Recombinant kunitz protein of third generation of ponceau as well as preparation method and application of recombinant kunitz protein

By developing the recombinant kunitz protein of cigarettes, the problems of drug resistance and environmental pollution in the prevention and control of third-generation insect diseases in fish are solved, effective immune protection against third-generation insects is achieved, and new vaccines and drug targets are provided.

CN120230192AActive Publication Date: 2025-07-01SUN YAT SEN UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510318360.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-18
Publication Date
2025-07-01
Estimated Expiration
2045-03-18

AI Technical Summary

Technical Problem

The prior art has problems with drug resistance, environmental pollution and harm to fish when preventing and controlling third-generation insect diseases in fish, and lacks effective vaccines and drug targets.

Method used

A recombinant kunitz protein of cichlid third generation and its preparation method are developed. As a target for vaccines or drugs, the amino acid sequence of the GcKSI protein is optimized and prokaryotic expression is performed to obtain the GcKSI recombinant protein rGcKSI.

Benefits of technology

rGcKSI protein significantly inhibits the complement activity and serine protease of the host fish in vitro, and significantly reduces the infection rate and infection intensity of the third generation insects after immunization of tilapia, proving that it has good immunoprotection and immunogenicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230192A_ABST
    Figure CN120230192A_ABST
Patent Text Reader

Abstract

The invention relates to a recombinant kunitz protein of third-generation botryosphaeria formosa as well as a preparation method and application of the recombinant kunitz protein, and belongs to the technical field of fish parasite protein expression and function application research. The serine protease inhibitor of the third-generation botryosphaeria formosa is a GcKSI protein, and the amino acid sequence of the GcKSI protein is as shown in SEQ ID NO: 2. According to the invention, the amino acid sequence of the GcKSI protein is optimized, and the GcKSI recombinant protein rGcKSI is obtained through prokaryotic expression. The rGcKSI inhibits complement activity of host fish in vitro and has an obvious inhibition effect on serine protease, after injection immunization of the rGcKSI and third-generation insect infection experiments, the infection rate and the average infection intensity of the rGcKSI are obviously lower than those of a control group, and it is proved that the rGcKSI has good immunoprotectiveness on third-generation insect infection, and the rGcKSI can be used as an immunopotentiator for the third-generation insect infection of the tilapia. The GcKSI gene of the serine protease inhibitor and the GcKSI protein coded by the GcKSI gene can be used as new targets for drug research and development.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of research on fish parasite protein expression and functional applications, and particularly relates to a kunitz protein of Gyrodactylus cichlidarum, a preparation method thereof, and applications thereof. Background Art

[0002] Monogeneans belong to the class Monogenea of the phylum Platyhelminthes. They are widely parasitic on the gills, skin, and stomach of marine, brackish, and freshwater fish around the world. A few can parasitize amphibians and reptiles, and they are the most diverse external parasites of fish. They usually use the anchor hooks on the posterior sucker to insert into the parasitic site, causing mechanical damage, and often causing other pathogens to invade and cause co-infection, resulting in huge economic losses to the fish farming industry. Gyrodactylus spp. is one of the typical representatives of monogeneans, belonging to the order Gyrodactylidea, the family Gyrodactylidae, and the genus Gyrodactylus. It mainly parasitizes on the body surface and gills of fish, is widely distributed in seawater and freshwater waters around the world, and can infect the vast majority of wild and farmed fish.

[0003] The suitable temperature for the survival of Gyrodactylus is 20-25°C. Gyrodactylosis is prevalent in late spring and early summer and poses a great threat to fry and fingerlings of spring flowers. It can cause surface wounds and trigger secondary infections by pathogens such as bacteria. After the fish body is parasitized by this worm, abnormal secretion of fish body mucus, congestion and punctate hemorrhagic spots can be seen. A grayish-blue dull mucus membrane forms on the skin of diseased fish. The fish is extremely restless, swims wildly in the water, or rubs its body against the pool wall while swimming, has a loss of appetite, becomes emaciated and eventually dies. When examined under a microscope, the parasite can often be found on the body surface, fins and gills. Earlier, Gyrodactylus salaris caused a devastating blow to the wild Atlantic salmon (Salmo salar) population in Norway and has shown a tendency to expand its transmission range in recent years. According to reports in recent years, Gyrodactylus has caused continuous harm to various economically important fish species in China, such as crucian carp (Carassius auratus), snakehead (Channa argus), tilapia (Oreochromis niloticus), common carp (Cyprinus carpio) and loach (Misgurnus anguillicaudatus). A large number of infections of Gyrodactylus kobayashi caused large-scale deaths of goldfish (carassius auratus) in the aquarium market in Henan Province, China. Currently, the applicant has successfully established an infection experimental model of Gyrodactylus cichlidarum and its host Nile tilapia (Oreochromis niloticus) in the laboratory, completed the preservation of Gyrodactylus cichlidarum, and reported research on the immune defense mechanism of tilapia against Gyrodactylus.

