Saccharomyces cerevisiae engineering bacterium for producing equol by taking daidzein as substrate and application of saccharomyces cerevisiae engineering bacterium

By introducing daidinetin racemase and reductase genes into Saccharomyces cerevisiae, recombinant strains were constructed, and the stability and yield problems of S-esterol production using daidinetin as substrate were solved, and efficient and simple S-esterol fermentation production was achieved, which was suitable for industrialization.

CN120230656APending Publication Date: 2025-07-01BLOOMAGE BIOTECHNOLOGY CORP LTD +1

Patent Information

Application Number
CN202311867970.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-29
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

The prior art is difficult to efficiently and stably produce S-equol using daidase as substrate, and there are problems such as unstable fermentation, low yield, and the need for addition of antibiotics.

Method used

Genetically engineered bacteria with Saccharomyces cerevisiae as the chassis microorganism, introduce daidzein racemase and reductase genes, form recombinant strains, and can efficiently produce S-esterol with daidzein as the substrate.

Benefits of technology

The stable and simple fermentation of S-equol was achieved with daidase as the substrate, which increased the yield and did not require antibiotics. It was suitable for industrial production and had the potential for further metabolic engineering transformation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120230656A_ABST
    Figure CN120230656A_ABST
Patent Text Reader

Abstract

The invention provides a genetically engineered bacterium for producing equol by taking daidzein as a substrate, and belongs to the field of genetic engineering. The genetically engineered bacterium is a recombinant strain which takes saccharomyces cerevisiae as a chassis microorganism and contains racemic enzyme and reductase of daidzein. The genetically engineered bacterium provided by the invention can be fermented by using a common culture medium of saccharomyces cerevisiae, equol, especially S-equol, can be simply and stably fermented and produced, antibiotics do not need to be added, the genetically engineered bacterium provided by the invention is also suitable for further metabolic engineering transformation, the production efficiency of equol is further improved, and the production cost is reduced. And the method has higher S-equol production potential.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a Saccharomyces cerevisiae engineering bacterium for producing equol using daidzein as a substrate, a construction method thereof, and an application thereof. Background Art

[0002] Equol (EQL) is one of the metabolites of soy isoflavones. Some studies have shown that the biological effects of soy isoflavones may, to some extent, be attributed to equol. Equol is a racemic compound with a pair of enantiomers, namely S-type and R-type. Among them, the biological activity of S-equol against certain substances is much higher than that of R-equol. Therefore, the synthesis of S-equol has become a research hotspot. However, all current chemical synthesis methods of S-equol have disadvantages such as low yield, cumbersome steps, and the product being a racemic compound mixed with R-equol and S-equol.

[0003] Constructing genetic engineering strains using microorganisms has become an important path for researchers to explore how to increase the yield of S-equol. Currently, most of the existing recombinant strains for biosynthesizing equol use one or more anaerobic microorganisms derived from the intestine for anaerobic fermentation to produce equol. For example, the patents "Composition of lactic acid bacteria producing equol" (Application No.: CN200480020952.4), "Fermented product containing equol-producing microorganism maintaining equol-producing ability and preparation method thereof" (Application No.: CN201610096187.9), and "An equol-producing Clostridium C1-6 derived from chicken intestine and application thereof" (Application No.: CN201410320599.7). However, anaerobic fermentation processes including the above-mentioned schemes often have disadvantages such as low yield, complex strain fermentation processes, and unstable fermentation. Currently, no mature cultivation method has been established for these types of microorganisms, so it is difficult to efficiently produce equol on an industrial scale through fermentation. Moreover, no mature genetic modification system has been established for these microorganisms, so their metabolism cannot be modified to produce high-yield equol, which limits the production potential of these methods. In recent years, a process for fermenting and producing equol using engineered Escherichia coli has also been developed. However, due to the low tolerance of the Escherichia coli host to substrates and products, the improvement space of fermentation yield is limited. In addition, multiple antibiotics need to be added during the fermentation process of the Escherichia coli host, and endotoxins are easily produced, which greatly increases the difficulty of the subsequent purification process and brings risks to product safety.

