A tyrosine sulfate-modified high-activity recombinant hirudin, Saccharomyces cerevisiae engineered bacteria and its application

Abstract

The present invention belongs to the field of genetic engineering and synthetic biology, and specifically relates to a tyrosine sulfated highly active recombinant hirudin, brewer's yeast engineered bacteria and applications. The present invention uses brewer's yeast as a chassis cell, and through genetic engineering modification, introduces tyrosine protein sulfonate transferase and related enzymes and transport systems to achieve efficient sulfate modification of the Tyr63 site of hirudin, significantly improving its anticoagulant activity. This method overcomes the limitations of the high cost of extracting natural hirudin and the lack of modification function of existing recombinant technologies. In addition, the tyrosine sulfated highly active recombinant hirudin provided by the present invention exhibits excellent antioxidant efficacy in the field of beauty and skin care, and experiments have shown that its antioxidant activity is equivalent to that of natural hirudin. The present invention provides an innovative solution for the low-cost, large-scale production of highly active hirudin, and has potential for application in both medicine and cosmetics.

Description

Technical Field

[0001] The present invention belongs to the fields of genetic engineering and synthetic biology, and specifically relates to a tyrosine sulfation-modified high-activity recombinant hirudin, a saccharomyces cerevisiae engineered bacterium and applications. Background Art

[0002] Hirudin is a natural active polypeptide isolated and purified from the salivary glands of leeches. It consists of 65-66 amino acid residues and has a non-glycosylated, acidic single-chain structure. It is the most effective natural thrombin inhibitor known and is widely used clinically in the treatment of cardiovascular diseases.

[0003] Tyrosine sulfation (Tyr63) of hirudin is a key modification in its structure and function. It is catalyzed by tyrosine protein sulfotransferase (TPST), which transfers a sulfate group from 3'-phosphoadenosine-5'-phosphosulfate (PAPS) to tyrosine residue 63. Sulfation at Tyr63 significantly enhances the specific binding of the C-terminal region of hirudin (including Tyr63) to the anion-binding exosite I of thrombin, increasing its ability to inhibit thrombin by 10-fold. However, the low yield and high extraction cost of natural hirudin severely limit its application.

[0004] Currently, Escherichia coli or engineered yeast expression systems are the primary expression systems for recombinant hirudin production. Among them, Saccharomyces cerevisiae offers multiple significant advantages as a host system for hirudin expression: ① Its clear genetic background and ease of manipulation make it suitable for efficient gene editing and hirudin expression; ② its natural secretion system enables efficient secretion of hirudin into the culture medium, simplifying downstream purification; and ③ its ability to form disulfide bonds ensures the correct folding of the hirudin N-terminal functional domain. Furthermore, Saccharomyces cerevisiae boasts rapid growth, low cultivation costs, and high safety (GRAS certification), making it suitable for high-density fermentation and large-scale production. It is an environmentally friendly and resource-efficient expression system. These advantages make it an ideal choice for the efficient production of high-quality, highly active hirudin, providing important technical support for the pharmaceutical and cosmetic industries. However, Escherichia coli or Saccharomyces cerevisiae, as expression hosts, lack the TPST-mediated post-translational modification function and are unable to complete Tyr63 sulfation modification, resulting in the recombinant hirudin expressed in them having only one-tenth the potency of natural hirudin. Therefore, the development of an efficient expression system capable of Tyr63 sulfation modification is of great significance for enhancing the activity of recombinant hirudin and promoting its widespread application in the medical field.

[0005] Furthermore, as a natural antithrombin active substance, hirudin has been extensively studied in the field of pharmacology, demonstrating remarkable efficacy in anticoagulation, antithrombosis, lowering blood pressure, and lowering blood lipids. However, its application in the field of beauty and skincare is relatively limited. Studies have shown that it has multiple benefits, including antioxidant, anti-aging, whitening, anti-inflammatory, repair, microcirculation improvement, oil control, and pore reduction, while being highly safe and non-irritating. These properties make it a highly promising functional skincare ingredient, and it is expected to be widely used in high-end skincare products with anti-aging, whitening, and repair properties in the future. With in-depth research and advancements in production technology, the application prospects of hirudin in the cosmetics field will be even broader. Summary of the Invention

[0006] In order to overcome the deficiencies and shortcomings of the prior art, the primary purpose of the present invention is to provide an engineered yeast strain of Saccharomyces cerevisiae that expresses a tyrosine sulfate-modified highly active recombinant hirudin.

[0007] Another object of the present invention is to provide a method for constructing the above-mentioned engineered yeast Saccharomyces cerevisiae.

[0008] Another object of the present invention is to provide a tyrosine sulfation-modified recombinant hirudin with high activity.

[0009] The fourth object of the present invention is to provide a method for preparing the above-mentioned tyrosine sulfation-modified highly active recombinant hirudin.

[0010] The fifth object of the present invention is to provide the application of the above-mentioned engineered yeast Saccharomyces cerevisiae or the tyrosine sulfation-modified highly active recombinant hirudin.

[0011] The purpose of the present invention is achieved through the following technical solutions:

[0012] An engineered yeast strain of Saccharomyces cerevisiae expressing a tyrosine-sulfated, highly active recombinant hirudin is obtained by the following method:

[0013] Using Saccharomyces cerevisiae as a starting strain, the MET3Δ gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element were integrated into the chromosome of Saccharomyces cerevisiae to obtain an engineered Saccharomyces cerevisiae strain that has been introduced with a tyrosine sulfation modification system. A recombinant plasmid containing a recombinant hirudin gene expression element was then transferred into the engineered Saccharomyces cerevisiae strain that has been introduced with the tyrosine sulfation modification system to obtain an engineered Saccharomyces cerevisiae strain that expresses a tyrosine-sulfated, highly active recombinant hirudin.

[0014] The Saccharomyces cerevisiae strain is preferably CEN.PK2-1D.

[0015] The recombinant hirudin gene expression element includes the rHirudin gene, the promoter TEF1p and the terminator ADH1t, wherein the rHirudin gene is composed of an AGA2 secretory peptide nucleic acid sequence, a His tag nucleic acid sequence, an enterokinase-cleaved nucleic acid sequence and a truncated Hirudin gene sequence connected in sequence, and the nucleotide sequence of the rHirudin gene is shown in SEQ ID No: 1.

[0016] The recombinant plasmid containing the recombinant hirudin gene expression element is obtained by inserting the recombinant hirudin gene expression element into the free plasmid pRS416.

[0017] The MET3Δ gene expression element includes the MET3 gene functional region coding sequence from Saccharomyces cerevisiae (amino acid sequence is 1-393 positions of MET3) and its promoter and terminator (MET3p and MET3t). The nucleotide sequence of the gene expression element is shown in SEQ ID No: 2.

[0018] The MET14 gene expression element includes the MET14 gene coding sequence and its promoter and terminator (MET14p and MET14t) derived from Saccharomyces cerevisiae. The nucleotide sequence of the gene expression element is shown in SEQ ID No: 3.

[0019] The SLL gene expression element includes the SLL gene coding sequence, the Saccharomyces cerevisiae promoter TDH3p and the terminator CYC1t. The nucleotide sequence of the SLL gene coding sequence is shown in SEQ ID No: 4.

[0020] The TPST1 gene expression element includes the coding sequence of the TPST1 gene and the saccharomyces cerevisiae promoter PGK1p and terminator PDC1t.

[0021] The TPST1 gene is hTPST1 (derived from humans), bTPST1 (derived from cattle) or eTPST1 (derived from nematodes). The coding sequences of the hTPST1 gene and the bTPST1 gene are shown in SEQ ID No: 5 or 6.

[0022] The eTPST1 gene is a wild-type eTPST1 gene or a mutant eTPST1 gene; the coding sequence of the wild-type eTPST1 gene is shown in SEQ ID No: 7; the mutant eTPST1 gene is eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H 、eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H ;eTPST1Q113R 、eTPST1 Q113K 、eTPST1 Q113H The corresponding mutation sites are 337-339bp, and the corresponding mutation nucleotide sequences are AGA, AAA, and CAT; eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H The corresponding mutation sites are 601-603bp, and the corresponding mutation nucleotide sequences are AGA, AAA, and CAT.