[0004] At present, the prevention and control methods of monogenean diseases, including gyrodactylosis, mainly rely on soaking with chemical drugs such as formalin and the use of drugs such as antibiotics, and they are all broad-spectrum insecticidal drugs. The current national standard fishery drugs are mainly transplanted from pesticide raw materials (trichlorfon and phoxim), livestock and poultry veterinary drugs (diclazuril and robenidine), and pharmaceutical raw materials (mebendazole and praziquantel). The long-term and over-dose use of insecticidal drugs in production will cause problems such as drug resistance, drug residues, and environmental pollution, and it will also cause certain harm to the fish itself, increasing the difficulty of disease prevention and control. In the past two years, there have been more and more reports on the drug resistance of monogeneans. Many farms are facing the dilemma of "no effective drugs available" when monogenean diseases break out in fish. The research and development of new drugs and vaccines for monogenean diseases are urgent. However, due to factors such as difficult sampling and lack of suitable experimental models, the domestic research on monogenean vaccines is almost blank. Among monogeneans, a patent for a vaccine against Benedenia seriolae was reported in Japan. It is a DNA vaccine composed of a serine protease gene fragment of Benedenia seriolae, and there is no report on its promotion and application yet. In the entire range of fish parasites, there is currently a commercial vaccine, Providean Aquatec SeaLice against fish lice, manufactured by the Argentine biopharmaceutical company Tecnovax S.A.

[0005] The applicant's team has successfully established a Gyrodactylus cichlidarum-Oreochromis niloticus infection experimental model in the laboratory and obtained the genomic, transcriptomic, and excretory / secretory protein data of Gyrodactylus cichlidarum for the first time. Some serine protease inhibitors in the excretory / secretory proteins of Gyrodactylus cichlidarum are highly abundant and may be involved in regulating the immune response of the host fish, thus helping the gyrodactylids achieve immune escape, including kunitz-type serine protease inhibitors. Kunitz-type serine protease inhibitors are typical secreted proteins. Their main function is to inhibit the activity of serine proteases, and in a few cases, they can also inhibit cysteine proteases or aspartic proteases. Kunitz proteins have a small molecular weight, usually only 6-8 kDa. They generally have an active protease-binding domain containing six cysteine residues, and the six cysteine residues form three disulfide bonds to ensure the stability of protein folding. Kunitz proteins are involved in regulating various biological processes in organisms, such as cell proliferation, cuticle formation and tissue remodeling, ion channel blockage, blood coagulation, fibrinolysis, inflammation, etc. At the same time, kunitz proteins are also important bioactive compounds in the venoms of sea anemones, spiders, scorpions, snakes, etc. Some people have classified kunitz proteins into five types according to their functions: trypsin inhibitors in vivo, chymotrypsin inhibitors in venom, trypsin inhibitors in venom, bifunctional toxins, and K +Channel blockers. Kunitz proteins have been studied in some parasitic worms. Based on these studies, their functions are speculated to include protecting parasites from host digestive enzymes, regulating endogenous cysteine proteases, immune escape, and immune regulation, etc.

[0006] Chinese Patent CN117736309A discloses the preparation method and application of the first recombinant serine protease inhibitor of Gyrodactylus cichlidarum, obtaining the cDNA sequence of the GcSerpin gene, and obtaining the rGcSerpin protein through recombinant vector construction, prokaryotic expression, and purification. The rGcSerpin protein participates in the immune interaction and immune regulation between Gyrodactylus cichlidarum and tilapia. Neutralizing the secretion of the GcSerpin protein in vitro can significantly reduce the infection intensity of Gyrodactylus cichlidarum on tilapia. There are many types of serine proteases, and serine protease inhibitors also have multiple different types. The regulation of the host fish's immunity by parasites is also achieved through the combined action of multiple proteins. Therefore, more Gyrodactylus serine protease inhibitor genes and proteins need to be identified and studied to obtain more effective vaccine or drug targets for better application in the prevention and control of Gyrodactylosis in fish. Summary of the Invention

[0007] In order to solve the problems of drug resistance and environmental pollution in the prevention and control of parasitic diseases in aquaculture production, the purpose of the present invention is to provide effective targets for the development of vaccines and drugs for Gyrodactylosis in fish, and to provide a recombinant kunitz protein of Gyrodactylus cichlidarum with the potential to be used as a vaccine and drug target and which is easy to prepare in large quantities, as well as its preparation method and application.

