferred embodiment, the non-human mammals include rodents and primates, preferably mice, rats, rabbits, monkeys.

[0046] In the fifth aspect of the present invention, a method for inducing trained immunity for non-diagnostic or therapeutic purposes in vitro is provided, comprising the steps of: (a) Stimulating macrophages in the presence of mannan derived from Flo8 gene-deleted Candida albicans, thereby inducing trained immunity of the macrophages.

[0047] In another preferred embodiment, the concentration of mannan derived from Flo8 gene-deleted Candida albicans is (10 mg - 100 mg) / 10 7 macrophages; preferably 50 mg / 10 7 macrophages.

[0048] In another preferred embodiment, in step (a), the culture system further comprises: (a1) After stimulating the macrophages for 24 to 48 hours, the macrophages are secondarily stimulated with the supernatant secreted by tumor cells, thereby inducing trained immunity.

[0049] In another preferred embodiment, the volume ratio of the supernatant secreted by the tumor cells to the culture system is 1:1 to 1:5; preferably 1:2 to 1:4.

[0050] In another preferred embodiment, the time of the secondary stimulation is 5 to 9 days, preferably 7 days.

[0051] In another preferred embodiment, the tumor cells include: MB49, HCT116, HT29, SW480, SW620, NCI-1299, SW1573, HepG2, Huh-7, Huh-7.5.1, HGC27 and MFC cells.

[0052] In the sixth aspect of the present invention, a method for regulating trained immunity induced by fungal mannan is provided, and the method includes: (F1) regulating the trained immunity induced by fungal mannan by regulating the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone; including: enhancing the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone to enhance the trained immunity induced by fungal mannan and prevent infection and treat tumors; or inhibiting the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone to inhibit the trained immunity induced by fungal mannan and inhibit the inflammatory response; wherein, the fungal mannan is mannan derived from Candida albicans with Flo8 gene deletion.

[0053] In another preferred embodiment, the method for enhancing the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone is to directly add an agonist that can increase the level of H3K79 monomethylation modification or an agonist that can increase the activity of DOT1L.

[0054] In another preferred embodiment, during the process of enhancing the trained immunity induced by fungal mannan, the agonist used to enhance the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone is used before inoculation with the fungal mannan, or used together with the mannan by the same route or different routes of inoculation; During the process of preventing infection and treating tumors, the agonist used to enhance the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone is administered by intraperitoneal injection, intravenous injection or intratumoral injection.

[0055] In another preferred embodiment, the method for inhibiting the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone is to directly add an inhibitor that can reduce the level of H3K79 monomethylation modification or a DOT1L inhibitor; the DOT1L inhibitor is selected from Pinometostat.

[0056] In another preferred embodiment, the manner of regulating the trained immunity induced by fungal mannan by regulating the level of H3K79 monomethylation modification (H3K79me1) of macrophage histone is to directly inject an agonist that can increase the level of H3K79 monomethylation modification or an agonist that can increase the activity of DOT1L into the bloodstream in vivo to stimulate immune cells; or Sort out immune cells and stimulate the immune cells in vitro with an agonist that can increase the level of H3K79 monomethylation modification or an agonist that can increase the activity of DOT1L, and then reinfuse them into the body.

[0057] In another preferred embodiment, the method further includes: (F2) Regulating the trained immunity induced by fungal mannan by modulating the ERK signaling pathway or glycolysis; including: Enhancing the ERK signaling pathway or glycolysis to enhance the trained immunity induced by fungal mannan and prevent infection and treat tumors; or Inhibiting the ERK signaling pathway or glycolysis to inhibit the trained immunity induced by fungal mannan and inhibit the inflammatory response; wherein, the fungal mannan is mannan derived from Candida albicans lacking the Flo8 gene.

[0058] In another preferred embodiment, the method for enhancing the ERK signaling pathway or glycolysis is to directly add an agonist that can activate the ERK signaling pathway or undergo glycolysis.