[0023] The nucleotide sequence of the promoter TDH3p is shown in NCBI database sequence accession number CP029160.1 from positions 9954286 to 9955085; the nucleotide sequence of the promoter PGK1p is shown in NCBI database sequence accession number CP135951.1 from positions 124102 to 124853; the nucleotide sequence of the promoter TEF1p is shown in NCBI database sequence accession number CP029160.1 from positions 707052 to 707481. The nucleotide sequence of the terminator CYC1t is shown in positions 1301 to 1607 of the NCBI database sequence accession number KC879308.1; the nucleotide sequence of the terminator PDC1t is shown in positions 3660519 to 3660915 of the NCBI database sequence accession number CP029160.1; and the nucleotide sequence of the terminator ADH1t is shown in positions 4671969 to 4672126 of the NCBI database sequence accession number CP029160.1.

[0024] The method for constructing an engineered yeast strain of Saccharomyces cerevisiae expressing tyrosine sulfate-modified highly active recombinant hirudin comprises the following steps:

[0025] Ⅰ. Using Saccharomyces cerevisiae CEN.PK2-1D as the starting strain, the MET3Δ gene expression element and the MET14 gene expression element were inserted into the yeast chromosome via homologous recombination to generate the engineered strain ZR-01.

[0026] II. Using the engineered strain ZR-01 obtained in step I as the target, the SLL gene expression element was inserted through gene editing to obtain the engineered strain ZR-02;

[0027] III. Using the engineered strain ZR-02 obtained in step II as the target, the TPST1 gene expression element was inserted through gene editing to obtain engineered strains (ZR-03, ZR-04, ZR-05, ZR-05 / 01 to ZR-05 / 06) containing the MET3Δ gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element. The hTPST1 gene expression element was inserted into the engineered strain ZR-03, the bTPST1 gene expression element was inserted into the engineered strain ZR-04, the wild-type eTPST1 gene expression element was inserted into the engineered strain ZR-05, and the mutant eTPST1 gene expression element was inserted into the engineered strains ZR-05 / 01 to ZR-05 / 06.

[0028] IV. Using the engineered strains obtained in step III as the target, recombinant plasmids containing the recombinant hirudin gene expression elements were transferred into the strains using the lithium acetate method to obtain strains ZR-07~09 and ZR-10~15, which are engineered Saccharomyces cerevisiae strains expressing tyrosine sulfated, highly active recombinant hirudin.

[0029] The engineered strain ZR-01 in step I is preferably prepared by the following method:

[0030] Design and synthesize a nucleic acid sequence, the nucleic acid sequence includes: GAL7 UP、 MET3Δ gene expression element (MET3p-MET3Δ-MET3t), MET14 gene expression element (MET14p-MET14-MET14t), LEU2p-LEU2 and GAL7 DOWN The fragments were transformed into Saccharomyces cerevisiae by the lithium acetate method, and positive clones were screened in LEU nutrient deficiency medium to obtain strain ZR-01.

[0031] GAL7 UP and GAL7 DOWN It is a fragment located at the Gal7 site of the Saccharomyces cerevisiae genome, and its nucleotide sequence is shown in SEQ ID No: 8-9.

[0032] The engineered strain ZR-02 in step II is preferably prepared by the following method:

[0033] (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence comprising: GAL1 UP , SLL gene expression elements and GAL1 DOWN , and set enzyme cutting sites upstream and downstream respectively;

[0034] (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-GAL1UP -TDH3p-SLL-CYC1t-GAL1 DOWN ;

[0035] (3) Amplification of recombinant plasmid pUC57-GAL1 in E. coli UP -TDH3p-SLL-CYC1t-GAL1 DOWN , double enzyme digestion to obtain GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment;

[0036] (4) Combine the gene editing plasmid with GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN The fragment was transformed into strain ZR-01 by the lithium acetate method, and positive transformants were screened to obtain engineered strain ZR-02.

[0037] GAL1 UP and GAL1 DOWN It is a fragment located at the Gal1 site of the Saccharomyces cerevisiae genome, and its nucleotide sequence is shown in SEQ ID No: 10-11.

[0038] The engineered strain containing the MET3Δ gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element in step III is preferably prepared by the following method:

[0039] (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence comprising: HO UP Sequences, TPST1 gene expression elements and HO DOWN Sequence, and set restriction sites upstream and downstream respectively;

[0040] (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN ;

[0041] (3) Amplification of recombinant plasmid pUC57-HO in E. coli UP -PGK1p-TPST1-PDC1t-HO DOWN , double enzyme digestion to obtain HO UP -PGK1p-TPST1-PDC1t-HO DOWN fragment;

[0042] (4) Combine the gene editing plasmid with HO UP -PGK1p-TPST1-PDC1t-HODOWN The fragment was transformed into strain ZR-02 by the lithium acetate method, and positive transformants were screened to obtain the target engineered strain.

[0043] The HO UP and HO DOWN It is a homology arm fragment mapped to the HO gene of Saccharomyces cerevisiae, and its nucleotide sequence is shown in SEQ ID No: 12-13.

[0044] The starting plasmid of the gene editing plasmid is pRS416; the gene editing plasmid is based on the plasmid pRS416, and the following components are inserted: Cas9 expression element and gRNA expression element, wherein the Cas9 expression element encodes Cas9 nuclease for targeted cutting of target DNA sequence as well as promoter and terminator; the gRNA expression element includes a guide RNA sequence targeting the target Saccharomyces cerevisiae genomic site, a gRNA scaffold sequence, a promoter and a terminator; the gRNA expression element is preferably GAL1 sgRNA expression element or HO sgRNA Expression elements.

[0045] The recombinant plasmid containing the recombinant hirudin gene expression element in step IV is preferably prepared by the following method:

[0046] (1) Artificially synthesize the recombinant hirudin gene expression element (TEF1p-rHirudin-ADH1t) and set restriction sites upstream and downstream;

[0047] (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t;

[0048] (3) The recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t was amplified in E. coli and the TEF1p-rHirudin-ADH1t fragment was obtained by double enzyme digestion;

[0049] (4) The TEF1p-rHirudin-ADH1t fragment was connected to the pRS416 vector through the restriction enzyme cutting site to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t.

[0050] The method for constructing an engineered yeast strain of Saccharomyces cerevisiae expressing tyrosine sulfate-modified recombinant hirudin preferably further comprises the following steps:

[0051] Design and synthesize fusion gene expression elements including rDNA homology arm fragments (rDNA UP -PGK1p-KanMX4-P2A-eTPST1 T201K-PDC1t-rDNA DOWN ), the expression element nucleic acid sequence includes: rDNA UP、 PGK1p, KanMX4, P2A, TPST1, PDC1t, rDNA DOWN ; The element was transformed into the engineered strain ZR-02 by the lithium acetate method, and strains containing high-copy TPST1 genes were screened by G418; a recombinant plasmid containing the recombinant hirudin gene expression element (pRS416-TEF1p-rHirudin-ADH1t) was transferred into the strain containing the high-copy TPST1 gene to obtain a cerevisiae engineered strain expressing tyrosine sulfate-modified recombinant hirudin.

[0052] The TPST1 gene is preferably eTPST1 T201R .

[0053] The rDNA UP and rDNA DOWN is a fragment located in the rDNA of Saccharomyces cerevisiae, where rDNA UP and rDNA DOWN The nucleotide sequence of the KanMX4 resistance gene is shown in SEQ ID No: 14-15. The nucleotide sequence of the KanMX4 resistance gene is shown in SEQ ID No: 16, and the nucleotide sequence of the P2A self-cleavage peptide is shown in SEQ ID No: 17.

[0054] A tyrosine sulfate-modified high-activity recombinant hirudin is expressed by the above-mentioned tyrosine sulfate-modified high-activity recombinant hirudin engineering bacteria.

[0055] The method for preparing the tyrosine sulfation-modified high-activity recombinant hirudin comprises the following steps:

[0056] The saccharomyces cerevisiae engineered bacteria expressing tyrosine sulfated highly active recombinant hirudin are fermented, and the fermentation supernatant is collected and purified to obtain the tyrosine sulfated highly active recombinant hirudin.