[0008] To achieve the above object, the technical solution adopted by the present invention is as follows:

[0009] In the first aspect, the present invention provides a serine protease inhibitor of Gyrodactylus cichlidarum. The serine protease inhibitor of Gyrodactylus cichlidarum is a kunitz-type serine protease inhibitor, which is the GcKSI protein, and the amino acid sequence of the GcKSI protein is as shown in SEQ ID NO: 2.

[0010] The present invention discovers that the serine protease inhibitor GcKSI protein of Gyrodactylus cichlidarum has good immune protection against the infection of tilapia by Gyrodactylus cichlidarum and is an effective target for drug research and development.

[0011] In the second aspect, the present invention provides the application of the serine protease inhibitor of Gyrodactylus cichlidarum as an immunogen or molecular target in the preparation of drugs for preventing and treating monogenean diseases of tilapia.

[0012] The GcKSI protein has a significant inhibitory effect on the activity of tilapia complement. Designing GcKSI protein inhibitors with the GcKSI protein as the molecular target is beneficial to restoring tilapia complement activity, improving tilapia immune function, and further preventing and treating tilapia monogenean disease.

[0013] In a specific embodiment of the present invention, the pathogen of tilapia monogenean disease is Gyrodactylus cichlidarum.

[0014] In a third aspect, the present invention provides a coding gene for a serine protease inhibitor of Gyrodactylus cichlidarum, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO: 1.

[0015] In a fourth aspect, the present invention provides a recombinant expression vector that expresses a serine protease inhibitor of Gyrodactylus cichlidarum.

[0016] In a specific embodiment of the present invention, the recombinant expression vector expresses a recombinant protein of a serine protease inhibitor of Gyrodactylus cichlidarum with an amino acid sequence as shown in SEQ ID NO: 5.

[0017] In a specific embodiment of the present invention, the recombinant expression vector uses pET-44b(+) as the backbone vector.

[0018] In a specific embodiment of the present invention, the recombinant expression vector uses pET-44b(+) as the backbone vector, and a nucleotide molecule with a nucleotide sequence as shown in SEQ ID NO: 4 is connected between the Sac I and Xho I restriction enzyme sites of the backbone vector.

[0019] In a fifth aspect, the present invention provides a recombinant engineering bacterium that contains the recombinant expression vector.

[0020] Furthermore, Escherichia coli BL21 can be selected to construct the recombinant engineering bacterium.

[0021] In a sixth aspect, the present invention provides a recombinant protein of a serine protease inhibitor of Gyrodactylus cichlidarum, and the amino acid sequence of the recombinant protein is as shown in SEQ ID NO: 5. In the present invention, the amino acid sequence of the GcKSI protein in the serine protease inhibitor of Gyrodactylus cichlidarum is optimized, the signal peptide is removed, and Sac I-Xho I restriction enzyme sites are added to both ends of the nucleotide sequence of the GcKSI protein coding gene to obtain the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum.

[0022] In a seventh aspect, the present invention provides the application of the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum in the preparation of a drug for preventing and treating tilapia monogenean disease.

[0023] In a specific embodiment of the present invention, the pathogen of tilapia monogeneosis is Gyrodactylus cichlidarum.

[0024] In an eighth aspect, the present invention provides a method for preparing a recombinant protein of a serine protease inhibitor of Gyrodactylus cichlidarum, culturing the recombinant engineering bacteria, and expressing the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum.

[0025] Further, a medium containing 0.1 - 1 mM isopropyl-β-D-thiogalactoside is used to induce the expression of the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum.

[0026] Preferably, the concentration of isopropyl-β-D-thiogalactoside is 0.5 mM, which is the optimal concentration for inducing the expression of the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum.

[0027] Further, the culture temperature is 20 - 37 °C, and the culture rotation speed is 100 - 300 rpm.

[0028] Even further, the culture temperature is 37 °C, and the culture rotation speed is 220 rpm.

[0029] Further, the OD of the recombinant engineering bacteria is cultured 600 to reach 0.4 - 0.8, isopropyl-β-D-thiogalactoside is added for induction culture, and the induction culture time is 4 - 16 h.

[0030] Even further, the OD 600 reaches 0.6, and the induction culture time is 16 h.

[0031] Further, the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum is purified.

[0032] Further, Ni-NTA affinity chromatography purification is performed on the recombinant protein of the serine protease inhibitor of Gyrodactylus cichlidarum.

[0033] Even further, the cells of the recombinant engineering bacteria are collected, the cells are ultrasonically disrupted, centrifuged at 10000 - 20000 rpm for 0.5 - 1.5 h, the supernatant is taken, passed through a Ni NTA affinity chromatography column, and washed and eluted with a washing solution and an elution solution containing Tris-HCl, NaCl, and imidazole.

[0034] Even further, centrifugation is performed at 17000 rpm for 1 h.

[0035] Even further, in the washing solution and the elution solution, the concentration of Tris-HCl is 15 - 25 mM, the concentration of NaCl is 200 - 500 mM, and the concentration of imidazole is 10 - 30 mM.