[0004] As a eukaryotic microorganism, Saccharomyces cerevisiae has strong robustness and is widely used in the fermentation production of active substances such as flavonoids and terpenoids. Compared with prokaryotes as chassis microorganisms without post-translational modification processes (such as Escherichia coli), Saccharomyces cerevisiae as a eukaryote will have post-translational modification or glycosylation processes, resulting in the expression of active substances as a chassis microorganism being unknown (Hongting Tang et al., 2016, DOI: 10.1038 / srep25654). For example, Liu Yuxue et al. (Reference: Liu Yuxue, Zhang Yixin, Wang Lei, etc. Recombinant Saccharomyces cerevisiae catalyzes the production of equol from daidzein [J]. China Biotechnology Journal, 2014, 34(4): 41-45.) constructed a recombinant Saccharomyces cerevisiae capable of expressing the key enzymes orf-1, orf-2, and orf-3 for equol synthesis. This engineered bacterium can synthesize equol using daidzein as a substrate, but cannot synthesize equol using daidzein as a substrate. In addition, daidzein is expensive, and the synthesis of equol from daidzein does not have industrialization prospects in terms of economic effects. Daidzein can be directly extracted from the crop soybean, with a wide source and low price.

[0005] Therefore, there is an urgent need in the prior art to construct a yeast engineered bacterium that can use daidzein as a substrate and is suitable for industrial-scale production of high-yield S-equol. Summary of the Invention

[0006] In order to solve the above problems, the present invention aims to provide a genetically engineered bacterium for producing equol using daidzein as a substrate. The genetically engineered bacterium is:

[0007] A recombinant strain using yeast as a chassis microorganism and containing racemase and reductase of daidzein.

[0008] Preferably, the yeast is Saccharomyces cerevisiae.

[0009] In one embodiment, the racemase includes daidzein racemase;

[0010] And / or, the reductase includes daidzein reductase, daidzein reductase, and tetrahydrodaidzein reductase.

[0011] In one embodiment, the genetically engineered bacterium is obtained by using Saccharomyces cerevisiae as a starting strain and introducing gene sequences encoding daidzein racemase, daidzein reductase, daidzein reductase, and tetrahydrodaidzein reductase.

[0012] In one embodiment, the daidzein racemase is DDRC derived from Lactococcus garvieae, and contains the amino acid sequence shown in SEQ ID NO.1 or an amino acid sequence with 95% or more homology to SEQ ID NO.1;

[0013] and / or, the tetrahydrodaidzein reductase is THDR derived from Slackia isoflavoniconvertens, which comprises the amino acid sequence shown in SEQ ID NO.2 or an amino acid sequence with 95% or more homology to SEQ ID NO.2;

[0014] and / or, the daidzein reductase is DZNR derived from Asaccharobacter celatus, which comprises the amino acid sequence shown in SEQ ID NO.3 or an amino acid sequence with 95% or more homology to SEQ ID NO.3;

[0015] and / or, the dihydrodaidzein reductase is DHDR derived from Slackia isoflavoniconvertens, which comprises the amino acid sequence shown in SEQ ID NO.4 or an amino acid sequence with 95% or more homology to SEQ ID NO.4.

[0016] On the other hand, the present application provides a method for constructing the above-mentioned genetically engineered bacterium, including:

[0017] Using Saccharomyces cerevisiae as the starting strain, introducing the gene sequences encoding dihydrodaidzein racemase DDRC, tetrahydrodaidzein reductase THDR, daidzein reductase DZNR and dihydrodaidzein reductase DHDR to obtain a recombinant Saccharomyces cerevisiae engineering bacterium.

[0018] In one embodiment, the method of introduction includes the following steps:

[0019] A. Obtain a recombinant vector containing the nucleotide sequences encoding dihydrodaidzein racemase DDRC, tetrahydrodaidzein reductase THDR, daidzein reductase DZNR and dihydrodaidzein reductase DHDR;

[0020] B. Transform the recombinant vector into Saccharomyces cerevisiae.

