A recombinant kunitz protein of ichthyophthirius multifiliis and a preparation method and application thereof

Abstract

The present application relates to a guppy trichodinid third generation recombinant kunitz protein and a preparation method and application thereof, and belongs to the technical field of fish parasite protein expression and functional application research.The serine protease inhibitor of the guppy trichodinid third generation in the present application is a GcKSI protein, and the amino acid sequence of the GcKSI protein is shown as SEQ ID NO:2.The amino acid sequence of the GcKSI protein is optimized in the present application, and a GcKSI recombinant protein rGcKSI is obtained through prokaryotic expression.rGcKSI can inhibit the complement activity of a host fish in vitro, and has an obvious inhibitory effect on serine protease.The infection rate and average infection intensity of rohu fish injected with rGcKSI and then subjected to trichodinid infection experiment are significantly lower than those of a control group, proving that rGcKSI has good immunoprotective properties for trichodinid infection, and indicating that the serine protease inhibitor GcKSI gene and the GcKSI protein encoded by the GcKSI gene can be used as a new target for drug research and development.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of fish parasite protein expression and functional application research, and particularly relates to a guppy Gyrodactylus kunitz protein and a preparation method and application thereof. BACKGROUND

[0002] Monogenean belongs to Platyhelminthes Monogenea, widely parasitizes the gill, skin and stomach of marine, brackish water and freshwater fish in the world, and a few can parasitize amphibians and reptiles, is the most diverse fish ectoparasite; they usually use the anchor hook on the posterior sucker to insert into the parasitic site to cause mechanical damage, and often cause other pathogens to invade to cause coinfection, causing huge economic losses to fish farming industry. Gyrodactylus spp. is one of the typical representatives of monogenean, belongs to Gyrodactylidea, Gyrodactylidae and Gyrodactylus, mainly parasitizes the body surface and gill of fish, widely distributes in seawater and freshwater areas in the world, and can infect most wild and cultured fish.

[0003] The suitable temperature for the survival of Gyrodactylus is 20-25℃, and the disease is more prevalent in late spring and early summer, which is harmful to the fry and spring fish eggs, and can cause body surface wounds and secondary infection of bacteria and other pathogens. After the fish is parasitized by the worm, the fish can see abnormal secretion of mucus, congestion and patchy bleeding spots, and the skin of the sick fish forms a gray-blue, dull, mucus membrane, and the fish is extremely restless, swimming in the water, or rubbing the body against the pool wall, losing appetite, losing weight and even dying. Microscopy often shows that the worm is parasitic on the body surface, fins and gills. Earlier, Gyrodactylus salaris once caused devastating damage to the wild Atlantic salmon (Salmo salar) population in Norway, and in recent years there has been a trend of expanding the range of transmission; according to recent reports, Gyrodactylus has caused persistent harm to many economic fish species such as crucian carp (Carassius auratus), snakehead (Channa argus), tilapia (Oreochromis niloticus), carp (Cyprinus carpio) and loach (Misgurnus anguillicaudatus) in China; mass infection of Gyrodactylus kobayashi once caused large-scale death of goldfish (carassius auratus) in the water tribe market in Henan Province, China. At present, the applicant has successfully established an infection experiment model of Gyrodactylus cichlidarum and its host Nile tilapia (Oreochromis niloticus) in the laboratory, completed the preservation of Gyrodactylus cichlidarum, and reported the research on the immune defense mechanism of tilapia against Gyrodactylus.

[0004] Currently, the prevention and treatment methods of monogenean diseases including trichodiniasis are mainly formalin and other chemical drugs and antibiotics. The current national standard fishing drugs are mainly pesticides (difenzoquat and phoxim), livestock and poultry drugs (diclazuril and clonazuril) and medical drugs (moxidectin and praziquantel) raw materials. Long-term and over-dose use of insecticides in production will cause drug resistance, drug residues and environmental pollution, and also harm fish itself, making it more difficult to control diseases. In the past two years, there have been more and more reports on the drug resistance of monogeneans. Many fish farms are facing the dilemma of "no effective drugs available" when fish monogenean diseases break out. The development of new drugs and vaccines for monogenean diseases is imminent. However, due to the difficulty in sampling and the lack of suitable experimental models, there is almost no research on monogenean vaccines in China. Among monogeneans, Japan has reported a patent for a Benedenia seriolae vaccine, which is a DNA vaccine composed of a fragment of the serine protease gene of Benedenia seriolae. There have been no reports of its popularization and application. Among all fish parasites, there is currently one commercial vaccine, Providean Aquatec SeaLice, manufactured by Tecnovax S.A., an Argentine biopharmaceutical company.