[0036] Furthermore, in Wash Solution 1, the Tris-HCl concentration is 20 mM, the NaCl concentration is 300 mM, and the imidazole concentration is 20 mM;

[0037] In Wash Solution 2, the Tris-HCl concentration is 20 mM, the NaCl concentration is 300 mM, and the imidazole concentration is 40 mM;

[0038] In the elution solution, the Tris-HCl concentration is 20 mM, the NaCl concentration is 300 mM, and the imidazole concentration is 250 mM.

[0039] In a ninth aspect, the present invention provides a drug for preventing and treating monogenean disease of tilapia, and the drug contains the serine protease inhibitor recombinant protein of Gyrodactylus cichlidarum.

[0040] In a specific embodiment of the present invention, the drug includes a vaccine.

[0041] Furthermore, the drug further contains a pharmaceutically acceptable carrier.

[0042] Furthermore, the vaccine contains a vaccine adjuvant.

[0043] In a specific embodiment of the present invention, the vaccine adjuvant is Freund's adjuvant.

[0044] Furthermore, the concentration of the serine protease inhibitor recombinant protein of Gyrodactylus cichlidarum in the vaccine is 0.5 - 2 mg / mL, preferably 1 mg / mL.

[0045] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0046] In the present invention, the full-length cDNA of the kunitz-type serine protease inhibitor GcKSI gene of Gyrodactylus cichlidarum was cloned by RACE technology, and the encoded GcKSI protein was analyzed. By optimizing the amino acid sequence of the GcKSI protein and performing prokaryotic expression, the GcKSI recombinant protein rGcKSI was obtained. rGcKSI inhibits the complement activity of the host fish in vitro and has an obvious inhibitory effect on serine protease. After injecting and immunizing tilapia with rGcKSI and then conducting a Gyrodactylus infection experiment, its infection rate and average infection intensity are significantly lower than those of the control group, proving that rGcKSI has good immune protection against Gyrodactylus infection, indicating that the serine protease inhibitor GcKSI gene and its encoded GcKSI protein can be used as new targets for drug research and development. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1It is the full-length cDNA nucleotide sequence of the GcKSI gene and the encoded amino acid sequence diagram. Among them, the digital serial numbers marked on both sides of each row of nucleotide sequences represent the positions of nucleotides and amino acids; the start codon (ATG) and the stop codon (TAA) are underlined; "*" represents the terminator; the poly(A) tail is marked in italics; the polyadenylation signal is in bold; the signal peptide sequence is in a box; the shaded part represents the phosphorylation site; the glycosylation site is represented by a circle.

[0048] Figure 2 It is the signal peptide structure analysis of the GcKSI protein.

[0049] Figure 3 It is the phosphorylation site analysis of the GcKSI protein.

[0050] Figure 4 It is the conserved domain analysis of the GcKSI protein.

[0051] Figure 5 It is the GcKSI protein structure prediction.

[0052] Figure 6 It is the physical map of the pET-44b(+) vector. Among them, the red box represents the restriction enzyme digestion site used in the present invention.

[0053] Figure 7 It is the nucleotide sequence diagram of the optimized GcKSI gene with the Sac I-Xho I restriction enzyme digestion site linker sequence added and the signal peptide removed. Among them, the digital serial numbers marked on both sides of each row of nucleotide sequences represent the positions of nucleotides and amino acids; the added restriction enzyme digestion site is in a box.

[0054] Figure 8 It is the SDS-PAGE identification (Coomassie brilliant blue staining) diagram of the GcKSI protein after induction and expression with isopropyl-β-D-thiogalactoside (IPTG). Among them, M is the standard protein marker, and the red arrow indicates the target band.

[0055] Figure 9 It is the SDS-PAGE identification (Coomassie brilliant blue staining) diagram of the GcKSI protein after purification by the Ni NTA column. Among them, M is the standard protein marker, and the red arrow indicates the target band.

[0056] Figure 10 It is the inhibitory effect of the recombinant protein rGcKSI on serine protease. Among them, Trypsin is trypsin; Chymotrypsin is chymotrypsin; Thrombin is thrombin, and FXa is factor Xa (coagulation factor Xa).

[0057] Figure 11Concentration-dependent effect of recombinant protein rGcKSI on the complement-mediated lysis of rabbit erythrocytes by tilapia. LT represents lysis time (complete hemolysis time).

[0058] Figure 12 Shows the lysis of rabbit erythrocytes in each group 20 minutes after the start of the hemolysis experiment. Among them, A is the blank control group; B is the complete hemolysis group; C is the rGcKSI group; D is the NusA protein control group. The scale bar in the figure is 50 μm.