[0021] Wherein, the recombinant vector can be any vector (such as a plasmid or a virus) that is convenient for recombinant DNA operation and expressing nucleic acid sequences.

[0022] Optionally, step A includes the step of introducing the coding gene into a blank vector.

[0023] Optionally, step A can be to obtain a recombinant vector containing four enzyme genes simultaneously, or to obtain four recombinant vectors each containing one enzyme gene.

[0024] In one embodiment, the nucleotide sequence encoding dihydrodaidzein racemase DDRC comprises the nucleotide sequence shown in SEQ ID NO.5, or is partially identical to the sequence shown in SEQ ID NO.5 and encodes a protein with the same function;

[0025] and / or, the nucleotide sequence encoding tetrahydrodaidzein reductase THDR comprises the nucleotide sequence shown in SEQ ID NO.6, or is partially identical to the sequence shown in SEQ ID NO.6 and encodes a protein with the same function;

[0026] and / or, the nucleotide sequence encoding daidzein reductase DZNR comprises the nucleotide sequence shown in SEQ ID NO.7, or is partially identical to the sequence shown in SEQ ID NO.7 and encodes a protein with the same function;

[0027] and / or, the nucleotide sequence encoding dihydrodaidzein reductase DHDR comprises the nucleotide sequence shown in SEQ ID NO.8, or is partially identical to the sequence shown in SEQ ID NO.8 and encodes a protein with the same function.

[0028] It can be understood that the partial identity described in this application means being completely identical to a partially continuous base sequence segment in the original sequence. For example, it can be 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 91%, 93%, 94%, 95%, 96%, 97%, 98%, 99% identical.

[0029] In one embodiment, the bidirectional promoter P GAL1,10 is used to express the gene sequence encoding dihydrodaidzein racemase DDRC and / or the gene sequence encoding tetrahydrodaidzein reductase THDR;

[0030] and / or, the promoter P GAL7 is used to express the gene sequence encoding daidzein reductase DZNR;

[0031] and / or, the promoter P TDH3 is used to express the gene sequence of dihydrodaidzein reductase DHDR.

[0032] Wherein, the promoter can be any promoter that is convenient for recombinant DNA operation and expressing nucleic acid sequences, and is not further limited herein.

[0033] In one embodiment, the nucleotide sequence of the bidirectional promoter P GAL1,10 is as shown in SEQ ID NO.9;

[0034] Among them, the promoter can be any promoter that facilitates recombinant DNA operations and expresses nucleic acid sequences, and no further limitation is made here.

[0035] In one embodiment, the promoter P GAL7 has the nucleotide sequence shown in SEQ ID NO. 10;

[0036] Among them, the promoter can be any promoter that facilitates recombinant DNA operations and expresses nucleic acid sequences, and no further limitation is made here.

[0037] In one embodiment, the promoter P TDH3 has the nucleotide sequence shown in SEQ ID NO. 11;

[0038] Among them, the promoter can be any promoter that facilitates recombinant DNA operations and expresses nucleic acid sequences, and no further limitation is made here.

[0039] On the other hand, the present application provides the use of the genetically engineered bacterium described above, or the genetically engineered bacterium obtained by the method described above, in the production of equol or products containing equol.

[0040] In one embodiment, the equol includes s-equol.

[0041] Optionally, the products include but are not limited to chemical reagents, medicines, health products, and cosmetics.

[0042] On the other hand, the present application provides a method for producing equol by microbial conversion of daidzein, comprising the following steps:

[0043] Using the genetically engineered bacterium described above, or the genetically engineered bacterium obtained by the method described above, to ferment a substrate containing daidzein to obtain a fermentation broth containing equol.

[0044] On the other hand, the present application provides the use of Saccharomyces cerevisiae in the conversion of daidzein to produce equol, wherein the genetically engineered bacterium is constructed using Saccharomyces cerevisiae as the chassis microorganism.

