Leucine dehydrogenase mutant and application thereof

By mutation of leucine dehydrogenase at specific sites, improving its catalytic activity, and optimizing the activity of threonine dehydrogenase in recombinant microorganisms, the yield and quality problems in L-isoleucine fermentation technology are solved, and efficient L-isoleucine production is achieved.

CN120230731APending Publication Date: 2025-07-01ANHUI HUAHENG BIOTECH CO LTD +2

Patent Information

Application Number
CN202311867096.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-29
Publication Date
2025-07-01

AI Technical Summary

Technical Problem

Domestic L-isoleucine fermentation technology is backward, and the yield and quality are difficult to meet the standards. The catalytic activity of existing leucine dehydrogenase is insufficient, affecting the biosynthesis of L-isoleucine.

Method used

By performing specific site mutations in the amino acid sequence of wild-type leucine dehydrogenase, a highly active leucine dehydrogenase mutant is obtained and introduced into recombinant microorganisms, the activity of threonine dehydrogenase is optimized and the production of L-isoleucine is increased.

Benefits of technology

The production of L-isoleucine has been significantly improved to reach more than 30g/L, which is more than 5 times higher than the host bacteria and 26% higher than the wild type, providing strong support for fermentation production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004645929500000051
    Figure BDA0004645929500000051
  • Figure BDA0004645929500000061
    Figure BDA0004645929500000061
  • Figure BDA0004645929500000062
    Figure BDA0004645929500000062
Patent Text Reader

Abstract

The invention discloses a leucine dehydrogenase mutant and application thereof.The mutant is obtained by replacing any one or more amino acid residues in the 36th site, the 59th site and the 109th site on the basis of a wild leucine dehydrogenase amino acid sequence, compared with the wild leucine dehydrogenase amino acid sequence, the enzyme activity of the mutant is improved by 5 times or above, the LeuDH mutant is guided into host bacteria, and the activity of the LeuDH mutant is improved by 5 times or above. The obtained recombinant bacterium is used for fermentation production of L-isoleucine, the yield of L-isoleucine reaches 30 g / L or above, compared with a wild type, the yield is remarkably improved, and powerful support is provided for fermentation production of an L-isoleucine product.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a leucine dehydrogenase mutant and its application. Background Art

[0002] L-isoleucine is one of the essential amino acids in humans and animals, playing roles in protein synthesis, muscle growth, energy supply, brain function, immune regulation, etc., and is widely used in industries such as sports nutrition, functional foods, pharmaceuticals, and feeds. Especially in the feed industry, the application of L-isoleucine has advantages such as reducing nitrogen emissions, optimizing the feed structure, and reducing feed costs, which conforms to the national policy orientation and has broad application prospects.

[0003] Currently, L-isoleucine is mainly produced by fermentation. Major producers include foreign enterprises such as Ajinomoto of Japan and CJ of South Korea. There are also several domestic enterprises producing it, but there are problems in China such as backward fermentation technology and difficulties in meeting the production quantity and quality standards of L-isoleucine. The biosynthetic pathway of L-isoleucine includes the central metabolic pathway and the branched metabolic pathway: Glucose generates phosphoenolpyruvate and pyruvate through the Embden-Meyerhof-Parnas pathway (EMP) and the pentose phosphate pathway (HMP). Carboxylation reactions occur under the action of phosphoenolpyruvate carboxylase and pyruvate carboxylase to generate oxaloacetate, which is then converted into L-aspartic acid under the action of transaminase. L-aspartic acid then undergoes 10 catalytic reactions to generate L-isoleucine. Among them, the synthesis of L-isoleucine mainly occurs through the threonine pathway, that is, L-aspartic acid first generates L-threonine under the catalytic action of a series of enzymes. L-threonine is converted into 2-ketobutyric acid under the catalysis of threonine dehydratase. 2-Ketobutyric acid generates L-isoleucine under the catalysis of acetolactate synthase (AHAS), keto acid reductoisomerase (ilvC), dihydroxy acid dehydratase (ilvD), and branched-chain amino acid transaminase (ilvE). Leucine dehydrogenase (LeuDH) is an isozyme of branched-chain amino acid transaminase (ilvE) and has a similar catalytic function to branched-chain amino acid transaminase (ilvE). Both can catalyze 2-keto-3-methylvaleric acid to generate L-isoleucine. At the same time, leucine dehydrogenase (LeuDH) is an NAD + / NADH-dependent oxidoreductase, which can catalyze 2-keto-3-methylvaleric acid to generate L-isoleucine in vitro using NADH, and has a cost advantage compared with NADPH in terms of cofactor supply. In the biosynthetic pathway of L-isoleucine, the activity of key enzymes affects the carbon flux of the main metabolic flux, thereby affecting the synthesis of the final product. Therefore, screening for leucine dehydrogenase with high activity is of great significance for the fermentation production of L-isoleucine. Summary of the Invention