[0005] The applicant's team has successfully established a model of Trichodinella sp.-Oreochromis niloticus infection in the laboratory, and for the first time obtained the genomic, transcriptomic and excreted / secreted protein data of Trichodinella sp. Some serine protease inhibitors in the excreted / secreted proteins of Trichodinella sp. have high abundance and may be involved in regulating the immune response of the host fish, thereby helping Trichodinella sp. to achieve immune escape, including kunitz-type serine protease inhibitors. Kunitz-type serine protease inhibitors are typical secreted proteins, and their main function is to inhibit serine protease activity, and in a few cases, they can also inhibit cysteine proteases or aspartic proteases. Kunitz proteins have a small molecular weight, usually only 6-8 kDa, and they all have an active protease binding domain containing 6 cysteine residues, which form 3 disulfide bonds to ensure the stability of protein folding. Kunitz proteins are involved in regulating various biological processes of organisms, such as cell proliferation, keratin layer formation and tissue remodeling, ion channel blocking, blood clotting, fibrinolysis, inflammation, etc. At the same time, kunitz proteins are also important bioactive compounds in the venom of sea anemones, spiders, scorpions and snakes. Some people have divided kunitz proteins into five types according to their functions: intracellular trypsin inhibitors, chymotrypsin inhibitors in venom, trypsin inhibitors in venom, bifunctional toxins and K +Channel blockers. Kunitz proteins have been studied in some parasitic helminths and their functions are speculated to be protection of the parasite from host digestive enzymes, regulation of endogenous cysteine proteases, immune evasion and immunomodulation.

[0006] Chinese patent CN117736309A discloses a preparation method and application of a first guppy tritrichomonas recombination serine protease inhibitor, obtains the cDNA sequence of GcSerpin gene, and obtains rGcSerpin protein through recombination vector construction and prokaryotic expression and purification. The rGcSerpin protein is involved in the immune interaction and immunoregulation of guppy tritrichomonas and tilapia, and the secretion of GcSerpin protein can significantly reduce the infection intensity of guppy tritrichomonas on tilapia in vitro. There are many types of serine proteases, and serine protease inhibitors also have many different types. Parasites regulate the immunity of host fish through the joint action of multiple proteins, so more tritrichomonas serine protease inhibitor genes and proteins need to be identified and studied to obtain more effective vaccine or drug targets and better apply them to fish tritrichomoniasis prevention and control. SUMMARY

[0007] In order to solve the problems of drug resistance and environmental pollution in the prevention and control of parasitic diseases in aquaculture production, the purpose of the present application is to provide an effective target for the development of fish tritrichomoniasis vaccine and drug, and to provide a guppy tritrichomonas recombination kunitz protein with potential as a vaccine drug target and easy to mass produce, and a preparation method and application thereof.

[0008] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0009] In a first aspect, the present application provides a serine protease inhibitor of guppy tritrichomonas, which is a kunitz type serine protease inhibitor, a GcKSI protein, and the amino acid sequence of the GcKSI protein is shown in SEQ ID NO: 2.

[0010] The present application finds that the serine protease inhibitor GcKSI protein of guppy tritrichomonas has good immunoprotective effect on tilapia infected with guppy tritrichomonas, and is an effective target for drug development.

[0011] In a second aspect, the present application provides the use of the serine protease inhibitor of guppy tritrichomonas as an immunogen or molecular target in the preparation of a drug for preventing and treating tilapia monogenean disease.

[0012] The GcKSI protein has a significant inhibitory effect on the activity of the tilapia fish complement, and designing a GcKSI protein inhibitor as a molecular target is beneficial to restore the activity of the tilapia fish complement, improve the immune function of the tilapia fish, and further prevent and treat the monogenean disease of the tilapia fish.

[0013] In the embodiment of the present application, the pathogen of the monogenean disease of the tilapia fish is the Dactylogyrus sp.

[0014] In a third aspect, the present application provides a coding gene of the serine protease inhibitor of the Dactylogyrus sp., and the nucleotide sequence of the coding gene is shown in SEQ ID NO: 1.

[0015] In a fourth aspect, the present application provides a recombinant expression vector expressing the serine protease inhibitor of the Dactylogyrus sp.