[0045] Among them, the Saccharomyces cerevisiae can be any engineered bacterium expressing equol constructed using Saccharomyces cerevisiae as the chassis microorganism, and no further limitation is made here.

[0046] Optionally, the Saccharomyces cerevisiae includes but is not limited to any one of haploid Saccharomyces cerevisiae strains such as Saccharomyces cerevisiae S288C, Saccharomyces cerevisiae W303-1A, Saccharomyces cerevisiae W303-1B, Saccharomyces cerevisiae YPH499, Saccharomyces cerevisiae YPH500, Saccharomyces cerevisiae CEN.PK2-1D, Saccharomyces cerevisiae BY4741, Saccharomyces cerevisiae BY4742, etc.

[0047] Compared with the prior art, the present invention has at least the following beneficial effects:

[0048] 1. In view of the limitations of the existing S-equol biosynthesis method, through metabolic engineering transformation, an engineered Saccharomyces cerevisiae strain capable of synthesizing S-equol using daidzein as a precursor was successfully constructed for the first time. This engineered strain can be fermented using the common culture medium for Saccharomyces cerevisiae, and can simply and stably ferment and produce equol, especially S-equol, without the need to add antibiotics. Moreover, the genetically engineered strain provided in the present application is also suitable for further metabolic engineering transformation to further improve the equol production efficiency and has a higher S-equol production potential.

[0049] 2. The genetically engineered strain provided in the present application uses Saccharomyces cerevisiae as the chassis microorganism, which can maintain its expression stability when subjected to uncertain interferences such as environmental changes, random events (or intracellular noise), and genetic variations, further improving the stability of producing equol by microbial fermentation process, and overcoming the problems when using Saccharomyces cerevisiae as the host cell.

[0050] 3. The genetically engineered strain provided in the present application can simultaneously express four enzymes required for the conversion of daidzein to equol, and all of these four enzymes can participate in the conversion process, broadening the source selection for obtaining equol, improving the yield and production efficiency of equol, especially S-equol, and being suitable for industrial promotion. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] The drawings here are incorporated into the description and form a part of this description, showing embodiments consistent with the present invention, and are used together with the description to explain the principles of the present invention.

[0052] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the description of the embodiments or the prior art. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings without creative efforts. In the drawings:

[0053] Figure 1 is the structural schematic diagram of the recombinant plasmid;

[0054] Figure 2 is the curve graph of the yield change of S-equol. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0055] To more clearly illustrate the overall concept of this application, the following will be described in detail by way of examples. In the following description, a large number of specific details are given to provide a more thorough understanding of this application. However, it is obvious to those skilled in the art that this application can be implemented without one or more of these details. In other examples, in order to avoid confusion with this application, some well-known technical features in the art are not described.

[0056] Unless otherwise specified, in the following embodiments, reagents or instruments without indicating the manufacturer can be obtained as conventional products through commercial purchase. For those not indicating specific conditions in the examples, they are carried out according to conventional conditions or conditions recommended by the manufacturer.

[0057] Plasmids, restriction enzymes, PCR enzymes, column DNA extraction kits, DNA gel recovery kits, etc. used in the following examples are commercial products, and the specific operations are carried out according to the kit instructions. Unless otherwise stated, the experimental methods, detection methods, and preparation methods disclosed in the present invention all adopt conventional techniques in the fields of molecular biology, biochemistry, chromatin structure and analysis, analytical chemistry, cell culture, recombinant DNA technology and related fields, and can be specifically carried out according to Molecular Cloning: A Laboratory Manual (Fourth Edition).

[0058] The composition of the culture media involved in the embodiments of this application is as follows:

[0059] LB medium: peptone 10 g / L, NaCl 10 g / L, yeast extract 5 g / L. 2% agar powder is added to the LB solid medium.

[0060] YPD liquid medium: peptone 20 g / L, yeast extract 10 g / L, glucose 20 g / L.