[0057] The invention relates to the use of the tyrosine sulfation-modified high-activity recombinant hirudin or the engineered yeast Saccharomyces cerevisiae in the preparation of antithrombin products.

[0058] The invention relates to the use of the tyrosine sulfation-modified high-activity recombinant hirudin or the engineered yeast Saccharomyces cerevisiae in the preparation of anticoagulant, antithrombotic, blood pressure-lowering or blood lipid-lowering drugs.

[0059] The application of the tyrosine sulfation-modified highly active recombinant hirudin or the engineered yeast Saccharomyces cerevisiae in the field of beauty and skin care includes but is not limited to anti-oxidation.

[0060] Technical principle of the present invention:

[0061] Sulfate adenylyltransferase (MET3) and adenosine-5'-phosphosulfate kinase (MET14) are enzymes involved in the synthesis of the tyrosine sulfation donor 3'-phosphoadenosine-5'-phosphosulfate (PAPS). PAPS is transported to the Golgi apparatus by the 3'-phosphoadenosine 5'-phosphosulfate transporter (SLL). Under the catalysis of tyrosyl-protein sulfotransferase (TPST1), the sulfate group of PAPS is transferred to the tyrosine residue at position 63 of hirudin, completing tyrosine sulfation. Based on this mechanism, to introduce a protein tyrosine sulfation modification system into the Saccharomyces cerevisiae expression system, the present invention uses Saccharomyces cerevisiae as a starting strain and integrates the MET3Δ (MET3 functional region) gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element into the yeast chromosome to produce an engineered strain with the tyrosine sulfation modification system. The following are the key points:

[0062] The proteins expressed by the MET3Δ and MET14 gene expression elements, respectively, are sulfate adenyltransferase and adenosine 5'-phosphosulfate anhydride kinase, both derived from Saccharomyces cerevisiae. Their introduction can increase the level of the sulfation modification donor 3'-phosphoadenosine-5'-phosphosulfate (PAPS) in the expression strain. The SLL gene expression element expresses the 3'-phosphoadenosine 5'-phosphosulfate transporter, derived from Drosophila melanogaster. Its introduction has been reported to increase PAPS levels in the Golgi apparatus of Saccharomyces cerevisiae by 5.6-fold (Shin Kamiyama et al., J Biol Chem, 2003 July 11). The protein expressed by the TPST1 gene expression element is tyrosyl protein sulfotransferase 1. Its introduction can directly catalyze the sulfation of recombinant hirudin at the Tyr63 position. In summary, the present invention achieves Tyr63 sulfation modification of hirudin by increasing the levels of PAPS-related synthases MET3 and MET14 and introducing SLL and TPST1, thereby significantly enhancing the anticoagulant activity of hirudin.

[0063] In the process of constructing an engineered yeast strain expressing tyrosine sulfated recombinant hirudin, the present invention first studied the effects of TPST1 genes from different sources on the expression level of recombinant hirudin and the level of Tyr63 sulfate modification of recombinant hirudin. After fermentation screening and comparison of engineered strains ZR-06~09, the expression levels of recombinant hirudin in strains ZR-06~09 were similar ( Figure 1 ), the recombinant hirudin expressed by ZR-09 has a higher level of sulfation modification at Tyr63 ( Figure 1 ), and the activity of the recombinant hirudin expressed by strain ZR-09 was also higher as measured by thrombin titration ( Figure 2On this basis, the present invention further mutated eTPST1 to optimize its activity. After αfold3 simulation docking, the Q113 and T201 of eTPST1 and the hirudin binding region are less than 3.5Å ( Figure 3 ), the hirudin binding region is rich in negatively charged E, so two amino acids were mutated to positive charges. eTPST1 mutants include eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H 、eTPST1 T201R 、eTPST1 T201K and eTPST1 T201H The corresponding engineered strains were numbered ZR-10-15. Strains ZR-10-15 were constructed in the same manner as ZR-09, with the mutant recombinant plasmid (obtained by site-directed mutagenesis PCR) carrying a homology arm mutant TPST1 gene expression element fragment and a recombinant hirudin expression plasmid gene editing into strain ZR-02. Strains ZR-10-15 were screened and compared for fermentation, with consistent expression levels ( Figure 3 ), the recombinant hirudin expressed by ZR-13 strain is more active ( Figure 4 ). The present invention further optimizes eTPST1 T201R The copy number of the strain ZR-16 was further constructed.

[0064] The present invention has the following advantages and effects compared to the prior art:

[0065] (1) The present invention uses Saccharomyces cerevisiae as the base cell and introduces tyrosine protein sulfotransferase (TPST1) and related enzymes and transport systems (MET3, MET14, SLL) through genetic engineering to achieve efficient sulfation modification of the Tyr63 site of hirudin, significantly improving its anticoagulant activity.

[0066] (2) The present invention selects TPST1 genes from different sources, directs mutation of eTPST1 genes, and realizes eTPST1 through rDNA. T201R High copy integration significantly improves the activity of recombinant hirudin.

[0067] (3) The present invention overcomes the limitations of high extraction costs of natural hirudin and the lack of modification functions of existing recombinant technologies. In addition, sulfated hirudin exhibits excellent antioxidant effects in the field of beauty and skin care. Experiments have shown that its antioxidant activity is comparable to that of natural hirudin, and it has potential for both medical and cosmetic applications.

[0068] (4) The recombinant hirudin expression system provided by the present invention exhibits significant advantages in terms of production cost, biosafety, production efficiency, ease of genetic manipulation, and product activity. It provides an innovative solution for the low-cost, large-scale production of highly active hirudin and opens up a new path for the research, development, and production of recombinantly modified highly active polypeptides. BRIEF DESCRIPTION OF THE DRAWINGS

[0069] Figure 1 This is the Western blot result of recombinant hirudin expression and Tyr63 sulfation modification in strain ZR-06~09.

[0070] Figure 2 This is a comparative analysis of the activity of recombinant hirudin expressed by strains ZR-06~09.

[0071] Figure 3 This is a diagram showing the simulation of αfold3 docking of eTPST1 and hirudin binding.

[0072] Figure 4 This is a Western blot analysis of the recombinant hirudin expressed by strain ZR-10~15.

[0073] Figure 5 This is a comparative analysis chart of the activity of recombinant hirudin expressed by strains ZR-10~15.

[0074] Figure 6 The results of the analysis of the expression (A) and activity comparison (B) of recombinant hirudin of strains ZR-13 and ZR-16 are shown.

[0075] Figure 7 This is an analysis chart of the antioxidant efficacy evaluation of recombinant hirudin expressed by strain ZR-16. DETAILED DESCRIPTION

[0076] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0077] Unless otherwise specified, the terms used in the present invention generally have the meanings commonly understood by those of ordinary skill in the art. In the examples, the processes and methods not described in detail are conventional methods well known in the art. The reagents used in the examples were purchased from common commercial sources, and the experimental operations and experimental conditions not specified are referenced to conventional operations and conventional conditions in the art.

[0078] YPD medium was prepared as follows: 10 g yeast extract, 20 g peptone, 20 g glucose, 20 g agar (added when using solid culture medium), and ddH2O to make up to 1 L. SC-Ura medium was prepared as follows: 6.7 g yeast nitrogen base (YNB), 0.77 g amino acid mixture (without uracil), 20 g glucose, 20 g agar (added when using solid culture medium), and ddH2O to make up to 1 L. SC-Leu medium was prepared as follows: 6.7 g yeast nitrogen base (YNB), 0.77 g amino acid mixture (without leucine), 20 g glucose, 20 g agar (added when using solid culture medium), and ddH2O to make up to 1 L. Tris-HCl buffer was prepared in the following order: 121.14 g Tris, made up to 1 L with ddH2O, and adjusted to pH 7.4 with HCl. 500 mM imidazole eluent was prepared in the following order: 68.08 g imidazole, 2.42 g Tris, 29.22 g NaCl, made up to 1 L with ddH2O, and adjusted to pH 8.0 with HCl.