[0016] In the embodiment of the present application, the recombinant expression vector expresses the serine protease inhibitor recombinant protein of the Dactylogyrus sp. with the amino acid sequence shown in SEQ ID NO: 5.

[0017] In the embodiment of the present application, the recombinant expression vector uses pET-44b(+) as a skeleton vector.

[0018] In the embodiment of the present application, the recombinant expression vector uses pET-44b(+) as a skeleton vector, and the nucleotide sequence shown in SEQ ID NO: 4 is connected between the Sac I and Xho I enzyme cutting sites of the skeleton vector.

[0019] In a fifth aspect, the present application provides a recombinant engineering bacterium containing the recombinant expression vector.

[0020] Further, the recombinant engineering bacterium can be constructed by using E. coli BL21.

[0021] In a sixth aspect, the present application provides a serine protease inhibitor recombinant protein of the Dactylogyrus sp., and the amino acid sequence of the recombinant protein is shown in SEQ ID NO: 5. In the present application, the amino acid sequence of the GcKSI protein in the serine protease inhibitor of the Dactylogyrus sp. is optimized, the signal peptide is removed, and Sac I-Xho I enzyme cutting sites are added at both ends of the nucleotide sequence of the GcKSI protein coding gene, so as to obtain the serine protease inhibitor recombinant protein of the Dactylogyrus sp.

[0022] In a seventh aspect, the present application provides the use of the serine protease inhibitor recombinant protein of the Dactylogyrus sp. in the preparation of a drug for preventing and treating the monogenean disease of the tilapia fish.

[0023] In the detailed description of the present application, the pathogen of the monogenean disease of the rohu is Triadentria.

[0024] In the eighth aspect, the present application provides a method for preparing the recombinant protein of the serine protease inhibitor of the Triadentria, and the recombinant engineering bacteria are cultured to express the recombinant protein of the serine protease inhibitor of the Triadentria.

[0025] Further, the expression of the recombinant protein of the serine protease inhibitor of the Triadentria is induced by using a culture medium containing 0.1-1 mM isopropyl-β-D-thiogalactoside.

[0026] Preferably, the concentration of the isopropyl-β-D-thiogalactoside is 0.5 mM, which is the optimal concentration for inducing the expression of the recombinant protein of the serine protease inhibitor of the Triadentria.

[0027] Further, the culture temperature is 20-37°C, and the culture rotation speed is 100-300 rpm.

[0028] Further, the culture temperature is 20-37°C, and the culture rotation speed is 100-300 rpm.

[0029] Further, the culture of the recombinant engineering bacteria is performed to an OD 600 of 0.4-0.8, and the isopropyl-β-D-thiogalactoside is added for inducing the culture, and the induction culture time is 4-16 h.

[0030] Further, the culture of the recombinant engineering bacteria is performed to an OD 600 of 0.6, and the induction culture time is 16 h.

[0031] Further, the recombinant protein of the serine protease inhibitor of the Triadentria is purified.

[0032] Further, the recombinant protein of the serine protease inhibitor of the Triadentria is purified by Ni-NTA affinity chromatography.

[0033] Further, the bacterial body of the recombinant engineering bacteria is collected, the bacterial body is ultrasonically broken, centrifuged at 10,000-20,000 rpm for 0.5-1.5 h, the supernatant is taken, and the Ni NTA affinity chromatography column is used for washing and elution by using a washing solution and an elution solution containing Tris-HCl, NaCl and imidazole.

[0034] Further, the centrifugation is performed at 17,000 rpm for 1 h.

[0035] Further, in the washing solution and the elution solution, the concentration of Tris-HCl is 15-25 mM, the concentration of NaCl is 200-500 mM, and the concentration of imidazole is 10-30 mM.

[0036] Further, in the washing solution 1, the concentration of Tris-HCl is 20 mM, the concentration of NaCl is 300 mM, and the concentration of imidazole is 20 mM.

[0037] In the washing solution 2, the concentration of Tris-HCl is 20 mM, the concentration of NaCl is 300 mM, and the concentration of imidazole is 40 mM.

[0038] In the elution solution, the concentration of Tris-HCl is 20 mM, the concentration of NaCl is 300 mM, and the concentration of imidazole is 250 mM.

[0039] In a ninth aspect, the present application provides a drug for preventing and treating monogenean disease of Oreochromis niloticus, wherein the drug contains the recombinant protein of serine protease inhibitor of Triadentate.