[0061] 10×YNB medium: yeast nitrogen source (without amino acids) 67.2 g / L, filter sterilized and stored at 4°C.

[0062] 10×glucose: 200 g / L (sterilized at 115°C for 15 min and reserved).

[0063] YNB liquid medium: 100 mL of 10×YNB medium, 100 mL of 10×glucose, made up to 1 L with water, filter sterilized, and if necessary, add 1% corresponding 10 g / L amino acid mother liquor; add 10 g / L calcium carbonate and 5% PVP-40K powder and sterilize together with the empty shaking flask.

[0064] YNB solid medium: 10% 10×YNB medium, 10% 10× glucose, 1% corresponding 10 g / L amino acid mother liquor, 2% agar powder.

[0065] In the examples of this application, the HPLC detection method for S-equol is as follows:

[0066] Use an Agilent 1260 Infinity II detection system. Dilute the fermentation broth by an appropriate multiple with methanol, shake for 2 min, centrifuge at 12,000 rpm for 5 min, filter through a 0.22 μm nylon filter membrane, and perform HPLC analysis. Use a C18 chromatographic column (4.6 mm × 250 mm, 5 μm) for chromatographic separation; the column temperature is 40 °C; the injection volume is 10 μL; the mobile phases are: phase A is ultrapure water (added with 0.1% formic acid), and phase B is methanol (added with 0.1% formic acid); the elution method is gradient elution, and the elution program is: 0 - 10 min, phase B: 10 - 60%; 10 - 20 min, phase B: 60 - 80%; 20 - 22 min, phase B: 80 - 10%; 22 - 25 min, phase B: 10%; detect at a wavelength of 280 nm.

[0067] Preparation method of Escherichia coli competent cells and chemical transformation:

[0068] Streak Escherichia coli JM109 on a solid LB plate and culture at 37 °C for 15 h. Pick a single colony and inoculate it into a liquid LB medium, grow at 37 °C and 220 rpm for 10 h, inoculate it into 20 mL of liquid LB medium at an inoculation amount of 1%, and culture at 37 °C until the OD 600 Grow to 0.3 - 0.5 to prepare competent cells. Use TaKaRa's Competent Cell Preparation Kit to prepare JM109 competent cells. The specific operation process is referred to the instruction manual. The prepared competent cells are stored at -80 °C for standby.

[0069] Take out the competent cells and melt them on ice. Add 10 ng of DNA sample, place it on ice for 30 min, immediately take it out after heat shock at 42 °C for 60 s and place it on ice for 2 min. Add 1000 μL of LB medium, shake and culture at 37 °C for 1 h, and then spread it on an LB solid plate for overnight culture.

[0070] In the examples of this application, the PCR amplification system uses a high-fidelity DNA polymerase (Novoprotein 2×Phanta Max Master Mix), and the system is as follows:

[0071] 2×Phanta Flash Master Mix 25 μL, upstream primer 2 μL, downstream primer 2 μL, template DNA 10 ng, make up to 50 μL with ultrapure sterile water.

[0072] In the embodiments of the present application, the plasmid seamless cloning and assembly method is as follows:

[0073] Use one-step cloning enzyme (Vazyme ClonExpress Ultra One Step Cloning Kit) for seamless cloning and assembly. The reaction system is as follows: 100 ng of linearized vector, 50 ng of each target gene fragment, 5 μL of one-step cloning enzyme, and the system is supplemented to 10 μL with ultrapure sterile water. React at 50 °C for 45 min; immediately place on ice after the reaction. Take 10 μL of the reaction system and transform it into Escherichia coli competent JM109.