[0059] In another preferred embodiment, during the process of enhancing the trained immunity induced by fungal mannan, the agonist that can activate the ERK signaling pathway or undergo glycolysis used to enhance the ERK signaling pathway or glycolysis is used before the inoculation of the fungal mannan, or used together with the mannan by the same or different routes of inoculation; During the process of preventing infection and treating tumors, the agonist that can activate the ERK signaling pathway or undergo glycolysis used to enhance the ERK signaling pathway or glycolysis is administered by intraperitoneal injection, intravenous injection or intratumoral injection.

[0060] In another preferred embodiment, the method for inhibiting the ERK signaling pathway or glycolysis is to directly add an ERK inhibitor or a glycolysis inhibitor; the ERK inhibitor is selected from U0126; the glycolysis inhibitor is selected from 2-DG.

[0061] Compared with the prior art, the present invention has the following technical effects: (1) The present invention first applies FM to the immunotherapy of malignant tumors, opening up a new direction for tumor treatment.

[0062] (2) The present invention discovers that the deletion of the flo8 gene leads to significant changes in the glycosidic bond connection mode and polymerization degree of mannan on the surface of Candida albicans, thereby endowing FM with unique physiological effects and having a profound impact on immune responses.

[0063] (3) The FM provided by the present invention is a synthetic polysaccharide derived from human symbiotic fungi, which has high biosafety, is easily soluble in water, has a concentrated molecular weight and a relatively single composition. Different from the polysaccharides derived from medicinal and edible fungi, it exhibits superior biosafety and good biocompatibility in inducing trained immunity, and is expected to promote clinical translational applications. Description of the Drawings

[0064] Figure 1 The figure shows the relevant results of FM pre-immunization (pre-stored immunity) inhibiting the growth of transplanted tumors in the embodiments of the present invention. Among them, A: Schematic diagram of the pre-immunization model; B: Tumor sizes of mice pre-immunized with different doses of FM 21 days after tumor transplantation of mouse bladder cancer cells (MB49 cells); C: Changes in tumor volume of mice pre-immunized with different doses of FM.

[0065] Figure 2 The figure shows the relevant results of FM-induced trained immunity in the embodiments of the present invention. Among them, A: Schematic diagram of the in vitro trained immunity model, including extracting mouse peritoneal macrophages, using FM at a concentration of 50 mg / 10 7 cells to stimulate macrophages for 24 h, and then resting the macrophages in a non-stimulating culture environment for 3 days. After stimulating the trained macrophages with 100 ng of LPS or the secreted supernatant of the cancer cell line MB49, detecting the changes in macrophage gene expression and the production of TNF-α; B: Levels of TNF-α produced by polysaccharide-trained macrophages after secondary stimulation with LPS, where β-glucan refers to β-glucan, SCM refers to mannan derived from Saccharomyces cerevisiae, WYM refers to mannan derived from wild-type Candida albicans, and FM refers to mannan biosynthesized by Candida albicans with flo8 gene deletion; C: Levels of TNF-α produced by polysaccharide-trained macrophages after stimulation with MB49 supernatant (MB49 sup ) stimulation; D: Relative mRNA expressions of CD86, iNOS, and Arg-1 genes in polysaccharide-trained macrophages after stimulation with MB49 supernatant (MB49 sup ).

[0066] Figure 3 The figure shows the relevant results of FM-induced trained immunity of macrophages in different tumor cell microenvironments in the embodiments of the present invention. Among them, the colon cancer cell lines include HCT116, HT29, SW480, and SW620 cells; the lung cancer cell lines include NCI-1299 and SW1573 cells; the liver cancer cell lines include HepG2, Huh-7, and Huh-7.5.1 cells; the gastric cancer cell lines include HGC27 and MFC cells.