[0079] The yeast genomic DNA extraction kit (Cat. No. DP307) and plasmid miniprep kit (Cat. No. DP105) in the examples were purchased from Tiangen Biochemical Technology Co., Ltd.; restriction enzymes such as Kpn I (Cat. No. R3142V), Hind III (Cat. No. R0104V), EcoRI (Cat. No. R0101S), and BamHI (Cat. No. R3136S), and T4 ligase (Cat. No. M0202) were purchased from New England Biolabs; and the gel recovery kit (Cat. No. B518131-0100) was purchased from Sangon Biotech (Shanghai) Co., Ltd. The pRS416 episomal plasmid in the examples was purchased from Biowind.

[0080] Example 1 Construction of engineered strains ZR-01-02

[0081] 1. Construction of engineered strain ZR-01

[0082] 1. Artificially synthesize the sequence of MET3Δ gene expression element + MET14 gene expression element + LEU2p-LEU2 element with homology arms (GAL7 UP -MET3p-MET3Δ-MET3t-MET14p-MET14-MET14t-LEU2p-LEU2-GAL7 DOWNThe synthesized fragment was transformed into the strain CEN.PK2-1D using the lithium acetate method. The addition order and volume of the system were as follows: 240μL of 50% PEG 3350, 36μL of 1M LiAc, 10μL of ssDNA, 1μg of DNA fragment, and 50μL of CEN.PK2-1D competent medium. The cells were cultured in SC-Leu medium for 2-3 days, and positive clones were screened. PCR was used to verify the insertion of the expression elements, resulting in the engineered strain ZR-01 containing the MET3Δ gene expression element and the MET14 gene expression element. Among them, LEU2p-LEU2 (SEQ ID No: 18) is " Addgene: pESC-LEU (V5 and HA) Sequences "LEU2" in ", totaling 1095bp, https: / / www.addgene.org / 222486 / sequences / .

[0083] MET3p-MET3Δ-MET3t sequence (the character frame parts are the promoter and terminator):

[0084]

[0085] MET14p-MET14-MET14t sequence (the character border parts are the promoter and terminator):

[0086]

[0087] GAL7 UP The nucleotide sequence is as follows:

[0088] TTGACGCTTATTGTCAAGGCTTTCATCCCGATTCCAATATTACATTAGAAGTTTTAAGTACAGAGCCAACTTATCAATTTTATACCGGTGATTTCTTGTCTGCTGGTTACGAAGCAAGACAAGGTTTTGCAATTGAGCCTGGTAGATACATTGATGCTATCAATCAAGAGAACTGGAAAGATTGTGTAACCT

[0089] GAL7 DOWN The nucleotide sequence is as follows:

[0090] GGGTCCAAGATTGTCTACAGATTTTCCTGATTTGCCAGCTTACTATCCTTCTTGAAAATATGCACTCTATATCTTTTAGTTCTTAATTGCAACACATAGATTTGCTGTATAACGAATTTTATGCTATTTTTTAAATTTGGAGTTCAGTGATAAAAGTGTCACAGCGAATTTCCTCACATGTAGGGACCGAATTG

[0091] 2. Construction of engineered strain ZR-02

[0092] 1. Construction of the GAL1 gene editing vector. The steps are as follows:

[0093] (1) Artificial synthesis of Cas9 expression elements and GAL1 sgRNA The expression element sequence was inserted into the pUC57 plasmid, the recombinant plasmid was transformed into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid extraction kit; then double enzyme digestion was performed with Kpn I and Hind III. The order and volume of enzyme digestion system addition were as follows: Kpn I 1.5 μL, Hind III 1.5 μL, 10× cutsmart buffer 5 μL, pUC57-TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -32 μL of SUP4t plasmid. Among them, Cas9 expression element and GAL1 sgRNA The sequence of the expression element is Addgene: pYZ463 Sequences ( ) 3617-8836 bp, and inserted the targeting sequence TGAGTTCAATTCTAGCGCAA after 8737 bp.

[0094] (2) After the enzyme-digested system was subjected to 2% agarose gel electrophoresis, the gel block of the target size of about 5200 bp was cut out and recovered using a gel recovery kit to obtain TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -SUP4t fragment (SEQ ID No: 19).

[0095] (3) The pRS416 free plasmid was transformed into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid extraction kit; then double enzyme digestion was performed with Kpn I and Hind III. The order and volume of enzyme digestion system addition were as follows: Kpn I 1.5 μL, Hind III 1.5 μL, 10× cutsmart buffer 5 μL, pRS416 free plasmid 32 μL.

[0096] (4) After enzyme digestion, the system was subjected to 2% agarose gel electrophoresis, and the gel block of the target size of about 4800 bp was cut out and recovered using a gel recovery kit to obtain the pRS416 enzyme digestion fragment.

[0097] (5)TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -SUP4t fragment and pRS416 digested fragment were ligated with T4 ligase to obtain recombinant plasmid pRS416-TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -SUP4t, which is the GAL1 gene editing plasmid. The order and volume of the ligation system are as follows: T4 DNA Ligase Buffer (10×) 2μL, TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -SUP4t fragment 2 μL, pRS416 digested fragment 2 μL, T4 DNA Ligase 1 μL, ddH2O 13 μL.

[0098] (6) The GAL1 gene editing plasmid was transferred into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid extraction kit for later use.

[0099] 2. Obtain the SLL gene expression element fragment with homology arms. The steps are as follows:

[0100] (1) Entrust Suzhou Hongxun Biotechnology Co., Ltd. to artificially synthesize the SLL gene expression element with homology arms (GAL1 UP -TDH3p-SLL-CYC1t-GAL1DOWN The fragment was double-digested with EcoRI and BamHI and then inserted into the pUC57 plasmid. The recombinant plasmid was transformed into Escherichia coli DH5α for amplification and extracted with a plasmid extraction kit. The double-digestion was then performed with EcoRI and BamHI. The order and volume of the enzyme digestion system were as follows: EcoRI 1.5μL, BamHI 1.5μL, 10× cutsmart buffer 5μL, pUC57-GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN 32 μL of plasmid.

[0101] (2) After enzyme digestion, the system was subjected to 2% agarose gel electrophoresis, and the target size of about 2900 bp was cut out and recovered using a gel recovery kit to obtain GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN DNA fragments.

[0102] 3. Construction of engineered strain ZR-02, steps are as follows:

[0103] (1) The GAL1 gene editing plasmid and GAL1 were separated by lithium acetate method. UP -TDH3p-SLL-CYC1t-GAL1 DOWN The DNA fragment was introduced into strain ZR-01. The addition order and volume of the required additive system were as follows: 50% PEG 3350 240μL, 1M LiAc 36μL; ssDNA 10μL, GAL1 gene editing plasmid 500ng, GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN 1 μg of fragment, 50 μL of competent cells.

[0104] (2) After the system is mixed, it is incubated at 30°C for 30 min, incubated at 42°C for 20 min, treated with 5 mM CaCl2 for 8 min, and spread on SC-Ura plates to culture at 30°C to screen positive colonies. After the positive colonies are cultured for 2-3 generations, the SC-Ura plates and YPD plates are dot-to-dot lined to screen out the positive colonies that have lost the gene editing plasmid. Then, PCR is performed to verify the insertion of the SLL gene element, thus obtaining the engineered strain ZR-02 containing the MET3Δ gene expression element, the MET14 gene expression element, and the SLL gene expression element.

[0105] The nucleotide sequence of TDH3p-SLL-CYC1t is shown below:

[0106]

[0107] GAL1 UP The nucleotide sequence is as follows:

[0108] TATTAACAGATATATAAATGGAAAAGCTGCATAACCACTTTAACTAATACTTTCAACATTTTCAGTTTGTATTACTTCTTATTCAAATGTCATAAAAGTATCAACAAAAAATTGTTAATATACCTCTATACTTTAACGTCAAGGAGAAAAAAACTATAATGACTAAATCTCATTCAGAAGAAGTGATTGTACC

[0109] GAL1 DOWN The nucleotide sequence is as follows:

[0110] AGGAATTACCAAGACCATTGGCCGAAAAGTGCCCGAGCATAATTAAGAAATTTATAAGCGCTTATGATGCTAAACCGGATTTTGTTGCTAGATCGCCTGGTAGAGTCAATCTAATTGGTGAACATATTGATTATTGTGACTTCTCGGTTTTACCTTTAGCTATTGATTTTGATATGCTTTGCGCCGTCAAAG

[0111] Example 2 Construction of engineered bacteria ZR-03~05

[0112] 1. Construction of HO gene editing vector, steps are as follows:

[0113] (1) Artificial synthesis of Cas9 expression elements and HO sgRNA The expression element sequence was inserted into the pUC57 plasmid, the recombinant plasmid was transformed into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid extraction kit; then double enzyme digestion was performed with Kpn I and Hind III. The order and volume of enzyme digestion system addition were as follows: Kpn I 1.5 μL, Hind III 1.5 μL, 10× cutsmart buffer 5 μL, pUC57-TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t plasmid 32 μL. Among them, Cas9 expression element and HO sgRNA The sequence of the expression element is 3617-8836bp in Addgene: pYZ463 Sequences, and the targeting sequence TCACCCACTAGTACTACCAT is inserted after 8737bp.