[0074] In the following specific embodiments, the dihydrodaidzein racemase gene DDRC includes the nucleotide sequence shown in SEQ ID NO.5 and functionally equivalent nucleotide sequences obtained by substituting one or more nucleotides thereon. Those skilled in the art can obtain the DDRC gene of the present application based on the nucleotide sequence of DDRC disclosed in the present application, using cloning or synthesis methods or other suitable methods based on existing molecular biology techniques. In addition, DDRC genes from different strains, species, or other sources have similar functions. Therefore, the nucleotide sequences encoding the above DDRC genes are not limited to the nucleotide sequence shown in SEQ ID NO.5. If the encoded protein has no obvious functional difference from the protein described in SEQ ID NO.1, it is also included within the scope of the present invention.

[0075] The same applies to THDR, DZNR, and DHDR.

[0076] Example 1: Construction of recombinant vector

[0077] Use the bidirectional promoter P GAL1,10 (the nucleotide sequence is shown in SEQ ID NO.9) to express the dihydrodaidzein racemase gene DDRC (the nucleotide sequence is shown in SEQ ID NO.5) from Lactococcus garvieae and the tetrahydrodaidzein reductase gene THDR (the nucleotide sequence is shown in SEQ ID NO.6) from Slackia isoflavoniconvertens; use the promoter P GAL7 (the nucleotide sequence is shown in SEQ ID NO.10) to express the daidzein reductase gene DZNR (the nucleotide sequence is shown in SEQ ID NO.7) from Asaccharobacter celatus; use the promoter P TDH3(The nucleotide sequence is shown as SEQ ID NO.11) expresses the dihydrodaidzein reductase gene DHDR (the nucleotide sequence is shown as SEQ ID NO.8) from Slackia isoflavoniconvertens; the above four gene expression cassettes are inserted into the plasmid pY26 to obtain the recombinant plasmid pY26-EQLopt, which is transformed into Saccharomyces cerevisiae CEN.PK2-1D to obtain the S-equol-producing engineering strain S01. The nucleotide sequences of DDRC, THDR, DZNR, and DHDR are codon-optimized for Saccharomyces cerevisiae and synthesized by Sangon Biotech (Shanghai); the promoters P GAL1,10 , P GAL7 and P TDH3 are synthesized by Sangon Biotech (Shanghai).

[0078] The construction method of the recombinant plasmid pY26-EQLopt is as follows:

[0079] (1) Design primers pY26-EQLopt-F / R, use pY26 plasmid as a template, and perform inverse PCR amplification using high-fidelity DNA polymerase (Novoprotein 2×Phanta Max Master Mix). The amplification program is: pre-denaturation at 95°C for 15 s; denaturation at 95°C for 15 s; annealing at 55°C for 5 s; extension at 72°C for 3 min; a total of 27 cycles; final extension at 72°C for 5 min. After amplification, purify the PCR product to obtain linearized pY26.

[0080] (2) Codon-optimize the four genes DDRC, THDR, DZNR, and DHDR for Saccharomyces cerevisiae, and perform gene synthesis of the expression cassette by Sangon Biotech (Shanghai) to obtain the T-vector T-DDDT. Design primers DDDT-F / R, use T-DDDT as a template, and perform PCR amplification using high-fidelity DNA polymerase (Novoprotein 2×Phanta Max Master Mix). The amplification program is: pre-denaturation at 95°C for 15 s; denaturation at 95°C for 15 s; annealing at 55°C for 5 s; extension at 72°C for 8 min; a total of 27 cycles; final extension at 72°C for 5 min. After amplification, purify the PCR product to obtain the gene fragment DDDT.

[0081] (3) Use one-step cloning enzyme (Novoprotein ClonExpress Ultra One Step Cloning Kit) to perform seamless cloning and assembly of the gene fragment DDDT and linearized pY26. After the reaction, transform the product into Escherichia coli JM109, extract the plasmid, and send it to Genewiz (Suzhou) for sequencing to obtain the recombinant vector pY26-EQLopt with the correct sequence. Its structural schematic is as Figure 1 shown.

[0082] The primer sequences involved in the above steps are shown in Table 1.