[0004] The objective of the present application is to modify the exogenous LeuDH gene through semi-rational design to obtain a highly active LeuDH mutant, which has stronger catalytic activity towards 2-keto-3-methylvaleric acid, and use the recombinant microorganism expressing this LeuDH mutant to ferment and produce L-isoleucine, with a significant increase in the yield of L-isoleucine.

[0005] To achieve the above objective, the present invention provides the following technical solutions:

[0006] In a first aspect, the present invention provides a protein, which is a leucine dehydrogenase with improved enzyme activity, namely a leucine dehydrogenase mutant, obtained by mutating any one or more of the amino acids at positions 36, 59, and 109 based on the amino acid sequence of the wild-type leucine dehydrogenase shown in SEQ ID NO:5.

[0007] Among them, the enzyme activity refers to the catalytic activity of the protein / leucine dehydrogenase mutant in catalyzing the substrate 2-keto-3-methylvaleric acid to L-isoleucine.

[0008] In an embodiment of the present invention, the mutation methods of the amino acids at positions 36, 59, and 109 are respectively:

[0009] The glycine G at position 36 is mutated to histidine H;

[0010] The methionine M at position 59 is mutated to lysine K;

[0011] The aspartic acid D at position 109 is mutated to arginine R.

[0012] In an embodiment of the present invention, the protein is a leucine dehydrogenase with improved enzyme activity obtained by mutating the glycine G at position 36 of the amino acid sequence of the wild-type leucine dehydrogenase shown in SEQ ID NO:5 to histidine H;

[0013] The nucleotide sequence of the protein is SEQ ID NO.2, and its amino acid sequence is SEQ ID NO.6.

[0014] In an embodiment of the present invention, the protein is a leucine dehydrogenase with improved enzyme activity obtained by mutating the methionine M at position 59 of the amino acid sequence of the wild-type leucine dehydrogenase shown in SEQ ID NO:5 to lysine K;

[0015] The nucleotide sequence of the protein is SEQ ID NO.3, and its amino acid sequence is SEQ ID NO.7.

[0016] In one embodiment of the present invention, the protein is a leucine dehydrogenase with enhanced enzymatic activity obtained by mutating aspartic acid D at position 109 of the wild-type leucine dehydrogenase amino acid sequence shown in SEQ ID NO:5 to arginine R;

[0017] The nucleotide sequence of the protein is SEQ ID NO.4, and its amino acid sequence is SEQ ID NO.8.

[0018] In a second aspect, the present invention provides a nucleic acid molecule encoding any of the proteins described in the first aspect.

[0019] In one embodiment of the present invention, the nucleotide sequence of the nucleic acid molecule is a sequence mutated from the nucleotide sequence of the wild-type leucine dehydrogenase gene leuDH (the nucleotide sequence is SEQ ID NO.1), and the mutated sequence is as shown in SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.

[0020] In a third aspect, the present invention provides an expression cassette or recombinant vector containing the nucleic acid molecule described in the second aspect.

[0021] Furthermore, the expression cassette refers to a nucleic acid molecule capable of expressing the protein described in the first aspect in a host strain. This nucleic acid molecule may not only include a promoter that initiates the transcription of the mutant coding gene sequence, but also include a terminator that terminates the transcription of the mutant coding gene sequence. Even further, the expression cassette may also include an enhancer sequence.