[0114] (2) After the enzyme digestion system was subjected to 2% agarose gel electrophoresis, the gel block of the target size of about 5200 bp was cut out and recovered using a gel recovery kit to obtain TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t fragment (SEQ ID No: 20).

[0115] (3) The pRS416 free plasmid was transformed into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid extraction kit; then double enzyme digestion was performed with Kpn I and Hind III. The addition order and volume of the system were as follows: Kpn I 1.5 μL, Hind III 1.5 μL, 10× cutsmart buffer 5 μL, pRS416 free plasmid 32 μL.

[0116] (4) After enzyme digestion, the system was subjected to 2% agarose gel electrophoresis, and the gel blocks of target size of about 4800 bp were cut out and recovered using a gel recovery kit to obtain the enzyme digestion fragments of pRS416.

[0117] (5)TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t fragment and pRS416 digested fragment were ligated with T4 ligase to obtain the recombinant plasmid pRS416-TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t, which is the HO gene editing plasmid. The required ligation system addition order and volume are as follows: T4 DNA Ligase Buffer (10×) 2 μL, TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t fragment 2 μL, pRS416 digested fragment 2 μL, T4 DNA Ligase 1 μL, ddH2O 13 μL.

[0118] (6) The HO gene editing plasmid was transferred into Escherichia coli DH5α for amplification, and the plasmid was extracted using a plasmid extraction kit for later use.

[0119] 2. Obtain the TPST1 gene expression element fragment with homology arms as follows:

[0120] (1) Artificially synthesize a TPST1 gene element (hTPST1, bTPST1 or eTPST1) fragment with homology arms and set restriction sites (EcoRI and BamHI) upstream and downstream respectively. After double digestion with EcoRI and BamHI, ligate and insert into pUC57 plasmid. Transform the recombinant plasmid into Escherichia coli DH5α for amplification and extract the plasmid using a plasmid extraction kit. Then, double digestion with EcoRI and BamHI was performed. The order and volume of enzyme digestion system addition were as follows: EcoRI 1.5μL, BamHI 1.5μL, 10×cutsmart buffer 5μL, pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN 32 μL of plasmid.

[0121] (2) After enzyme digestion, the system was subjected to 2% agarose gel electrophoresis, and the target size of about 2600 bp (hTPST1), 2600 bp (bTPST1), and 2700 bp (eTPST1) was cut out and recovered using a gel recovery kit to obtain HO UP -PGK1p-TPST1-PDC1t-HO DOWN DNA fragments.

[0122] 3. Construction of engineered strains ZR-03~05:

[0123] (1) The HO gene editing plasmid and HO were separated by lithium acetate method. UP -PGK1p-TPST1-PDC1t-HO DOWN The DNA fragments were introduced into strain ZR-02. The addition order and volume of the required additive system were as follows: 50% PEG 3350 240 μL, 1M LiAc 36 μL; ssDNA 10 μL, HO gene editing plasmid 500 ng, HO UP -PGK1p-TPST1-PDC1t-HO DOWN 1 μg of fragment, 50 μL of competent cells.

[0124] (2) After the system is mixed, it is incubated at 30°C for 30 min, incubated at 42°C for 20 min, treated with 5 mM CaCl2 for 8 min, and spread on SC-Ura plates for incubation at 30°C to screen positive colonies. After the positive colonies are cultured for 2-3 generations, the SC-Ura plates and YPD plates are dot-to-dot streaking to screen out the positive colonies that have lost the gene editing plasmid. Then, PCR is performed to verify the insertion of the TPST1 gene expression element, and the engineered strains ZR-03 (hTPST1), ZR-04 (bTPST1), and ZR-05 (eTPST1) are obtained.

[0125] Taking the hTPST1 gene element as an example, its nucleotide sequence is shown below (the horizontal line part is HO UP and HO DOWN ):

[0126] TTACAGAAAGGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACGAAATAAACCTATGG TTTACGAAATGATCCACGAAAATCATGTTATTATTTACATCAACATATCGCGAAAATTCATGTCATGTCCACATTA ACATCATTGCAGAGCAACAATTCATTTTCATAGAGAAATTTGCTACTATGGTACCTACTACTTTGAATTGTACTACCGCTGGGCGTTAT TAGGTGTGAAACCACGAAAAGTTCACCATAACTTCGAATAAAGTCGCGGAAAAAAGTAAACAGCTATTGCTACTCAA ATGAGGTTTGCAGAAGCTTGTTGAAGCATGATGAAGCGTTCTAAACGCACTATTCATCATTAAATATTTAAAGCTCA TAA

[0127] The coding sequence of the bTPST1 gene is shown below:

[0128]

[0129] The coding sequence of the eTPST1 gene is shown below:

[0130]

[0131] Example 3 Construction of recombinant hirudin-expressing engineered bacteria ZR-06-09

[0132] 1. Construction of the recombinant hirudin expression vector pRS416-TEF1p-rHirudin-ADH1t. The steps required are as follows:

[0133] (1) Obtaining TEF1p-rHirudin-ADH1t gene expression elements: Artificially synthesize TEF1p-rHirudin-ADH1t DNA fragments and set restriction sites (EcoRI and BamHI) upstream and downstream respectively. After double digestion with EcoRI and BamHI, the fragments were connected and inserted into the pUC57 plasmid. The recombinant plasmid was transformed into Escherichia coli DH5α for amplification and extracted with a plasmid mini kit. Then, double digestion was performed with EcoRI and BamHI. The order and volume of enzyme digestion system addition were as follows: EcoRI 1.5μL, BamHI 1.5μL, 10×cutsmart buffer 5μL, pUC57-TEF1p-rHirudin-ADH1t plasmid 32μL.

[0134] TEF1p-rHirudin-ADH1t DNA fragment:

[0135] TEF1p- ATGCAGTTACTTCGCTGTTTTTCAATATTTTCTGTTATTGCTTCAGTTTTAGCA CATCACCAT GACGACGACGACAAGGTTGTTTACACTGATTGTACCGAAAGTGGCCAAAATTTATGCTTATGCGAAGGTAGCAAC GTCTGTGGTCAAGGAAACAAATGCATATTAGGTAGCGACGGTGAGAAAAATCAGTGCGTTACTGGAGAAGGAACAC CAAAACCTCAATCACATAACGATGGTGACTTTGAAGAGATCCCAGAAGAATATCTGCAATAA ADH1t

[0136] Note: The underlined part is the AGA2 secretory peptide nucleic acid sequence, the ununderlined part is the His tag nucleic acid sequence, the dotted underlined part is the enterokinase-cleaved nucleic acid sequence, and the bold line part is the Hirudin gene sequence.

[0137] (2) After 1% agarose gel electrophoresis, cut out the target gel block of about 900 bp and recover it using a gel recovery kit to obtain the TEF1p-rHirudin-ADH1t DNA fragment.

[0138] 2. Obtain the pRS416 vector enzyme digestion fragment as follows:

[0139] (1) The pRS416 free plasmid was transferred into Escherichia coli DH5α for amplification. The plasmid was extracted using a plasmid extraction kit and double-digested with EcoRI and BamHI. The order and volume of addition were as follows: EcoRI endonuclease 1.5μL, BamHI endonuclease 1.5μL, 10× cutsmart buffer 5μL, and pRS416 plasmid 32μL.