[0067] Figure 4The figure shows the relevant results demonstrating that the H3K79me1 modification in the embodiments of the present invention plays an important role in the FM-induced trained immunity process. Among them, A: By separating the histone components of FM-stimulated and unstimulated peritoneal macrophages, the modification of histone lysine was identified using liquid chromatography-mass spectrometry; among them, "100" in K79(100) refers to the accuracy of mass spectrometry identification of this modification, with a maximum of 100; B: Immunoblotting was used to detect the differences in histone H3 modification in polysaccharide-trained macrophages; C: The effect of Pinometostat treatment on the H3K79mel modification; D: The level of TNF-α in Pinometostat-treated FM-trained macrophages stimulated by MB49 supernatant. Among them, the macrophages trained in the three groups of untrained, FM, and FM+Pinometostat were all secondarily stimulated with MB49 supernatant. unSti represents macrophages trained by FM but not stimulated with MB49 supernatant; E: The relative mRNA expression of CD86, iNOS, and Arg-1 genes in Pinometostat-treated FM-trained macrophages; F: The effect of treatment with the glycolysis inhibitor 2-DG and the ERK inhibitor U0126 on the production of TNF-α in trained macrophages. Detailed implementation manners

[0068] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. In addition, it should be understood that after reading the content taught by the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of this application. All common reagents used in the embodiments are commercially available products.

[0069] Terms Macrophage Macrophages play a dual role in the tumor microenvironment, which can both inhibit tumor growth and promote tumor progression. Among them, M1 macrophages play an anti-tumor role, including secreting cytokines such as TNFα and IL-12 to activate the anti-tumor immune response; directly phagocytosing tumor cells or killing tumor cells by releasing reactive oxygen species (ROS) and nitric oxide (NO); or enhancing the anti-tumor activity of T cells and NK cells. While M2 macrophages play a pro-tumor role. In the tumor microenvironment, macrophages are often polarized into M2 type, promoting tumor growth, angiogenesis, and metastasis; inhibiting the activity of T cells and NK cells by secreting factors such as IL-10 and TGF-β to form an immunosuppressive microenvironment; promoting the remodeling of the extracellular matrix (ECM) of tumor cells to help tumor cells invade and metastasize.

[0070] Pre-existing immunity Pre - existing immunity refers to the situation where an individual already has the immune ability against a specific pathogen before being exposed to it. This immune ability can be acquired through the following ways: (1) Natural infection: An individual has been infected with a certain pathogen, and the immune system has generated memory cells against this pathogen. When encountering the same pathogen again, it can quickly initiate an immune response; (2) Vaccination: By vaccinating, it mimics pathogen infection and stimulates the immune system to produce memory cells, thus providing protection during a real infection; (3) Maternal transmission: Newborns obtain antibodies from their mothers through the placenta or breast milk, forming a transient immune protection; (4) Passive immunity: By injecting antibodies (such as immunoglobulins), it directly provides short - term immune protection. Pre - existing immunity can effectively prevent diseases or alleviate symptoms, and it is an important guarantee for public health and individual health.

[0071] Trained Immunity Trained immunity refers to the state in which the innate immune system can generate a long - term and non - specific immune enhancement after exposure to certain stimuli. Different from traditional immune memory (mediated by the adaptive immune system and having antigen specificity), trained immunity is that innate immune cells (such as monocytes, macrophages, and natural killer cells) show a stronger immune response ability after infection or vaccination, and can provide more effective defense even against non - related pathogens. The said trained immunity inducers include: innate immune trainers, non - specific immune enhancers, innate immune memory activators, epigenetic immunomodulators, broad - spectrum immunomodulators, macrophage memory inducers, etc.

[0072] As used herein, the term "training" refers to inducing the formation of trained immunity.

[0073] As used herein, the term "FM" can be used interchangeably with "fungal mannan", "mannan from Flo8 gene - deleted (Flo8Δ) Candida albicans", "flo8 mutant mannan", "Mannan", "mannan biosynthesized by Flo8 gene - deleted Candida albicans", and "Flo8 mutant derived mannan", and all refer to the mannan from Flo8 gene - deleted Candida albicans described in the present invention.