[0083] Table 1

[0084] Primer Name 5’-3’ Sequence (the underlined part is the homologous arm region) pY26-EQLopt-F <![CDATA GGTGAAATTGCTTAA GATATCAAGCTTATCGATAC]]> pY26-EQLopt-R <![CDATA TGGGATGCTAAGTAA TGATCAGTTAACTCCGGACC]]> DDDT-F <![CDATA TTACTTAGCATCCCA ATCACAAACA]]> DDDT-R <![CDATA TTAAGCAATTTCACC TTGCATAGCA]]>

[0085] Example 2: Construction of engineered Saccharomyces cerevisiae strain S01

[0086] In this example, the recombinant plasmid pY26-EQLopt prepared in Example 1 was transformed into Saccharomyces cerevisiae CEN.PK2-1D to construct the engineered strain S01. The specific method includes the following steps:

[0087] (1) Saccharomyces cerevisiae CEN.PK2-1D was cultured overnight in YPD medium and then transferred to YPD medium with an initial OD 600nm = 0.3 and grown to OD 600nm = 1.2.

[0088] (2) The cells were collected and centrifuged at 3000 rpm for 5 min at 4°C using a low-temperature centrifuge. The cells were resuspended twice with 30 mL of sterile water, and then the cells were collected, 1 mL of 0.1 M LiAc was added, and the cells were resuspended. The suspension was transferred to a 1.5 mL EP tube and centrifuged at 8000 rpm / min at 4°C for 1 min. The supernatant was discarded, 500 μL of 0.1 M LiAc was added, and the cells were resuspended. The suspension was aliquoted into 1.5 mL EP tubes, 50 μL each.

[0089] (3) The 1.5 mL EP tube containing the competent cells was centrifuged at 8000 rpm for 1 min at 4°C using a low-temperature centrifuge. The supernatant was discarded, and the following were added in sequence: a. 240 μL of 50% PEG3350; b. 36 μL of 1 M LiAc; c. 25 μL of salmon sperm ssDNA (denatured by boiling water bath for 5 min before use and immediately placed on ice for use); d. 50 μL of the recombinant plasmid pY26-EQLopt with a concentration of 10 - 20 ng / μL.

[0090] (4) The mixture was shaken and mixed for 10 - 20 s, incubated at 30°C in an incubator for 30 min, incubated in a water bath at 42°C for 25 min, centrifuged at 8000 rpm for 1 min, the supernatant was discarded, and the cells were spread on a uracil-deficient YNB plate and cultured in an incubator at 30°C for 3 - 4 days.

[0091] Example 3: Shake flask fermentation verification

[0092] In this example, the recombinant Saccharomyces cerevisiae engineered strain S01 obtained in Example 2 was verified by fermentation. The specific steps are as follows:

[0093] (1) Seed culture: Streak from the preservation tube onto a uracil-deficient YNB solid plate and incubate in an incubator at 30 °C for 3 - 4 days. Pick a single colony and transfer it to 20 mL of YPD liquid medium (250 mL shake flask), and incubate overnight at 30 °C and 220 rpm / min.

[0094] (2) Fermentation culture: Inoculate with an inoculum size of 5% into a uracil-deficient YNB liquid medium (250 mL shake flask), incubate at 30 °C and 220 rpm for 24 h, add 200 mg / L of daidzein (daidzein stock solution: 25 g / L dissolved in DMSO), and continue the incubation. The content of S-equol is determined by HPLC at 24 h, 72 h, 120 h, and 168 h after adding daidzein, and the results are as Figure 2 shown.

[0095] From Figure 2 the results in, it can be seen that the recombinant Saccharomyces cerevisiae engineering bacteria provided in the embodiments of the present application can convert daidzein into S-equol, and when the fermentation reaches 120 h, the yield of S-equol reaches the highest, which is 25.42 mg / L.

[0096] The above are only the embodiments of the present application and are not used to limit the present application. For those skilled in the art, various changes and modifications can be made to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included within the scope of the claims of the present application.

Claims

1. Genetically engineered bacteria, characterized in that, A recombinant strain using yeast as the chassis microorganism and containing the racemase and reductase of daidzein. Preferably, the yeast is Saccharomyces cerevisiae.