[0140] (2) After enzyme digestion, the system was subjected to 2% agarose gel electrophoresis, and the gel block of the target size of about 4800 bp was cut out and recovered using a gel recovery kit to obtain the enzyme digestion fragment of the pRS416 vector.

[0141] (3) The TEF1p-rHirudin-ADH1t DNA fragment and the pRS416 vector digested fragment were ligated via T4 to obtain a ligation mixture. The order and volume of addition of the required ligation system were as follows: T4 DNA Ligase Buffer (10×) 2 μL, TEF1p-rHirudin-ADH1t DNA fragment 2 μL, pRS416 digested fragment 2 μL, T4 DNA Ligase 1 μL, ddH2O 13 μL.

[0142] 3. Screening for positive strains expressing the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t:

[0143] The ligation mixture was transformed into DH5α, spread on an ampicillin-resistant LB plate, and cultured overnight at 37°C. The strain was selected for expansion culture, and the plasmid was extracted using a plasmid extraction kit and verified by PCR and sequencing to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t.

[0144] 4. Construction of engineered strains ZR-06~09:

[0145] (1) The recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transformed into the strain CEN.PK2-1D (as a control) and the engineered strains ZR-03~05 constructed in Example 2 by the lithium acetate method. The addition order and volume of the required additive system were as follows: 50% PEG 3350 240 μL, 1 M LiAc 36 μL; ssDNA 10 μL, pRS416-TEF1p-rHirudin-ADH1t plasmid 1 μg, competent cells 50 μL.

[0146] (2) After the system was mixed, it was incubated at 30°C for 30 min, incubated at 42°C for 20 min, treated with 5 mM CaCl2 for 8 min, and spread on SC-Ura plates for incubation at 30°C to screen positive colonies. The engineered bacteria ZR-06 (control, expressing only rHirudin), ZR-07 (MET3Δ+MET14+SLL+hTPST1+rHirudin), ZR-08 (MET3Δ+MET14+SLL+bTPST1+rHirudin), and ZR-09 (MET3Δ+MET14+SLL+eTPST1+rHirudin) were obtained.

[0147] Example 4 Screening of engineered strains expressing higher recombinant hirudin activity among ZR-07-09

[0148] 1. Strain fermentation: Single colonies of engineered strains ZR-06-09 were selected and inoculated into YPD liquid medium. Cultured overnight at 30°C and 200 rpm. Transferred the overnight culture into fresh YPD liquid medium at a ratio of 1:50 (V:V) and cultured for 48 hours to ensure adequate protein expression and sulfation modification.

[0149] 2. Centrifugation: Centrifuge at 5000 rpm at 4°C for 10 min. Collect the culture supernatant and boil a portion of the supernatant for Western blot analysis to detect recombinant hirudin protein expression and Tyr63 sulfation modification (the primary antibody for protein expression is anti-his, Catalog No. DTH01; the primary antibody for Tyr63 sulfate modification is Sulfo-1C-A2, Catalog No. ab136481; the secondary antibody is goat anti-mouse IgG, Catalog No. ab205719; all antibodies were purchased from Abcam, UK). The remaining fermentation supernatant was lyophilized for later use.

[0150] 3. Activity Assay: The activity of the relevant recombinant hirudin was determined according to the thrombin titration method in the Pharmacopoeia of the People's Republic of China (2020 edition). The specific method is as follows: 1 g of the lyophilized powder to be tested (prepared in step 2) was accurately weighed, and 5 mL of a 0.9% by mass sodium chloride solution was accurately added. The mixture was thoroughly stirred and extracted for 30 min with occasional shaking. Centrifugation was performed, and 100 μL of the supernatant was accurately weighed and placed in a test tube. 200 μL of tris-hydrochloride buffer (prepared temporarily) containing 0.5% (bovine) fibrinogen (calculated as coagulant) was added. The tube was shaken and the tube was immersed in a 37°C water bath for 5 min. 40 units of thrombin solution per 1 mL was added dropwise (5 μL was added dropwise every 1 min, and gentle shaking was performed while adding) until coagulation occurred. Three replicates were performed in each group, and the volume of thrombin solution consumed was recorded.

[0151] 4. Activity Calculation: Calculate the activity of recombinant hirudin according to the formula U=C1V1 / C2V2, where U is the unit of thrombin activity per 1g (U / g); C1 is the concentration of thrombin solution (U / mL); C2 is the concentration of the test sample solution (g / mL); V1 is the volume of thrombin solution consumed (μL); and V2 is the amount of test sample solution added (μL).

[0152] from Figure 1 It can be seen that the expression levels of recombinant hirudin in strains ZR-06~09 are similar ( Figure 1 ), but the recombinant hirudin expressed by strain ZR-09 has a higher level of Tyr63 sulfation modification. Thrombin titration and calculation comparison showed that the recombinant hirudin expressed by strain ZR-09 also has a higher activity (Figure 2 ).

[0153] Example 5 Construction of recombinant hirudin-expressing engineered bacteria ZR-10-15

[0154] (1) In order to obtain a higher level of Tyr63 sulfation-modified recombinant hirudin, based on the above Examples 3 and 4, this study used wild-type eTPST1 protein as the research object to study its interaction with hirudin. After αfold3 simulation docking (https: / / alphafoldserver.com / ), it was found that the Q113 and T201 binding regions of eTPST1 protein to hirudin were less than 3.5 Å, and the binding region of hirudin to eTPST1 protein was rich in negatively charged E( Figure 3 ), so these two amino acids of the eTPST1 protein were mutated to be positively charged. The specific mutation sites are shown in Table 1.

[0155] (2) Recombinant plasmid pUC57-HO constructed in Example 2 UP -PGK1p-eTPST1-PDC1t-HO DOWN As a template, a one-step PCR method was used to construct a site-directed mutation sequence according to conventional methods. After phosphorylation, a recombinant plasmid pUC57-HO containing a mutant eTPST1 gene expression element fragment with homology arms was obtained. UP -PGK1p-eTPST1 Q113R -PDC1t-HO DOWN The required primers are shown in Table 2. The mutant eTPST1 gene expression element with homology arms can also be directly synthesized by referring to Example 2.

[0156] (3) Referring to Example 2, the mutant eTPST1 gene expression element fragment with the homology arm was enzymatically digested and recovered, and then introduced into the engineered bacteria ZR-02 using the lithium acetate method together with the HO gene editing plasmid. The positive clones were screened, the gene editing plasmid was discarded, and PCR was performed to verify the insertion of the mutant TPST1 gene expression element. The engineered strains corresponding to the insertion of the mutant eTPST1 gene expression element were ZR-05 / 01 to ZR-05 / 06.

[0157] (4) The recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transferred into the positive strain obtained in step (3) using the same method as in Example 3 to obtain the eTPST1 mutant eTPST1 Q113R 、eTPST1 Q113K 、eTPST1 Q113H 、eTPST1 T201R 、eTPST1 T201K 、eTPST1 T201H, corresponding to strains ZR-10~15 in sequence.

[0158] (3) Screening of engineered strains expressing higher recombinant hirudin activity among ZR-10~15: The fermentation, purification and activity detection methods were the same as those in Example 4.

[0159] See the results Figure 4 As can be seen from the figure, the expression levels of recombinant hirudin in the six mutants are comparable. The activity of recombinant hirudin expressed by each strain of ZR-10~15 was compared by thrombin titration and calculation. The results are shown in Figure 5 , eTPST1 T201R The mutation of can significantly improve the activity of recombinant hirudin.

[0160] Table 1 Mutation sites of eTPST1 protein

[0161]

[0162] Table 2 Primer sequences (bold parts are mutant nucleic acids)

[0163]

[0164] Example 6 High copy eTPST1 T201R Construction of engineered bacteria ZR-16

[0165] 1. Artificial synthesis of fusion gene expression elements including rDNA homology arm fragments up -pPGK1-KanMX4-P2A-eTPST1 T201R -PDC1t-rDNA down , the engineered strain ZR-02 was transformed with the lithium acetate method according to the above example, and positive clones were screened for 2-3 days on YPD plates containing 500 μg / mL G418. The positive clones were then streaked onto YPD plates containing gradient concentrations of G418 ranging from 1000 to 16000 μg / mL (1000 μg / mL, 2000 μg / mL, 4000 μg / mL, 8000 μg / mL, 16000 μg / mL) and cultured for 2-3 days to screen for high-copy eTPST1. T201R Positive sub.