[0040] In the detailed description of the present application, the drug includes a vaccine.

[0041] Further, the drug further contains a pharmaceutically acceptable carrier.

[0042] Further, the vaccine contains a vaccine adjuvant.

[0043] In the detailed description of the present application, the vaccine adjuvant is Freund's adjuvant.

[0044] Further, the concentration of the recombinant protein of serine protease inhibitor of Triadentate in the vaccine is 0.5-2 mg / mL, preferably 1 mg / mL.

[0045] Compared with the prior art, the present application has the following beneficial effects:

[0046] The present application clones the full-length cDNA of the kunitz-type serine protease inhibitor GcKSI gene of Triadentate by RACE technology, and analyzes the GcKSI protein coded by the gene. The GcKSI recombinant protein rGcKSI is obtained by optimizing the amino acid sequence of the GcKSI protein and performing prokaryotic expression. The rGcKSI inhibits the complement activity of host fish in vitro, and has obvious inhibitory effect on serine protease. The infection rate and average infection intensity of the rGcKSI-injected and immunized Oreochromis niloticus after Triadentate infection are significantly lower than those of the control group, which proves that the rGcKSI has good immunoprotection against Triadentate infection, and indicates that the serine protease inhibitor GcKSI gene and the GcKSI protein coded thereby can be used as a new target for drug research and development. BRIEF DESCRIPTION OF DRAWINGS

[0047] Figure 1Figure 1 is a diagram of the full-length nucleotide sequence of the cDNA of the GcKSI gene and the encoded amino acid sequence. The numbers on both sides of each row of nucleotide sequence represent the positions of nucleotides and amino acids; the start codon (ATG) and the stop codon (TAA) are underlined; "*" represents the terminator; the poly(A) tail is marked with italic; the polyadenylation signal is in bold; the signal peptide sequence is in a box; the shaded part represents the phosphorylation site; the glycosylation site is in a circle.

[0048] Figure 2 Figure 4 is an analysis of the signal peptide structure of the GcKSI protein.

[0049] Figure 3 Figure 5 is an analysis of the phosphorylation site of the GcKSI protein.

[0050] Figure 4 Figure 6 is an analysis of the conserved domain of the GcKSI protein.

[0051] Figure 5 Figure 7 is a structure prediction of the GcKSI protein.

[0052] Figure 6 Figure 8 is a physical map of the pET-44b(+) vector. The red box represents the restriction enzyme site used in the present application.

[0053] Figure 7 Figure 9 is a diagram of the nucleotide sequence of the GcKSI gene after optimization and removal of the signal peptide with the addition of a Sac I-Xho I restriction enzyme site linker sequence. The numbers on both sides of each row of nucleotide sequence represent the positions of nucleotides and amino acids; the added restriction enzyme site is in a box.

[0054] Figure 8 Figure 10 is a diagram of the SDS-PAGE identification (coomassie brilliant blue staining) of the GcKSI protein after induction of expression by isopropyl-β-D-thiogalactopyranoside (IPTG). M is a standard protein marker, and the red arrow indicates the target band.

[0055] Figure 9 Figure 11 is a diagram of the SDS-PAGE identification (coomassie brilliant blue staining) of the GcKSI protein after purification by Ni NTA column. M is a standard protein marker, and the red arrow indicates the target band.

[0056] Figure 10 Figure 12 is the inhibitory effect of the recombinant protein rGcKSI on serine proteases. Trypsin is trypsin; Chymotrypsin is chymotrypsin; Thrombin is thrombin; and FXa is factor Xa (coagulation factor Xa).

[0057] Figure 11The concentration-dependent effect of recombinant protein rGcKSI on the complement-mediated lysis of rabbit red blood cells in tilapia. LT represents lysis time (complete hemolysis time).

[0058] Figure 12 The lysis of rabbit red blood cells in each group 20 min after the start of the hemolysis experiment. Among them, A is the blank control group; B is the complete hemolysis group; C is the rGcKSI group; D is the NusA protein control group. The scale in the figure is 50 μm.