[0074] Pinometostat Pinometostat is a specific inhibitor of DOT1L histone methyltransferase. Its mechanism of action is to inhibit the activity of DOT1L, thereby reducing the generation of monomethylation of lysine 79 of histone H3 (H3K79me1) and other methylation forms (such as H3K79me2 and H3K79me3).

[0075] The abnormal activity of DOT1L is closely related to certain leukemias (MLL-rearranged leukemias). MLL rearrangement leads to the abnormal recruitment of DOT1L, promoting the expression of oncogenes. By inhibiting DOT1L, Pinometostat can block the proliferation and survival of MLL-rearranged leukemia cells and is thus being studied in clinical trials for the treatment of such leukemias.

[0076] Example 1: Preparation of mannan from Flo8-deficient Candida albicans (flo8 mutant mannan, FM) The Candida albicans standard strain SC5314 (ATCC MYA-2876) was provided by the laboratory of the Department of Microbiology and Immunology, Georgetown University, Washington, U.S.A. The Candida albicans transcription factor Flo8-deficient strain (Flo8Δ) was provided by the research group of Jiangye Chen at the Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences. The mannan from Candida albicans with Flo8 gene deletion (Flo8Δ) (flo8 mutant mannan, FM) used in the examples can be prepared by the traditional alkaline lysis method.

[0077] The extraction method of mannan from Flo8Δ Candida albicans (flo8 mutant mannan, FM) is as follows: Pick the Flo8Δ Candida albicans colonies on the 4°C plate with a pipette tip and add them to 2 mL of YPD (yeast extract pentose dextrose) liquid medium. Incubate overnight at 30°C with shaking at 200 rpm. Dilute the Flo8Δ Candida albicans 1:50 into YPD + 10% FBS medium and culture in a 37°C + 5% CO2 incubator for 3 h. Centrifuge to collect the cells and wash them twice with PBS.

[0078] Resuspend the cells at a ratio of 1 g of wet bacteria to 4 mL of 2% NaOH aqueous solution, and place them in a water bath at 100 °C for 1 h. Centrifuge at 7000 rpm to collect the supernatant, and add Fehling's reagent drop by drop (mix equal volumes of solution A and solution B and mix immediately before use) to precipitate the polysaccharide until no more precipitation occurs in the solution. Centrifuge at 8000 rpm, dissolve the lower precipitate in the minimum volume of 3 M HCl, and then add it drop by drop to 45 mL of a mixed solution of methanol:acetic acid = 8:1. After washing out the precipitate and centrifuging again, dissolve it in 3 M HCl and then repeat the addition to the methanol-acetic acid mixed solution. Repeat the operation 3 times to completely remove protein contamination. Finally, dissolve the white precipitate at the bottom of the tube in 5 - 10 mL of double-distilled water, place it in a 7 kDa dialysis bag for dialysis for 24 h, freeze-dry it, and store it in a -20 °C refrigerator. Dissolve the mannan in sterile water to a 5 mg / mL solution for use.

[0079] Example 2: Application of FM to induce pre-existing immunity can inhibit the growth of transplanted tumors The specific experimental procedure is as follows: As Figure 1 shown in A, male mice were intraperitoneally injected with different masses (0.5 mg, 1 mg, and 4 mg) of FM. After the injection, the mice were allowed to rest for one week and then subcutaneously inoculated with 10 6 bladder cancer cells MB49. At different time points after inoculation, the length and width of the tumor tissue were measured using a vernier caliper, and the volume of the tumor was calculated. On the 21st day after inoculation, the tumor tissue was isolated and the size of the tumors among the groups was compared.