[0022] In a fourth aspect, the present invention provides a recombinant microorganism expressing any of the proteins described in the first aspect.

[0023] In one embodiment of the present invention, the recombinant microorganism is obtained by introducing the nucleic acid molecule described in the second aspect, or the expression cassette or recombinant vector described in the third aspect, into a host strain.

[0024] In one embodiment of the present invention, when constructing the recombinant microorganism, the leucine dehydrogenase mutant gene leuDH can be incorporated into the chromosome of the host strain by means such as PCR, transduction, homologous recombination, etc.

[0025] In one embodiment of the present invention, the recombinant microorganism also has a threonine dehydrogenase TDH with reduced or inactivated activity to reduce the conversion of threonine to glycine, that is, to reduce the accumulation of by-products and further increase the yield of L-isoleucine.

[0026] In one embodiment of the present invention, the reduction or inactivation of the threonine dehydrogenase TDH activity is achieved by knocking out the threonine dehydrogenase gene tdh in the host strain.

[0027] In one embodiment of the present invention, the host bacterium can be Escherichia coli, Corynebacterium glutamicum, Bacillus subtilis, Pichia pastoris, Saccharomyces cerevisiae, etc.

[0028] In a preferred embodiment of the present invention, the host bacterium is Escherichia coli or Corynebacterium glutamicum.

[0029] More preferably, the host bacterium is a recombinant Escherichia coli producing L-isoleucine, specifically Escherichia coli Sval031 (CGMCC No. 19456, deposit date March 6, 2020; see CN113278641B for details), Escherichia coli Sval049 (deposit number CGMCC No. 19457, deposit date March 6, 2020; see CN113278568B for details), or Escherichia coli Sval065 (deposit number CGMCC No. 19458, deposit date March 6, 2020; see CN113278655B for details).

[0030] Fifthly, the present invention provides the use of the protein described in the first aspect in any one of the following A1)-A4);;

[0031] Or, the use of the nucleic acid molecule described in the second aspect in any one of the following A1)-A4);

[0032] Or, the use of the expression cassette or recombinant vector described in the third aspect in any one of the following A1)-A4);

[0033] Or, the use of the recombinant microorganism described in the fourth aspect in any one of the following A2)-A5):

[0034] A1) Constructing a recombinant engineering bacterium for producing L-isoleucine;

[0035] A2) Preparing leucine dehydrogenase;

[0036] A3) Producing isoleucine;

[0037] A4) Increasing the yield of L-isoleucine or the sugar-acid conversion rate;

[0038] A5) Increasing the yield of L-isoleucine or the sugar-acid conversion rate and reducing glycine accumulation.

[0039] In one embodiment of the present invention, the leucine dehydrogenase can be obtained by fermenting and culturing the recombinant microorganism described in the fourth aspect, inducing the expression of intracellular leucine dehydrogenase, centrifuging, collecting the bacterial cells, and disrupting the bacterial cells.

[0040] In one embodiment of the present invention, the recombinant microorganism is a strain obtained by introducing the nucleic acid molecule described in the second aspect or the expression cassette or recombinant vector described in the third aspect into a host bacterium. The host bacterium can be Escherichia coli Sval031 (CGMCC No. 19456, deposit date: March 6, 2020; see CN113278641B for details), Escherichia coli Sval049 (deposit number: CGMCC No. 19457, deposit date: March 6, 2020; see CN113278568B for details), or Escherichia coli Sval065 (deposit number: CGMCC No. 19458, deposit date: March 6, 2020; see CN113278655B for details). The above three host bacteria are all obtained by genetically modifying Escherichia coli ATCC 8739 and can all ferment and produce L-isoleucine.

[0041] Sixth aspect, the present invention provides a production method for producing L-isoleucine, and the production method is the following B1) or B2):

[0042] B1) Using leucine dehydrogenase to catalyze 2-keto-3-methylvaleric acid to produce L-isoleucine;

[0043] The leucine dehydrogenase includes the protein described in any one of claims 1-2.

[0044] B2) Fermenting and culturing the recombinant microorganism described in any one of claims 5-7, and separating to obtain L-isoleucine.