[0059] Figure 13 The immunogenicity and immunoprotection of recombinant protein rGcKSI. Among them, A is the infection abundance statistics of each group after rGcKSI injection immunization; B is the ELISA detection result of tilapia IgM (immunoglobulin M) antibody content after rGcKSI injection immunization; ** represents P<0.01, and *** represents P<0.001. DETAILED DESCRIPTION

[0060] In order to better illustrate the purpose, technical scheme and advantages of the present application, the present application will be further described below in combination with specific examples. Unless otherwise specified, other materials, reagents, etc. used in the examples can be obtained from commercial channels.

[0061] Example 1 Cloning of the full-length cDNA of the Kunitz gene of Triactinomyxon in guppy

[0062] The primers used for RACE (Rapid amplification of cdna end) cloning are shown in Table 1. The RACE amplification was performed using the kit SMARTer RACE 5’ / 3’ Kit–634858 (Takara, Dalian, China) according to the instructions. The amplified fragments were cut and recovered and ligated to the pMD 18-T vector. Then, the bacteria were transformed into DH5α competent cells, and the bacterial liquid was sequenced. After splicing the sequencing results, the full-length cDNA gene sequence of the GcKSI gene was obtained.

[0063] Table 1 Primers for cloning the Kunitz gene of Triactinomyxon in guppy

[0064]

[0065] The full-length cDNA of the GcKSI gene is 585 bp, including an open reading frame (ORF) of 423 bp ( Figure 1 ), which can encode 140 amino acids with an estimated molecular weight of 15.768 kDa and an isoelectric point (pI) of 4.32. The N-terminal of the GcKSI protein contains a 17-amino-acid-residue secretory protein signal peptide ( Figure 2), with 3 asparagine glycosylation sites, and 6 serine, 7 threonine and 1 tyrosine phosphorylation sites Figure 3 )Conserved domain analysis results show that the GcKSI protein amino acid sequence includes a BPTI / Kunitz family serine protease inhibitor domain, and a set of trypsin interaction sites Figure 4 )Protein structure prediction results show that the GcKSI protein is composed of 22 alpha helices, 38 extended chains and numerous irregular coils Figure 5

[0066] The nucleotide sequence of the cDNA of the GcKSI gene is shown in SEQ ID NO: 1, and the amino acid sequence of the GcKSI protein is shown in SEQ ID NO: 2.

[0067] Example 2 Preparation method of prokaryotic expression of Kunitz protein of Triactinomyxon of guppy

[0068] 1. Construct GcKSI gene expression vector

[0069] The pET-44b(+) vector used for prokaryotic expression was purchased from Guangzhou Jidan Biotechnology Co., Ltd., and was cloned at the Sac I-Xho I enzyme cutting site after bioinformatics analysis Figure 6 )。

[0070] The Sac I-Xho I enzyme cutting site linker sequence was added to both ends of the optimized and signal peptide-removed GcKSI gene sequence Figure 7 ), the nucleotide sequence of the optimized and signal peptide-removed GcKSI gene after adding the Sac I-Xho I enzyme cutting site linker sequence is shown in SEQ ID NO: 4 (as a fragment to be connected), and the final encoded recombinant protein (rGcKSI) amino acid sequence is shown in SEQ ID NO: 5.

[0071] The pET-44b(+) vector was linearized by double enzyme cutting linearization of the pET-44b(+) vector with Sac I (brand: Takara, product number: 1078S) and Xho I (brand: Takara, product number: 1094S) restriction endonucleases.

[0072] ​The linearized pET-44b(+) vector and the target fragment to be ligated were ligated using T4 ligase (Takara) to obtain a ligation product. The ligation product was transformed into Escherichia coli DH5α competent cells, spread on LA plate medium (Luria-Bertani medium supplemented with ampicillin), and cultured for 12 to 16 hours. The next day, 10 monoclonal colonies were picked and cultured in LA liquid medium at 37°C and 220 rpm to obtain a bacterial solution, which was then PCR amplified and sequenced using the universal primers T7 / ColiDOWN.

[0073] Primer T7: TAATACGACTCACTATAGGG;

[0074] Primer ColiDOWN: TTCACTTCTGAGTTCGGCATG.

[0075] PCR amplification system: sterile water 18 μL, bacterial solution 1 μL, ExTaq enzyme (brand: Takara, product number: RR001A) 0.5 μL, buffer 2.5 μL, dNTP 2 μL, T7 primer 0.5 μL, ColiDOWN primer 0.5 μL.

[0076] Conventional PCR procedures were used, with primer annealing temperature of 55°C and extension time of 1 min.