[0080] The results showed that: Application of FM successfully induced pre-existing immunity in mice. Seven days before the inoculation of transplanted tumor cells (Day - 7), mice were given different doses of FM (0.5 mg / mouse, 1 mg / mouse, 4 mg / mouse), and the growth of the tumors in the mice was observed 21 days (Day21) later ( Figure 1 A). The results showed that the pre-existing immunity induced by FM in mice could dose-dependently inhibit the volume growth of transplanted tumors. In particular, the pre-existing immunity induced when the FM dose was 4 mg / mouse significantly inhibited the volume growth of transplanted tumors ( Figure 1 B - 1C), indicating that FM can effectively inhibit the growth of transplanted tumors in mice by inducing pre-existing immunity and exert its anti-tumor effect.

[0081] Example 3: Application of FM can effectively induce trained immunity of macrophages in the tumor microenvironment In this example, a model of trained immunity of macrophages in the in vitro tumor microenvironment was constructed. As Figure 2 shown in A, the specific experimental procedure is as follows: Extract mouse peritoneal macrophages and use a concentration of 50 mg / 10 7The cells were stimulated with FM for 24 h. Subsequently, the cells were placed in a non-stimulating culture environment and rested for 3 days. After that, the trained cells were stimulated with 100 ng of LPS or the supernatant secreted by the bladder cancer cell line MB49 with a volume ratio of 30%, and the changes in cell gene expression and the production of TNF-α were detected.

[0082] mRNA experimental procedure: After the trained macrophages were stimulated with the supernatant secreted by MB49 at different time points, the mRNA samples of the cells were collected. After reverse transcription, the RT-qPCR technique was used to detect the expression levels of different genes.

[0083] Primer sequences: GAPDH-F: TGGCCTTCCGTGTTCCTAC (SEQ ID NO:1); GAPDH-R: GAGTTGCTGTTGAAGTCGCA (SEQ ID NO:2); iNOS-F: GAACTGTAGCACAGCACAGGAAAT (SEQ ID NO:3); iNOS-R: CGTACCGGATGAGCTGTGAAT (SEQ ID NO:4); Arg1-F: AAGAATGGAAGAGTCAGTGTGG (SEQ ID NO:5); Arg1-R: GGGAGTGTTGATGTCAGTGTG (SEQ ID NO:6); CD86-F: TGTTTCCGTGGAGACGCAAG (SEQ ID NO:7); CD86-R: TTGAGCCTTTGTAAATGGGCA (SEQ ID NO:8).

[0084] The experimental results showed that macrophages stimulated with FM, mannan (WYM) and β-glucan from wild-type Candida albicans could all induce more TNF-α production under secondary stimulation with LPS (7 days later). Figure 2 B); Under the conditions of the tumor microenvironment, after secondary stimulation (7 days later) with the supernatant of tumor cells (MB49 sup )), FM training significantly enhanced the production of TNF-α by macrophages, while WYM and β-glucan failed to induce this effect (did not significantly enhance the production of TNF-α). Figure 2C). Meanwhile, FM training also promoted a significant upregulation of genes CD86 and iNOS related to the M1 phenotype of macrophages, and significantly downregulated the expression of the gene Arg-1 related to the M2 phenotype of macrophages ( Figure 2 D). These results indicate that FM can effectively induce trained immunity of macrophages in the tumor microenvironment, thereby enhancing their immune memory and promoting M1 polarization of macrophages.

[0085] In addition, the present invention was further verified on a variety of different cancer cells (including: colon cancer cell lines: HCT116, HT29, SW480, and SW620 cells; lung cancer cell lines: NCI-1299 and SW1573 cells; liver cancer cell lines: HepG2, Huh-7, and Huh-7.5.1 cells; gastric cancer cell lines: HGC27 and MFC cells). The specific experimental procedures are as follows: Mouse peritoneal macrophages were extracted and stimulated with β-glucan at a concentration of 50 mg / 10 7 cells, mannan from wild-type Candida albicans (WYM), and FM for 24 h. Then, the cells were placed in a non-stimulated culture environment and rested for 3 days. A variety of different cancer cells (including: colon cancer cell lines: HCT116, HT29, SW480, SW620; lung cancer cell lines: NCI-1299, SW1573; liver cancer cell lines: HepG2, Huh-7, Huh-7.5.1; gastric cancer cell lines: HGC27, MFC) were used, and their secretory supernatants were used to stimulate the trained cells at a volume ratio of 30%, and the production of TNF-α was detected.