[0059] Figure 13 Immunogenicity and immunoprotection of recombinant protein rGcKSI. Among them, A shows the statistical results of the infection abundance of Gyrodactylus in each group after immunization with rGcKSI; B shows the results of enzyme-linked immunosorbent assay (ELISA) for the content of tilapia IgM (immunoglobulin M) antibody after immunization with rGcKSI; ** represents P < 0.01, *** represents P < 0.001. Specific implementation mode

[0060] To better illustrate the purpose, technical solution and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments. Other materials, reagents, etc. used in the embodiments can be obtained from commercial channels without special instructions.

[0061] Example 1 Full-length cDNA cloning of the kunitz gene of Gyrodactylus cichlidarum

[0062] The primers used for RACE (Rapid amplification of cdna end) cloning are shown in Table 1. The RACE amplification was carried out using the kit SMARTer RACE 5’ / 3’Kit–634858 (Takara, Dalian, China) according to the instructions. The amplified fragment was recovered by gel cutting and ligated into the pMD 18-T vector, and then transformed into DH5α competent cells. The bacterial solution was sequenced, and the full-length cDNA gene sequence of the GcKSI gene was obtained after splicing the sequencing results.

[0063] Table 1 Primers for cloning the kunitz gene of Gyrodactylus cichlidarum

[0064]

[0065] The full-length cDNA of the GcKSI gene is 585 bp, containing an open reading frame (ORF) of 423 bp ( Figure 1 ), which can encode 140 amino acids, with an estimated molecular weight of 15.768 kDa and an isoelectric point (pI) of 4.32. The N-terminus of the GcKSI protein contains a 17-amino acid residue secretory protein signal peptide ( Figure 2) and has 3 asparagine glycosylation sites, as well as 6 serine, 7 threonine and 1 tyrosine phosphorylation sites( Figure 3 )。The results of conserved domain analysis showed that the amino acid sequence of the GcKSI protein included a serine protease inhibitor domain of the BPTI / Kunitz family, as well as a set of trypsin interaction sites( Figure 4 )。The results of protein structure prediction showed that the GcKSI protein was composed of 22 α-helices, 38 extended strands and numerous irregular curls( Figure 5 )。

[0066] The nucleotide sequence of the cDNA of the GcKSI gene is shown in SEQ ID NO: 1, and the amino acid sequence of the GcKSI protein is shown in SEQ ID NO: 2.

[0067] Example 2 Preparation method of prokaryotic expression of the Kunitz protein of Gyrodactylus cichlid

[0068] 1. Construction of the GcKSI gene expression vector

[0069] The pET-44b(+) vector used for prokaryotic expression was purchased from Guangzhou Jidan Biotechnology Co., Ltd. After bioinformatics analysis, cloning was carried out at the Sac I-Xho I restriction enzyme sites( Figure 6 )。

[0070] Linker sequences of Sac I-Xho I restriction enzyme sites were added to both ends of the optimized GcKSI gene sequence after removing the signal peptide( Figure 7 )。The nucleotide sequence of the optimized GcKSI gene after removing the signal peptide is shown in SEQ ID NO: 3, and the nucleotide sequence of the optimized GcKSI gene after adding the linker sequence of Sac I-Xho I restriction enzyme sites and removing the signal peptide is shown in SEQ ID NO: 4 (as the target fragment to be ligated), and the amino acid sequence of the finally encoded recombinant protein (rGcKSI) is shown in SEQ ID NO: 5.

[0071] The pET-44b(+) vector was digested with Sac I (brand: Takara, catalog number: 1078S) and Xho I (brand: Takara, catalog number: 1094S) restriction enzymes for double digestion linearization to obtain the linearized pET-44b(+) vector.

[0072] The linearized pET-44b(+) vector and the target fragment to be ligated were ligated using T4 ligase (Takara) to obtain a ligation product. The ligation product was transformed into competent Escherichia coli DH5α cells and spread on LA plate medium (Luria-Bertani medium supplemented with ampicillin) and cultured for 12 - 16 h. The next day, 10 monoclonal colonies were picked and the strains were amplified in LA liquid medium at 37°C and 220 rpm to obtain a bacterial solution. The bacterial solution was subjected to PCR amplification and sequencing using the universal primers T7 / ColiDOWN.

[0073] Primer T7: TAATACGACTCACTATAGGG;

[0074] Primer ColiDOWN: TTCACTTCTGAGTTCGGCATG.

[0075] PCR amplification system: 18 μL of sterile water, 1 μL of bacterial solution, 0.5 μL of ExTaq enzyme (brand: Takara, catalog number: RR001A), 2.5 μL of Buffer, 2 μL of dNTP, 0.5 μL of T7 primer, 0.5 μL of ColiDOWN primer.

[0076] Using the conventional PCR program, the primer annealing temperature was 55°C and the extension time was 1 min.