[0077] According to the sequencing results, the monoclonal strain with the correct sequencing sequence was retained to obtain the corresponding bacterial solution. 40% (w / v) glycerol was added, and the volume ratio of the bacterial solution to 40% (w / v) glycerol was 1:1. The culture was stored at -80°C, and the monoclonal strain with the correct sequencing sequence was expanded and cultured. The plasmid was extracted to obtain the GcKSI gene expression vector for use in subsequent experiments.

[0078] 2. Transform the GcKSI gene expression vector constructed in step 1 into Escherichia coli BL21 competent cells, spread on LA plate medium and culture overnight. On the next day, pick 10 single clones and expand the culture in LA liquid medium at 37°C and 220 rpm. Perform PCR identification of the bacterial solution using the universal primers T7 / ColiDOWN according to step 1.

[0079] After 3 hours of shaking culture, the strain OD 600 When the concentration reached 0.6, 100 mM isopropyl-β-D-thiogalactopyranoside (IPTG) was added to make the final concentrations of IPTG 1 mM, 0.5 mM and 0.1 mM, respectively. The culture was continued with shaking for 4 h to obtain three IPTG-induced bacterial solutions.

[0080] 400 μL from each of the three IPTG-induced bacterial solutions, and 400 μL of a randomly selected bacterial solution without IPTG induction were taken as a negative control. All bacterial solution samples were centrifuged at 13000 rpm at room temperature for 1 min, and the supernatant was discarded. Then, 50 μL of 1x SDS Loading dye (brand: Biyun Tian, product number: P0281S) was added, and the bacterial solution was resuspended by blowing with a pipette gun. The resuspended solution was boiled in a 95°C constant temperature metal bath for 10 min to break the bacterial cells and release the proteins. The boiled sample was obtained.

[0081] The boiled sample was centrifuged at 13000 rpm at room temperature for 1 min, and 10 μL of each was taken for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and staining with Coomassie Brilliant Blue G250. The best expression strain was selected, and the corresponding bacterial solution was obtained. Then, 40% (w / v) glycerol was added, and the volume ratio of the bacterial solution to 40% (w / v) glycerol was 1:1. The solution was stored at -80°C.

[0082] The GcKSI protein was expressed in fusion with the NusA (transcription termination / anti-termination protein) tag on the pET-44b(+) vector. The molecular weight of the fusion protein was about 90 kDa Figure 8 ), and the isoelectric point (PI) was 4.66. The optimal concentration of IPTG for induction was 0.5 mM.

[0083] 3. The bacterial solution of the best expression strain prepared in step 2 was inoculated into 50 mL of LA liquid medium, and the solution was shaken at 220 rpm at 37°C overnight for small-scale amplification. The small-scale amplification bacterial solution was transferred to a large flask containing LA liquid medium. 25 mL of the small-scale amplification bacterial solution was inoculated into each 1 L of LA liquid medium, and a total of 2 L of bacterial solution was shaken at 37°C at 220 rpm for 3 h. When the OD 600 600, the bacterial solution was cooled on ice for 15 min. IPTG was added to the bacterial solution to a final concentration of 0.5 mM, and the bacterial solution was further shaken and cultured for 16 h for induction of expression. The 0.5 mM IPTG-induced expression bacterial solution was obtained.

[0084] The 0.5 mM IPTG-induced expression bacterial solution was centrifuged at 4°C and 7000 rpm for 15 min, and the supernatant was discarded. The bacterial cells were resuspended by blowing with 30 mL of phosphate buffered saline (PBS) and vortexing. The resuspended solution was transferred to a 50 mL centrifuge tube and centrifuged at 4°C and 4000 rpm for 30 min. The supernatant was discarded, and the bacterial cells were collected, weighing about 11.0 g.

[0085] The bacterial cells were ultrasonically broken, and centrifuged at 17000 rpm for 1 h. The supernatant was purified by passing through a 5 mL Ni NTA affinity chromatography column, and SDS-PAGE electrophoresis and staining were performed according to the method of step 2.Figure 9 ).

[0086] The wash solution Washl, wash solution Wash2 and elution solution Elution are all composed of Tris-HCl, NaCl and Imidazole, pH 8.0;

[0087] wherein the Tris-HCl concentration of Washl is 20 mM, the NaCl concentration is 300 mM, and the Imidazole concentration is 20 mM;

[0088] The Tris-HCl concentration of Wash2 is 20 mM, the NaCl concentration is 300 mM, and the Imidazole concentration is 40 mM;

[0089] The Tris-HCl concentration of Elution is 20 mM, the NaCl concentration is 300 mM, and the Imidazole concentration is 250 mM.