[0086] The experimental results showed that after macrophages were stimulated with FM training, mannan from wild-type Candida albicans (WYM), and β-glucan, and then re-stimulated with the supernatants of colon cancer, lung cancer, liver cancer, or gastric cancer cell lines for 24 h, FM training significantly enhanced the production of TNF-α by macrophages, while WYM and β-glucan failed to induce this effect (did not significantly enhance the production of TNF-α) ( Figure 3 ).

[0087] Example 4: FM specifically activates H3K79 monomethylation modification of macrophages and induces trained immunity The specific experimental procedures are as follows: Mouse peritoneal macrophages were extracted and stimulated with FM at a concentration of 50 mg / 10 7 cells for 24 h, then the histone components of the cells were separated, and liquid chromatography tandem mass spectrometry was performed to identify the modifications of histone lysine residues.

[0088] Western Blot assay: Mouse peritoneal macrophages were extracted and treated with β-glucan (β-glucan) at a concentration of 50 mg / 10 7 cells, mannan from wild-type Candida albicans (WYM) and FM for 24 h, and detected using specific antibodies against histone H3, H3K27Ac, H3K21Ac, and H3K79me1.

[0089] Mouse peritoneal macrophages were extracted and treated with FM at a concentration of 50 mg / 10 7 cells for 24 h. Pinometostat at a final concentration of 1 μM was added or not added. After resting the cells for 3 days, the trained cells were stimulated with 100 ng of LPS or the supernatant of the cancer cell line MB49 at a volume ratio of 30%, and the changes in cell gene expression and the production of TNF-α were detected.

[0090] Liquid chromatography-mass spectrometry analysis showed that three specific modifications, H3K79me1, H3K23ac, and H3K27ac, occurred in FM-induced macrophage histone (Histone H3.1) ( Figure 4 A). By comparing macrophages treated with different stimulants (β-glucan, WYM, and FM), it was found that FM stimulation of macrophages significantly activated the modification of histone H3K79me1, H3K23ac, and H3K27ac, indicating that FM induced a response of macrophage histone modification. These modifications were responsive to the stimulation of FM on macrophages ( Figure 4 B).

[0091] It is known that Pinometostat specifically inhibits DOT1L activity, thereby reducing the production of H3K79me1. The experiment found that the use of the DOT1L inhibitor (Pinometostat) could effectively block the H3K79me1 modification ( Figure 4 C), significantly reducing the production of TNF-α in trained macrophages stimulated by tumor supernatant ( Figure 4 D), while inhibiting the gene expression of CD86 and iNOS and upregulating the level of Arg-1 ( Figure 4 E).

[0092] In addition, inhibiting ERK kinase and the glycolysis process also partially hindered the trained immune effect. Figure 4 F shows the effect of treatment with the glycolysis inhibitor 2-DG and the ERK inhibitor U0126 on the production of TNF-α in trained macrophages The above results indicate that DOT1L-mediated H3K79me1 modification plays a key role in FM-induced trained immunity, and the ERK signaling pathway and glycolysis process are involved in this mechanism. Therefore, FM can induce trained immunity by specifically activating H3K79me1 modification in macrophages, thereby exerting an anti-tumor effect.

[0093] The above-described embodiments merely represent several implementation manners of the present invention. The description is relatively specific and detailed, but it should not be construed as a limitation on the scope of the patent of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present invention, several modifications and improvements can still be made, and these all belong to the protection scope of the present invention. Therefore, the protection scope of the present invention shall be subject to the appended claims.