[0077] According to the sequencing results, the monoclonal strains with correct sequencing sequences were retained to obtain the corresponding bacterial solution. 40% (w / v) glycerol was added, and the volume ratio of the bacterial solution to 40% (w / v) glycerol was 1:1. It was stored at -80°C, and the monoclonal strains with correct sequencing sequences were amplified. The plasmid was extracted to obtain the GcKSI gene expression vector for subsequent experiments.

[0078] 2. The GcKSI gene expression vector constructed in step 1 was transformed into competent Escherichia coli BL21 cells and spread on LA plate medium and cultured overnight. The next day, 10 monoclonal colonies were picked and cultured with shaking and amplified in LA liquid medium at 37°C and 220 rpm, and the bacterial solution was identified by PCR using the universal primers T7 / ColiDOWN according to step 1.

[0079] At 3 h of culturing with shaking and amplification, when the OD 600 of the strain reached 0.6, 100 mM isopropyl-β-D-thiogalactoside (IPTG) was added to make the final concentration of IPTG 1 mM, 0.5 mM, and 0.1 mM respectively, and the culture was continued with shaking and amplification for 4 h to obtain 3 kinds of IPTG-induced bacterial solutions.

[0080] Take 400 μL from each of the 3 IPTG-induced bacterial cultures. At the same time, randomly take a 400-μL tube of non-IPTG-induced bacterial culture as a negative control. Centrifuge all the bacterial culture samples at 13,000 rpm for 1 min at room temperature. After pouring off the supernatant, add 50 μL of 1×SDS Loading dye (brand: Beyotime, catalog number: P0281S). Use a pipette to blow and resuspend the bacteria, and place them in a 95°C constant-temperature metal bath for 10 min to break the bacteria and release the proteins, obtaining the cooked samples.

[0081] Centrifuge the cooked samples at 13,000 rpm for 1 min at room temperature. Pipette 10 μL from each and perform sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Stain with Coomassie Brilliant Blue G250, screen out the expression strain with the best effect, obtain the corresponding bacterial culture, add 40% (w / v) glycerol, with the volume ratio of the bacterial culture to 40% (w / v) glycerol being 1:1, and store at -80°C.

[0082] The GcKSI protein is fusion-expressed with the NusA (transcription termination / antitermination protein) tag on the pET-44b(+) vector. After fusion, the molecular weight is approximately 90 kDa ( Figure 8 ), and the isoelectric point (PI) is 4.66. The optimal concentration of IPTG for induced expression is 0.5 mM.

[0083] 3. Inoculate 1 mL of the bacterial culture of the expression strain with the best effect prepared in step 2 into 50 mL of LA liquid medium, and shake overnight at 220 rpm on a shaker at 37°C for small-scale amplification to obtain a small-scale amplified bacterial culture; transfer the small-scale amplified bacterial culture to a large shaker flask filled with LA liquid medium. Inoculate 25 mL of the small-scale amplified bacterial culture into every 1 L of LA liquid medium, and shake a total of 2 L of bacteria at 37°C and 220 rpm for 3 h. When the OD 600 reaches 0.6, let the bacterial culture stand on ice for 15 min to cool down. Add IPTG to the bacterial culture to a final concentration of 0.5 mM, and continue to shake and culture for induced expression for 16 h to obtain a 0.5 mM IPTG-induced expression bacterial culture.

[0084] Centrifuge the 0.5 mM IPTG-induced expression bacterial culture at 4°C and 7,000 rpm for 15 min, discard the supernatant, pipette the bacteria with 30 mL of phosphate buffer (PBS), and then shake with a vortex oscillator to completely resuspend the bacteria and transfer them to a 50-mL centrifuge tube. Centrifuge at 4°C and 4,000 rpm for 30 min, discard the supernatant, collect the bacteria, weighing approximately 11.0 g.

[0085] Ultrasonically break the bacteria, centrifuge at 17,000 rpm for 1 h, take the supernatant and purify it through a 5-mL Ni NTA affinity chromatography column, and perform SDS-PAGE electrophoresis and staining according to the method in step 2 (Figure 9 )。

[0086] Set the washing solutions Wash1, Wash2, and the elution solution Elution to be composed of Tris-HCl (tris(hydroxymethyl)aminomethane hydrochloride), NaCl, and Imidazole, with a pH of 8.0;

[0087] Among them, the Tris-HCl concentration in Wash1 is 20 mM, the NaCl concentration is 300 mM, and the Imidazole concentration is 20 mM;

[0088] The Tris-HCl concentration in the washing solution Wash2 is 20 mM, the NaCl concentration is 300 mM, and the Imidazole concentration is 40 mM;

[0089] The Tris-HCl concentration in the elution solution Elution is 20 mM, the NaCl concentration is 300 mM, and the Imidazole concentration is 250 mM Imidazole.