[0090] The final concentration of the recombinant protein (rGcKSI) is 0.93 mg / mL, and 5.5 mL is collected.

[0091] The recombinant protein (rGcKSI) is dissolved in 50 mM Tris-HCl, 1 mM CaCl2 and 0.1% (v / v) Tween-20 to obtain a recombinant protein (rGcKSI) solution, which is stored at -80°C for subsequent experiments.

[0092] Example 3 Function of the recombinant Kunitz protein of Triactinomyces

[0093] 1. Kunitz protein is a serine protease inhibitor. In order to verify the enzyme activity inhibition function of the recombinant Triactinomyces kunitz protein rGcKSI purified by prokaryotic expression in Example 2, several common serine protease standards and their corresponding substrates (Table 2) were detected. The addition amount of rGcKSI and the control protein was 5 μM, and the reaction was carried out at 37°C for 30 min, and the OD 410 .

[0094] The results show that rGcKSI has obvious inhibitory effect on thrombin and FXa factor (coagulation factor Xa), and 5 μM of rGcKSI inhibits about 20% activity of thrombin and FXa factor Figure 10 ).

[0095] Table 2 Serine protease standards and their corresponding chromogenic substrates

[0096]

[0097] 2、Multiple studies have shown that the complement system of fish is the main force against the infection of trichodinid. After the infection of trichodinid, the expression of multiple complement genes in the liver, spleen and skin of tilapia was significantly up-regulated. In vitro experiments confirmed that the complement of tilapia had a strong killing effect on trichodinid. The survival rate of trichodinid increased significantly after the heat-inactivated complement and the addition of complement C3 antibody. The use of cation chelation and specific chemicals to inhibit different complement pathways showed that the killing effect of complement on trichodinid was mainly through the activation of the alternative pathway, and the classical pathway was also involved. Multiple molecules in the complement system belong to serine proteases, including Clr, Cls and C2 involved in the activation of the classical pathway, MASP-1 (mannan-binding lectin serine peptidase-1), MASP-2 (mannan-binding lectin serine peptidase-2) and MASP-3 (mannan-binding lectin serine peptidase-3) involved in the activation of the lectin pathway, and factor D (properdin-activating factor D), factor B (properdin-activating factor B) and factor I (properdin-activating factor I) involved in the activation and regulation of the alternative pathway. Previous studies have shown that the complement of teleost fish can lyse the erythrocytes of various mammals, and rabbit erythrocytes are the best complement activators.

[0098] The complement in the serum of fish can lyse the erythrocytes of mammals, and the activity of fish complement can be determined by the degree of lysis of 2% rabbit erythrocytes. Therefore, 2% (w / v) rabbit erythrocytes were used to detect the inhibitory effect of rGcKSI on the activity of complement in the serum of tilapia.

[0099] The total experimental system was 250 μL: 100 μL 2% (w / v) rabbit erythrocytes, 50 μL tilapia serum and rGcKSI, and the total experimental system was supplemented with PBS to 250 μL. Three concentration gradients of rGcKSI were set, and the final concentrations were 1 μM, 5 μM and 10 μM, respectively.

[0100] A positive control complete hemolysis group (without adding rGcKSI) and a negative control non-hemolysis group (without adding tilapia serum) were set, as well as a control group of irrelevant protein NusA (NusA is a tag protein on a recombinant expression vector).

[0101] The experiment was carried out in a 96-well enzyme-labeled plate, and each treatment group had three replicates. According to the observation of the pre-experiment, hemolysis began about 6 min after the addition of each group, and OD 540 was detected from 6 min. The complete hemolysis time of each group was determined by the fact that OD 540 value no longer changed, and the complete hemolysis time of each group was compared. At 15 min of hemolysis, an inverted microscope was used to take pictures of the state of the erythrocytes in each group.

[0102] The results showed that rGcKSI significantly prolonged the time of complete hemolysis of rabbit red blood cells by tilapia complement, and had a concentration-dependent effect, in which 10 mM of rGcKSI could prolong the hemolysis time by about 80% ( Figure 11 ). The hemolysis of blood cells in each group was observed under a microscope. At 20 min of hemolysis, the blood cells in the rGcKSI group ( Figure 12 C) were similar to those in the blank control group ( Figure 12 A), and no obvious cell lysis and death was observed in the field of view, while a large number of lysed and dead blood cells were observed in the complete hemolysis group ( Figure 12 B) and the NusA protein control group ( Figure 12 D) and aggregated into clumps. In summary, rGcKSI had a significant inhibitory effect on the activity of tilapia complement.