[0045] The above "comprising the above arginine deiminase mutant" means that the leucine dehydrogenase used in the process of producing L-isoleucine by in vitro enzymatic catalysis can all be the above leucine dehydrogenase mutant, or part of it can be the above leucine dehydrogenase mutant.

[0046] In one embodiment of the present invention, in method B1), the leucine dehydrogenase is a disrupted bacterial solution, which is obtained by fermenting and culturing the recombinant microorganism described in the fourth aspect, inducing the expression of intracellular leucine dehydrogenase, centrifuging, and collecting the bacterial cells; disrupting the bacterial cells.

[0047] In another embodiment of the present invention, in method B1), the leucine dehydrogenase is a crude enzyme solution, which is obtained by centrifuging the above disrupted bacterial solution and collecting the supernatant.

[0048] In another embodiment of the present invention, in method B1), the leucine dehydrogenase is a pure enzyme solution, which is obtained by purifying the above crude enzyme solution through a protein purification column such as a Ni column.

[0049] In method B1), compared with the wild-type leucine dehydrogenase LeuDH, the L-isoleucine production of the LeuDH mutant in vitro enzymatic catalysis of 2-keto-3-methylvaleric acid was increased to 0.465 - 0.482 g / L, an increase of about 20%.

[0050] In method B2), the L-isoleucine production of the recombinant microorganism was above 30 g / L, which was more than 5 times higher than that of the host bacterium.

[0051] Compared with the prior art, the present invention has the following beneficial technical effects:

[0052] The present invention provides a leucine dehydrogenase LeuDH mutant. Compared with the wild-type LeuDH, the catalytic activity of the LeuDH mutant is significantly improved. The LeuDH mutant is introduced into a host bacterium, and the resulting recombinant bacterium is used for fermentative production of L-isoleucine. The L-isoleucine production is above 30 g / L, which is more than 5 times higher than that of the host bacterium and also 26% higher than that of the wild-type, providing strong support for the industrial production of L-isoleucine products. BRIEF DESCRIPTION OF THE DRAWINGS

[0053] Figure 1 It is a diagram of the interaction between leucine dehydrogenase and 2-keto-3-methylvaleric acid. DETAILED DESCRIPTION OF THE EMBODIMENTS

[0054] The present invention will be further described in detail below in conjunction with the specific embodiments. The provided embodiments are only for clarifying the present invention and not for limiting the scope of the present invention. The following provided embodiments can be used as a guide for those of ordinary skill in the art to make further improvements and do not limit the present invention in any way.

[0055] The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions, such as "Molecular Cloning: A Laboratory Manual" (J. Sambrook, D.W. Russell, translated by Huang Peitang, Wang Jiaxi, Zhu Houchu, etc. 3rd edition, Beijing: Science Press, 2002).

[0056] The materials, reagents, etc. used in the following embodiments can be obtained from commercial sources unless otherwise specified.

[0057] 1. The information of the kits and culture media involved in the following embodiments is as follows:

[0058] Among them, PrimeSTAR Max Premix (2×) was purchased from Takara Biotechnology (Dalian) Co., Ltd., product number R045A;

[0059] The pGEX-6P-1 plasmid was purchased from Wuhan Miaoling Biotechnology Co., Ltd., with the product number P0005;

[0060] The DpnI enzyme was purchased from Thermo Fisher Scientific, with the product number FD1703;

[0061] The TaKaRa MutanBEST Kit was purchased from Takara Biotechnology (Dalian) Co., Ltd., with the product number R401.

[0062] The synthetic plasmid containing the leuDH gene from Lysinibacillus sphaericus 1593, that is, the leuDH gene from Lysinibacillus sphaericus 1593 was synthesized on the puc19 plasmid vector, and was synthesized by Suzhou GenScript Biotech Corporation.

[0063] LB plate: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, 20 g / L agar, with water as the solvent.

[0064] LB liquid medium: 10 g / L sodium chloride, 10 g / L peptone, 5 g / L yeast extract, with water as the solvent.

[0065] 2. The primer, plasmid and strain information involved in the following examples are shown in Tables 1-4.