[0090] Finally, 5.5 mL of recombinant protein (rGcKSI) with a concentration of 0.93 mg / mL was collected.

[0091] The recombinant protein (rGcKSI) was dissolved in 50 mM Tris-HCl, 1 mM CaCl2, and 0.1% (v / v) Tween-20 to obtain a recombinant protein (rGcKSI) solution, which was stored at -80 °C for subsequent experiments.

[0092] Example 3 Function of the recombinant Kunitz protein of Gyrodactylus cichlidarum

[0093] 1. Kunitz protein is a serine protease inhibitor. To verify the enzyme activity inhibition function of the recombinant Gyrodactylus cichlidarum kunitz protein rGcKSI expressed and purified in Example 2, several common serine protease standards and their corresponding substrates (Table 2) were used for detection. The addition amounts of rGcKSI and the control group protein were both 5 μM, and the reaction was carried out at 37 °C for 30 min to detect OD 410 。

[0094] The results showed that rGcKSI had obvious inhibitory effects on thrombin and factor FXa (coagulation factor Xa). 5 μM of rGcKSI inhibited the activities of thrombin and factor FXa by about 20% ( Figure 10 )。

[0095] Table 2 Serine protease standards and their corresponding chromogenic substrates

[0096]

[0097] 2. Multiple studies have shown that the fish complement system is the main force in resisting Gyrodactylus infection. After tilapia is infected with Gyrodactylus, the expression of multiple complement genes is significantly up-regulated in the liver, spleen, and skin; and in vitro experiments have confirmed that tilapia complement has a strong killing effect on Gyrodactylus cichlidarum. After heat-inactivating the complement and neutralizing it with complement C3 antibody, the survival rate of Gyrodactylus cichlidarum has increased significantly. After using cation chelation and specific chemicals to inhibit different complement pathways, it is found that the killing effect of complement on Gyrodactylus mainly activates through the alternative pathway, and the classical pathway is also involved. And multiple molecules in the complement system belong to serine proteases, including C1r, C1s, and C2 involved in the activation of the classical pathway, MASP-1 (mannan-binding lectin serine peptidase-1), MASP-2 (mannan-binding lectin serine peptidase-2), and MASP-3 (mannan-binding lectin serine peptidase-3) involved in the activation of the lectin pathway, and factor D (prothrombin kinase D), factor B (prothrombin kinase B), and factor I (prothrombin kinase I) involved in the activation and regulation of the alternative pathway, etc. Existing studies have shown that the complement of teleost fish can lyse the erythrocytes of various mammals, and rabbit erythrocytes are the best complement activators.

[0098] The complement in fish serum can lyse the erythrocytes of mammals, and the activity of fish complement can be determined according to the lysis degree of 2% rabbit erythrocytes. Therefore, 2% (w / v) rabbit erythrocytes are used to detect the inhibitory effect of rGcKSI on the activity of complement in tilapia serum.

[0099] The total experimental system is 250 μL: 100 μL of 2% (w / v) rabbit erythrocytes, 50 μL of tilapia serum and rGcKSI, and the total experimental system is made up to 250 μL with PBS. Among them, rGcKSI is set at 3 concentration gradients, and its final concentrations are 1 μM, 5 μM, and 10 μM respectively.

[0100] A positive control complete hemolysis group (without rGcKSI), a negative control non-hemolysis group (without tilapia serum), and an irrelevant protein NusA control group (NusA is a tag protein carried on the recombinant expression vector) are set up.

[0101] The experiment is carried out in a 96-well enzyme-linked immunosorbent assay plate. Each treatment group has three replicates. According to the preliminary experiment, hemolysis starts about 6 min after the addition of each group system. OD is detected starting from the 6th minute. 540 (The amount of hemolyzed blood cells can be determined by the OD 540 value), and it is detected once per minute. The complete hemolysis time of each group is based on the OD value no longer changing, and the complete hemolysis times of each group are compared. And at 15 min of hemolysis, the state of blood cells in each group is photographed using an inverted microscope.

[0102] The results showed that rGcKSI significantly prolonged the time for the complete lysis of rabbit red blood cells by tilapia complement, and it was concentration-dependent. Among them, 10 μM rGcKSI could prolong the hemolysis time by about 80% ( Figure 11 ). The hemolysis of blood cells in each group was observed under a microscope. At 20 min of hemolysis, the blood cell conditions in the rGcKSI group ( Figure 12 C) were similar to those in the blank control group ( Figure 12 A), and no obvious cell lysis and death were seen in the field of view. While in the complete hemolysis group ( Figure 12 B) and the NusA protein control group ( Figure 12 D), a large number of blood cells after lysis and death were seen aggregated into lumps. In summary, rGcKSI has a significant inhibitory effect on the activity of tilapia complement.