[0103] Example 4 Immunogenicity and immunoprotection of tilapia three generations of recombinant Kunitz protein

[0104] To explore whether rGcKSI has the potential as a vaccine target, tilapia was immunized by intraperitoneal injection, and then an infection experiment was performed to count the infection abundance of three generations of parasites in each group, and the production of IgM (immunoglobulin M) antibodies in each group of fish was detected by enzyme-linked immunosorbent assay (ELISA) to detect the immunogenicity and immunoprotection of rGcKSI.

[0105] The experimental tilapia had a body length of 4.9 ± 0.5 cm and a body weight of 2.0 ± 0.5 g, and was divided into 4 groups, 15 fish in each group. Each fish was injected twice, the second injection was performed 1 week after the first injection, and the serum and body surface mucus were sampled 10 days after the second injection, and the three generations of parasite infection experiment was performed. The amount of antigen for two injections was 20 pg per fish. The tilapia was infected with 30 three generations of parasites per fish.

[0106] The recombinant protein rGcKSI solution was emulsified with Freund's adjuvant, and the volume ratio of the recombinant protein rGcKSI solution to Freund's adjuvant was 1:1 to obtain the rGcKSI injection solution. The injection volume was 40 pL, and the same volume of PBS or Freund's adjuvant was injected as a control. In addition, the first injection used complete Freund's adjuvant, and the second injection used incomplete Freund's adjuvant. The concentration of recombinant protein rGcKSI in the injection solution of the immunization group was 1 mg / mL, and the concentration of control protein NusA in the irrelevant protein control group was also 1 mg / mL. The injection information of each group is shown in Table 3.

[0107] Table 3 Injection immunization experiment grouping

[0108]

[0109] The results showed that the abundance of the third generation of parasites in the rGcKSI immunization group was significantly lower than that in the control group throughout the infection cycle (P<0.001), reducing the infection amount of the third generation of parasites by 5 to 10 times, and having good immune protection ( Figure 13 A); and 10 days after the second injection, that is, before the start of the infection experiment, the IgM antibody levels in the serum and mucus of the tilapia in the rGcKSI immunization group were significantly higher than those in the PBS control group (P<0.01), proving that rGcKSI has good immunogenicity ( Figure 13 B).

[0110] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that the technical solutions of the present invention may be modified or replaced by equivalents without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A recombinant protein of a serine protease inhibitor of Ichthyophthirius multifiliis, characterized in that, The amino acid sequence of the recombinant protein of the serine protease inhibitor of Triactinomyxon is shown as SEQ ID NO:

5.

2. The gene encoding the recombinant protein of the serine protease inhibitor of Triactinomyxon of the fish of claim 1, characterized by, The nucleotide sequence of the coding gene is shown as SEQ ID NO:

3.

3. A recombinant expression vector, characterized in that, The recombinant expression vector expresses the recombinant protein of the serine protease inhibitor of Triactinomyxon according to claim 1.

4. A recombinant engineered bacterium, characterized in that, The recombinant engineering bacteria contain the recombinant expression vector according to claim 3.

5. The recombinant protein of the serine protease inhibitor of Triactinomyxon according to claim 1 is used in the preparation of products for preventing and treating the disease of Triactinomyxon in Tilapia.

6. The method for preparing the recombinant serine protease inhibitor protein of Trichoderma cichlids according to claim 1, characterized in that: The recombinant engineering bacteria according to claim 4 are cultured to express the recombinant protein of the serine protease inhibitor of Triactinomyxon.

7. The method for preparing the serine protease inhibitor recombinant protein of Trichoderma cichlids according to claim 6, characterized in that: The expression of the recombinant protein of the serine protease inhibitor of Triactinomyxon is induced by using a culture medium containing 0.1-1 mM isopropyl-β-D-thiogalactoside.

8. A medicament for preventing and treating monogenean disease of Tilapia mossambica, characterized by comprising the compound of claim 1 or 2 as an active ingredient. The medicine contains the recombinant protein of the serine protease inhibitor of Triactinomyxon according to claim 1.

Images