[0166] 2. Referring to the previous example, the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t was transferred into the positive isolates screened in step 1 using the lithium acetate method. The positive isolates were plated onto SC-Ura plates and cultured for 2-3 days to obtain the engineered strain ZR-16.

[0167] 3. Referring to Example 4, the fermentation, purification and activity detection methods of the engineered strains ZR-13 and ZR-16 were carried out to compare the activity and sulfation level of the recombinant hirudin expressed by them (Figure 5 ).

[0168] The activity of recombinant hirudin expressed by ZR-13 and ZR-16 strains is as follows Figure 6 As shown, the results showed that the ZR-16 strain expressed a higher level of sulfated and highly active rHirudin.

[0169] Fusion gene expression element rDNA up -pPGK1-KanMX4-P2A-eTPST1 T201R -PDC1t-rDNA down The nucleotide sequence:

[0170] ATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGT ATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGA GTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACG GAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCC CCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTT CCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCG CAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAG TCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAA ... CCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGAT CTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTG - ATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTC GCTACTAACTTCTCTTTGTTGA -eTPST1 T201R

[0171] Note: lowercase letters represent rDNA UP and rDNA DOWN , the horizontal line part is the nucleotide sequence of KanMX4 resistance gene, and the dotted underline part is the nucleotide sequence of P2A self-cleavage peptide.

[0172] Application Example: Application of tyrosine sulfate-modified recombinant hirudin in the field of medical cosmetology

[0173] 1. Evaluation of the antioxidant activity of highly active rHirudin

[0174] (1) Preparation of 2',7'-dichlorofluorescein diacetate (DCFH-DA) solution: Accurately weigh 0.0049 g of DCFH-DA, add 1 mL of methanol to fully dissolve, aliquot (100 μL / tube), and store at -20°C in the dark. The preparation process must be carried out in a sterile environment and away from light. When using, accurately pipette 2.5 μL of DCFH-DA stock solution, add 1 mL of serum-free DMEM medium, mix thoroughly, and prepare immediately before use.

[0175] (2) Preparation of high-activity rHirudin solution: Accurately weigh 1 g of high-activity rHirudin lyophilized powder (the ZR-16 expression product in Example 6), mix thoroughly with 100 mL of distilled water, filter and sterilize with a 0.22 μm filter membrane to prepare a mother solution with a concentration of 10 g / L. When used, dilute with H2O2 solution (0.2 mmol / L) to prepare a concentration gradient of 50, 100, 150, 200, and 250 mg / L.

[0176] (3) Preparation of natural Hirudin (CAS No.: 113274-56-9) solution: same as above.

[0177] (4) Preparation of Vitamin C Solution: Accurately weigh 200.0 mg of vitamin C sample, mix thoroughly with distilled water, dilute to 10 mL, filter through a 0.22 μm filter to sterilize, and prepare a 20 mg / mL vitamin C stock solution. Store at 2-8°C in the dark for no more than 3 months. When used, dilute with H2O2 solution (0.2 mmol / L) to prepare a concentration gradient of 0.2, 0.4, 0.6, 0.8, and 1 mg / mL.

[0178] (5) Cell culture: Place Hacat cells (commercially available) in a cell culture flask, add 5 mL of cell culture medium (90% DMEM medium + 10% fetal bovine serum), and culture in a 37°C, 5% CO2 incubator. Observe cell growth under an inverted microscope. When the cells grow to 80%-90% of the culture flask, perform cell inoculation.

[0179] (6) Cell inoculation: Take logarithmic phase cells and inoculate them into 24-well plates at a density of 1×10 5 / mL, cultured for 24h.

[0180] (7) Evaluation system: A blank control group (Group 1), an oxidized control group (Group 2), a high-activity rHirudin group (Group 3), a natural Hirudin group (Group 4) and a positive control group (Group 5) were set up. The evaluation system is shown in Table 3.

[0181] Table 3

[0182]

[0183] Note: All washing steps in this experiment were performed using a pipette. 0.5-1 mL of PBS buffer was drawn up each time. The force was gentle and slow when pipetting, and the washing was performed row by row. The samples in the table refer to highly active rHirudin or natural Hirudin.

[0184] After adding the DCFH-DA solution, the evaluation system was incubated at 37°C in the dark for 30 minutes. The cells were then washed three times with PBS buffer and the fluorescence intensity (MFI) was measured using a fluorescence analyzer with an excitation wavelength of 485 nm and an emission wavelength of 538 nm. After gently removing the PBS buffer from each well, the cells were immediately lysed and total protein was extracted. Total protein content was determined using a BCA assay kit. ROS was expressed as fluorescence intensity per mg of protein, i.e., MFI / mg protein.

[0185] (8) Calculation of ROS inhibition rate: I ROS (%)=(1-(ROS S -ROS B ) / (ROS H -ROS B ))×100%, where I ROS Indicates ROS inhibition rate; ROS S Indicates the ROS value of sample group (group 3-5); ROS B represents the ROS value of the blank control group; ROS H Represents the ROS value of the oxidative group.

[0186] Draw a curve like AGCAAGCTGGTGACGTTGAAGAAAACCCAGGTCCA Figure 7 The results showed that the antioxidant capacity of the highly active recombinant hirudin with Tyr63 sulfate expressed by ZR-16 was comparable to that of natural hirudin, indicating that the structure of the highly active recombinant hirudin with Tyr63 sulfate expressed by ZR-16 was close to that of natural hirudin.

[0187] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. A method for constructing an engineered strain of Saccharomyces cerevisiae expressing a tyrosine-sulfated, highly active recombinant hirudin, characterized by: Ⅰ. The fragment was transformed into Saccharomyces cerevisiae CEN.PK2-1D by the lithium acetate method, and positive clones were screened in LEU nutrient-deficient medium to obtain strain ZR-01; described In the fragment, the nucleotide sequence of MET3p-MET3Δ-MET3t is shown in SEQ ID No: 2, the nucleotide sequence of MET14p-MET14-MET14t is shown in SEQ ID No: 3, the nucleotide sequence of LEU2p-LEU2 is shown in SEQ ID No: 18, and the nucleotide sequence of GAL7 is shown in SEQ ID No:

2. UP and GAL7 DOWN The nucleotide sequences are shown in SEQ ID No: 8-9 respectively; II. Integrate the GAL1 gene editing plasmid and GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN The fragment was transformed into the strain ZR-01 obtained in step I by the lithium acetate method, and the positive transformants were screened to obtain the engineered strain ZR-02; the GAL1 gene editing plasmid was prepared by the following method: TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -SUP4t fragment was inserted into the starting plasmid to obtain the GAL1 gene editing plasmid; the TEF1p-Cas9-CYC1t-SNR52p-GAL1 sgRNA -SUP4t fragment nucleotide sequence is shown in SEQ ID No: 19; the GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN In the fragment, the nucleotide sequence of SLL is shown in SEQ ID No: 4, GAL1 UP and GAL1 DOWN The nucleotide sequences are shown in SEQ ID No: 10-11 respectively; III. Combine the HO gene editing plasmid and HO UP -PGK1p-TPST1-PDC1t-HO DOWN The fragment was transformed into the strain ZR-02 obtained in step II by the lithium acetate method, and positive transformants were screened to obtain an engineered strain containing the MET3Δ gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element; the HO gene editing plasmid was prepared by the following method: TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t fragment was inserted into the starting plasmid to obtain the HO gene editing plasmid; the TEF1p-Cas9-CYC1t-SNR52p-HO sgRNA -SUP4t fragment nucleotide sequence is shown in SEQ ID No: 20; UP -PGK1p-TPST1-PDC1t-HO DOWN In the fragment, the TPST1 gene is a mutant eTPST1 gene, and the names of the mutant eTPST1 genes are eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H Among them, the mutant eTPST1 gene is mutated based on the nucleotide sequence of the wild-type eTPST1 gene, eTPST1 T201R 、eTPST1 T201K or eTPST1 T201H The corresponding mutation sites are 601-603bp of the wild-type eTPST1 gene nucleotide sequence, and the corresponding mutant nucleotide sequences are AGA, AAA, and CAT, respectively. The nucleotide sequence of the wild-type eTPST1 gene is shown in SEQ ID No: 7; IV. Using the engineered strain obtained in step III as the object, a recombinant plasmid containing the recombinant hirudin gene expression element TEF1p-rHirudin-ADH1t was transferred into the engineered strain by the lithium acetate method to obtain cerevisiae engineered strains ZR-13, ZR-14, and ZR-15 expressing tyrosine sulfated modified highly active recombinant hirudin; the recombinant plasmid was prepared by the following method: the TEF1p-rHirudin-ADH1t fragment was inserted into the starting plasmid to obtain a recombinant plasmid; in the TEF1p-rHirudin-ADH1t fragment, the nucleotide sequence of rHirudin is shown in SEQ ID No: 1; ZR-13, ZR-14, and ZR-15 respectively contain eTPST1 T201R 、eTPST1 T201K 、eTPST1 T201H ; V. Transform the fusion gene expression element containing the rDNA homology arm fragment into rDNA UP -PGK1p-KanMX4-P2A-eTPST1 T201K -PDC1t-rDNA DOWN The strain was transformed into the engineered strain ZR-02 by the lithium acetate method, and the strain containing the high-copy TPST1 gene was screened by G418; the recombinant plasmid containing the recombinant hirudin gene expression element TEF1p-rHirudin-ADH1t was transferred into the strain containing the high-copy TPST1 gene to obtain the cerevisiae engineered strain ZR-16 expressing tyrosine sulfated recombinant hirudin; the recombinant plasmid was prepared by the following method: the TEF1p-rHirudin-ADH1t fragment was inserted into the starting plasmid to obtain the recombinant plasmid; the nucleotide sequence of rHirudin in the TEF1p-rHirudin-ADH1t fragment was shown as SEQ ID No: 1; rDNA UP and rDNA DOWN The nucleotide sequences of are shown in SEQ ID No: 14-15, respectively, the nucleotide sequence of KanMX4 resistance gene is shown in SEQ ID No: 16, and the nucleotide sequence of P2A self-cleavage peptide is shown in SEQ ID No: 17; The nucleotide sequence of the promoter TDH3p is shown in the NCBI database sequence accession number CP029160.1 at positions 9954286 to 9955085; the nucleotide sequence of the promoter PGK1p is shown in the NCBI database sequence accession number CP135951.1 at positions 124102 to 124853; the nucleotide sequence of the promoter TEF1p is shown in the NCBI database sequence accession number CP029160.1 at positions 707052 to 707481. The nucleotide sequence of the terminator CYC1t is shown in NCBI database sequence accession number KC879308.1, positions 1301 to 1607; the nucleotide sequence of the terminator PDC1t is shown in NCBI database sequence accession number CP029160.1, positions 3660519 to 3660915; the nucleotide sequence of the terminator ADH1t is shown in NCBI database sequence accession number CP029160.1, positions 4671969 to 4672126; HO in step III UP -PGK1p-TPST1-PDC1t-HO DOWN In the clip, HO UP The nucleotide sequence is as follows: TTACAGAAAGGGTTCGCAAGTCCTGTTTCTATGCCTTTCTCTTAGTAATTCACGAAATAAACCTATGGTTTA CGAAATGATCCACGAAAATCATGTTATTATTTACATCAACATATCGCGAAAATTCATGTCATGTCCACATTAACAT CATTGCAGAGCAACAATTCATTTTCATAGAGAAATTTGCTACTA; HO in step III UP -PGK1p-TPST1-PDC1t-HO DOWN In the clip, HO DOWN The nucleotide sequence is as follows: TGGTACCTACTACTTTGAATTGTACTACCGCTGGGCGTTATTAGGTGTGAAACCACGAAAAGTTCACCATAA CTTCGAATAAAGTCGCGGAAAAAAGTAAACAGCTATTGCTACTCAAATGAGGTTTGCAGAAGCTTGTTGAAGCATG ATGAAGCGTTCTAAACGCACTATTCATCATTAAATATTTAAAGCTCATAA 。 2. The method for constructing an engineered strain of Saccharomyces cerevisiae according to claim 1, wherein: The engineered strain ZR-01 described in step I was prepared by the following method: Design and synthesize a nucleic acid sequence, the nucleic acid sequence includes: GAL7 UP、 MET3p-MET3Δ-MET3t, MET14p-MET14-MET14t, LEU2p-LEU2, and GAL7 DOWN The fragments were transformed into Saccharomyces cerevisiae by the lithium acetate method, and positive clones were screened in LEU nutrient deficiency medium to obtain strain ZR-01.

3. The method for constructing an engineered strain of Saccharomyces cerevisiae according to claim 1, wherein: The engineered strain ZR-02 described in step II is prepared by the following method: (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence comprising: GAL1 UP , SLL gene expression elements and GAL1 DOWN , and set enzyme cutting sites upstream and downstream respectively; (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN ; (3) Amplification of recombinant plasmid pUC57-GAL1 in E. coli UP -TDH3p-SLL-CYC1t-GAL1 DOWN , double enzyme digestion to obtain GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN fragment; (4) Integrate the GAL1 gene editing plasmid with GAL1 UP -TDH3p-SLL-CYC1t-GAL1 DOWN The fragment was transformed into strain ZR-01 by the lithium acetate method, and positive transformants were screened to obtain the engineered strain ZR-02.

4. The method for constructing an engineered strain of Saccharomyces cerevisiae according to claim 1, wherein: The engineered strain containing the MET3Δ gene expression element, the MET14 gene expression element, the SLL gene expression element, and the TPST1 gene expression element in step III is prepared by the following method: (1) Design and synthesize a nucleic acid sequence, the nucleic acid sequence comprising: HO UP Sequences, TPST1 gene expression elements and HO DOWN Sequence, and set restriction sites upstream and downstream respectively; (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-HO UP -PGK1p-TPST1-PDC1t-HO DOWN ; (3) Amplification of recombinant plasmid pUC57-HO in E. coli UP -PGK1p-TPST1-PDC1t-HO DOWN , double enzyme digestion to obtain HO UP -PGK1p-TPST1-PDC1t-HO DOWN fragment; (4) Combine the HO gene editing plasmid with HO UP -PGK1p-TPST1-PDC1t-HO DOWN The fragment was transformed into strain ZR-02 by the lithium acetate method, and positive transformants were screened to obtain the target engineered strain.

5. The method for constructing an engineered yeast strain of Saccharomyces cerevisiae according to claim 1, wherein It also includes the following steps: The starting plasmid in step II, III or IV is pRS416.

6. The method for constructing an engineered strain of Saccharomyces cerevisiae according to claim 1, wherein: The recombinant plasmid containing the recombinant hirudin gene expression element TEF1p-rHirudin-ADH1t in step IV or V is prepared by the following method: (1) Artificially synthesize the recombinant hirudin gene expression element and set enzyme cleavage sites upstream and downstream; (2) The sequence synthesized in step (1) was inserted into the pUC57 plasmid by enzyme digestion and ligation to construct the recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t; (3) The recombinant plasmid pUC57-TEF1p-rHirudin-ADH1t was amplified in E. coli and the TEF1p-rHirudin-ADH1t fragment was obtained by double enzyme digestion; (4) The TEF1p-rHirudin-ADH1t fragment was connected to the pRS416 vector through the enzyme cutting site to obtain the recombinant plasmid pRS416-TEF1p-rHirudin-ADH1t containing the recombinant hirudin gene expression element.

7. An engineered yeast strain of Saccharomyces cerevisiae expressing a tyrosine sulfate-modified highly active recombinant hirudin, characterized in that The method according to any one of claims 1 to 6 is used to construct the present invention.

8. Use of the engineered yeast Saccharomyces cerevisiae according to claim 7 in the preparation of an antithrombin product.

9. Use of the engineered yeast Saccharomyces cerevisiae according to claim 7 in the preparation of antithrombotic, antihypertensive or antihyperlipidemic drugs.

Images