Claims

1. A use of an active ingredient, characterized in that: The active ingredient is selected from mannan derived from Flo8 gene-deficient Candida albicans, or a pharmaceutically acceptable salt thereof, or an active derivative thereof, and the active ingredient is used in a drug or kit for preventing and / or treating tumors; or the active ingredient is used to prepare a preparation or composition, and the preparation or composition is used to induce trained immunity; or the active ingredient is used to prepare a trained immunity inducer; or the active ingredient is used to prepare a health product; or the active ingredient is used to prepare a medical device.

2. The use according to claim 1, characterized in that The drug is also used for the following purposes: (y1) promotes upregulation of TNF-α expression; (y2) promotes upregulation of CD86 expression; (y3) promote the upregulation of iNOS expression; (y4) decrease Arg-1 expression; (y5) promotes H3K79 monomethylation modification (H3K79me1) of macrophage histones; (y6) promoting H3K23 acetylation modification (H3K23ac) of macrophage histones; and / or (y7) Promotes H3K27 acetylation modification (H3K27ac) of histones in macrophages.

3. The use according to claim 1, characterized in that The dosage of the drug is 1-1000 mg / kg / day, preferably 20-800 mg / kg / day, more preferably 25-600 mg / kg / day, and most preferably 160-200 mg / kg / day, based on the dosage of mannan derived from Flo8 gene-deficient Candida albicans.

4. The use according to claim 1, characterized in that The tumors include: lung cancer, bladder cancer, liver cancer, stomach cancer, colon cancer, melanoma, and breast cancer; The medical devices include but are not limited to: medical dressings; The health products include, but are not limited to: oral health products, function-oriented health products and health products with special forms; The medical dressings include but are not limited to: Band-Aids, chronic wound dressings; The dosage forms of the oral health products include, but are not limited to: tablets, capsules, oral liquids, powders or granules; The function-oriented health products include but are not limited to: health products that enhance immunity; The health products with some special forms include but are not limited to: health drinks and health candies.

5. The use according to claim 1, characterized in that: The kit comprises: (f1) a first pharmaceutical composition comprising (i) as a first active ingredient, mannan derived from Flo8 gene-deficient Candida albicans, or a pharmaceutically acceptable salt thereof, or a derivative thereof; and (ii) a pharmaceutically acceptable carrier; and (f2) A reagent for detecting TNFα level.

6. A trained immune inducing agent, characterized in that: The trained immune inducer includes mannan derived from Flo8 gene-deficient Candida albicans, or a pharmaceutically acceptable salt thereof, or a derivative thereof.

7. Use of the trained immunity inducing agent according to claim 6, characterized in that: Used for preparing drugs for preventing and / or treating tumors, or for preparing health products; or for preparing medical devices.

8. The use according to claim 7, characterized in that The tumors include: lung cancer, bladder cancer, liver cancer, stomach cancer, colon cancer, melanoma, and breast cancer.

9. A method for inducing trained immunity in vitro for non-diagnostic or therapeutic purposes, comprising the steps of: (a) Macrophages are stimulated in the presence of mannan derived from Flo8 gene-deficient Candida albicans, thereby inducing trained immunity of the macrophages.

10. A method for regulating fungal mannan-induced trained immunity, characterized in that: The method includes: (F1) Modulation of fungal mannan-induced trained immunity by regulating the level of H3K79 monomethylation modification (H3K79me1) of macrophage histones; including: Enhancing the level of H3K79 monomethylation modification (H3K79me1) of macrophage histones to enhance fungal mannan-induced trained immunity and prevent infection and treat tumors; or Inhibiting the level of H3K79 monomethylation modification (H3K79me1) of macrophage histones to inhibit fungal mannan-induced trained immunity and inhibit inflammatory response; wherein the fungal mannan is mannan derived from Flo8 gene-deficient Candida albicans.

Images