2. The genetically engineered bacterium according to claim 1, wherein The racemase includes dihydrodaidzein racemase; And / or, the reductase includes daidzein reductase, dihydrodaidzein reductase and tetrahydrodaidzein reductase.

3. The genetically engineered bacterium according to claim 2, characterized in that, The dihydrodaidzein racemase is DDRC derived from Lactococcus garvieae and contains the amino acid sequence shown in SEQ ID NO.1; And / or, the tetrahydrodaidzein reductase is THDR derived from Slackia isoflavoniconvertens and contains the amino acid sequence shown in SEQ ID NO.2; And / or, the daidzein reductase is DZNR derived from Asaccharobacter celatus and contains the amino acid sequence shown in SEQ ID NO.3; And / or, the dihydrodaidzein reductase is DHDR derived from Slackia isoflavoniconvertens and contains the amino acid sequence shown in SEQ ID NO.

4.

4. The method for constructing the genetically engineered bacterium according to any one of claims 1-3, characterized in that, Including: Using Saccharomyces cerevisiae as the starting strain, introducing the gene sequences encoding dihydrodaidzein racemase DDRC, tetrahydrodaidzein reductase THDR, daidzein reductase DZNR and dihydrodaidzein reductase DHDR to obtain a recombinant Saccharomyces cerevisiae engineering strain.

5. The construction method according to claim 4, wherein The method of the introduction includes the following steps: A. Obtain a recombinant vector containing the nucleotide sequences encoding dihydrodaidzein racemase DDRC, tetrahydrodaidzein reductase THDR, daidzein reductase DZNR and dihydrodaidzein reductase DHDR; B. Transform the recombinant vector into Saccharomyces cerevisiae.

6. The construction method according to claim 5, characterized in that The nucleotide sequence encoding the dihydrodaidzein racemase DDRC contains the nucleotide sequence shown in SEQ ID NO.5, or is partially identical to the sequence shown in SEQ ID NO.5 and encodes a protein with the same function; And / or, the nucleotide sequence encoding the tetrahydrodaidzein reductase THDR contains the nucleotide sequence shown in SEQ ID NO.6, or is partially identical to the sequence shown in SEQ ID NO.6 and encodes a protein with the same function; And / or, the nucleotide sequence encoding the daidzein reductase DZNR contains the nucleotide sequence shown in SEQ ID NO.7, or is partially identical to the sequence shown in SEQ ID NO.7 and encodes a protein with the same function; And / or, the nucleotide sequence encoding the dihydrodaidzein reductase DHDR contains the nucleotide sequence shown in SEQ ID NO.8, or is partially identical to the sequence shown in SEQ ID NO.8 and encodes a protein with the same function.

7. The application of the genetically engineered bacterium according to any one of claims 1-3, or the genetically engineered bacterium constructed by the method according to any one of claims 4-6 in the production of equol or products containing equol.

8. The application according to claim 7, wherein The equol includes S-equol.

9. A method for producing equol by microbial transformation of daidzein, characterized in that, Including the following steps: Using the genetically engineered bacterium as described in any one of claims 1-3, or the genetically engineered bacterium constructed by the method as described in any one of claims 4-6, ferment a substrate containing daidzein to obtain a fermentation broth containing equol.

10. Application of Saccharomyces cerevisiae in the production of equol by converting daidzein, characterized in that, Using Saccharomyces cerevisiae as the starting strain, construct the genetically engineered bacterium as described in any one of claims 1-3.

Citation Information

Patent Citations

  • A kind of equol-producing Clostridium c1-6 derived from chicken intestine and its application

    CN104087532B

  • Fermentation Product Containing Equol-Producing Microorganism Having Maintained Equol-Producing Ability, And Method For Producing Same

    CN105707899A

  • Composition containing lactic acid bacterium producing equol

    CN1826059A

Cited By

  • Daidzein reductase mutant and application thereof in preparation of equol

    CN120966777A