[0103] Example 4 Immunogenicity and Immunoprotection of Recombinant Kunitz Protein of Gyrodactylus cichlidarum

[0104] To explore whether rGcKSI has the potential to be a vaccine target, tilapia were immunized by intraperitoneal injection, and then infection experiments were carried out. The infection abundance of Gyrodactylus in each group was counted, and the production of IgM (immunoglobulin M) antibodies in each group of fish was detected and counted by enzyme-linked immunosorbent assay (ELISA) to detect the immunogenicity and immunoprotection of rGcKSI.

[0105] The experimental tilapia had a body length of 4.9 ± 0.5 cm and a body weight of 2.0 ± 0.5 g. They were divided into 4 groups, with 15 fish in each group. Each fish was injected and immunized twice. The second injection was carried out 1 week after the first injection, and serum and body surface mucus samples were taken 10 days after the second injection, and then Gyrodactylus infection experiments were carried out. The antigen amount for both injections was 20 μg per fish. For the infection experiment with the input of Gyrodactylus, the input amount of Gyrodactylus per fish was 30.

[0106] The recombinant protein rGcKSI solution was emulsified and mixed evenly with Freund's adjuvant. The volume ratio of the recombinant protein rGcKSI solution to Freund's adjuvant was 1:1 to obtain the rGcKSI immunization group injection solution, with an injection volume of 40 μL. The same volume of PBS or Freund's adjuvant was injected as a control; in addition, complete Freund's adjuvant was used for the first injection and incomplete Freund's adjuvant was used for the second injection. The concentration of the recombinant protein rGcKSI in the immunization group injection solution and the control protein NusA in the irrelevant protein control group was both 1 mg / mL. The specific injection information for each group is shown in Table 3.

[0107] Table 3 Grouping of Injection Immunization Experiments

[0108]

[0109] The results showed that the infection abundance of Gyrodactylus in the rGcKSI immunized group was extremely significantly lower than that in the control group throughout the infection cycle (P<0.001), reducing the infection amount of Gyrodactylus by 5-10 times, and having good immune protection. Figure 13 A); and 10 days after the second injection, that is, before the start of the infection experiment, the IgM antibody contents in the serum and body surface mucus of tilapia in the rGcKSI immunized group were extremely significantly higher than those in the PBS control group (P<0.01), proving that rGcKSI had good immunogenicity. Figure 13 B).

[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A serine protease inhibitor of Trichoderma cichlids, characterized in that: The serine protease inhibitor of Trichoderma cichlids is a Kunitz-type serine protease inhibitor, which is a GcKSI protein. The amino acid sequence of the GcKSI protein is shown in SEQ ID NO:

2.

2. Use of the serine protease inhibitor of Trichodina cichlids according to claim 1 as an immunogen or molecular target in the preparation of products for preventing and treating monogenean trematodes in tilapia.

3. The gene encoding the serine protease inhibitor of Trichoderma cichlids according to claim 1, characterized in that: The nucleotide sequence of the coding gene is shown in SEQ ID NO:

1.

4. A recombinant expression vector, characterized in that: The recombinant expression vector expresses the serine protease inhibitor of the trichodina cichlid described in claim 1.

5. A recombinant engineered bacterium, characterized in that: The recombinant engineered bacteria contains the recombinant expression vector according to claim 4.

6. A recombinant protein of serine protease inhibitor of Trichoderma cichlids, characterized in that: The amino acid sequence of the serine protease inhibitor recombinant protein of Trichoderma cichlids is shown in SEQ ID NO:

5.

7. Use of the serine protease inhibitor recombinant protein of Trichodina cichlids according to claim 6 in the preparation of products for preventing and treating monogenean trematodes in tilapia.

8. The method for preparing the recombinant protein of serine protease inhibitor of Trichoderma cichlids according to claim 6, characterized in that: The recombinant engineered bacteria according to claim 5 are cultured to express the serine protease inhibitor recombinant protein of Trichoderma cichlid.

9. The method for preparing the serine protease inhibitor recombinant protein of Trichoderma cichlids according to claim 8, characterized in that: The culture medium containing 0.1-1 mM isopropyl-β-D-thiogalactoside is used to induce the expression of the serine protease inhibitor recombinant protein of the cichlid tridentate.

10. A drug for preventing and treating monogenean trematode disease in tilapia, characterized in that: The medicine contains the serine protease inhibitor recombinant protein of Trichodina cichlids as claimed in claim 6.

Citation Information

Patent Citations

  • Method of modifying serine protease inhibitors

    CN102574909A

  • Preparation method and application of third-generation botryosphaeria formosa recombinant serine protease inhibitor

    CN117736309A

  • Inhibitors of human plasmin derived from the kunitz domains

    US20030165896A1