[0066] Table 1: Recombinant primers for wild-type leuDH

[0067] Primer Name Sequence (5’→3’) leuDH-up ctggaagttctgttccaggggcccATGGAAAAGTATGATTATGAACAATTGG leuDH-down gaaacgcgcgaggcagatcgtcagtTTAGCGACCGTGTAAAATATTTTTTTCA 6P-up ctgacgatctgcctcgcgcgtttc 6P-down gggcccctggaacagaacttccag

[0068] Table 2: Design of recombinant primers for mutant leuDH

[0069] Primer Name Sequence (5’→3’) G36H-up CACGCACGTATGTGGACATATGCATCAGAG G36H-down GCCTAATGCTGGTCCAAGTGTTGTATCATG M59K-up AAGACCTACAAAAATGCGGCAGCTGG M59K-down ACCTCGTGCTAAACGCAATGCGTC D109R-up CGCGTAGGTACAACAGTTACAGATATG D109R-down TTCTGCCGTGATATAACGACCATTTAAGC

[0070] Table 3: Construction of leuDH gene-edited strains and related plasmids

[0071]

[0072]

[0073] Table 4: Primers designed for leuDH gene editing

[0074]

[0075] 3. Detection method for L-isoleucine content:

[0076] Take 2 mL of the catalytic product or fermentation broth, centrifuge at 5000 rpm for 1 min, dilute the supernatant by an appropriate multiple, filter through a 0.22 μm filter membrane, and collect the filtrate sample; take 300 μL of the filtrate sample, mix it with 360 μL of boric acid buffer and 240 μL of derivatizing agent, let it stand for 2 min, and then inject it for detection.

[0077] Chromatographic detection conditions:

[0078] Chromatographic column: ZORBAX Eclipse AAA, 3.0 x 150 mm, 3.5 μm;

[0079] Column temperature: 40 °C;

[0080] Flow rate: 1.0 mL / min;

[0081] Ultraviolet detection wavelength: 334 nm;

[0082] Mobile phase: Sodium acetate solution;

[0083] Borax buffer solution: 0.05 mol / L sodium borate solution, adjusted to pH = 9.5 with NaOH;

[0084] Derivatizing agent: 0.343 g of phthalaldehyde and 0.1472 g of N-acetyl-L-cysteine, placed in a 25 mL volumetric flask, then 5 mL of absolute ethanol is added, dissolved by ultrasonic wave, and then made up to 25 mL with 0.05 mol / L sodium borate, filtered through a membrane and stored in the dark for standby.

[0085] Sodium acetate solution: 2.871 g of anhydrous sodium acetate is mixed with 700 mL of ultrapure water and 300 mL of methanol, filtered through a 0.22 μm filter membrane to obtain.

[0086] Example 1: Obtaining the mutation sites of LeuDH

[0087] The wild-type leucine dehydrogenase LeuDH is derived from Lysinibacillus sphaericus 1593, its nucleic acid sequence is shown in SEQ ID NO.1, and its amino acid sequence is shown in SEQ ID NO.5.

[0088] The leucine dehydrogenase LeuDH mutants are obtained by molecular docking, saturation mutagenesis, homologous recombination, etc., including: in AutoDock Vina, the structure of the above wild-type leucine dehydrogenase LeuDH is simulated, using 2-keto-3-methylvaleric acid as the substrate, performing molecular docking with the wild-type leucine dehydrogenase to find the interaction sites, and the amino acids with interactions at the binding pocket include L34, G35, G36, R38, L55, M59, K62, K74, A107, E108, D109, V285, V288, and the interaction at the binding pocket is shown in Figure 1The amino acids at the interaction sites are subjected to saturation mutagenesis, homologous recombination, etc., and constructed into the pGEX-6P-1 expression vector, and then introduced into the BL21 chassis bacteria. The recombinant bacteria are fermented and cultured, induced to express intracellular leucine dehydrogenase, and then centrifuged. The bacterial cells are collected and lysed. The lysed bacterial solution is centrifuged, and the supernatant is collected to obtain a crude enzyme solution, which is obtained by in vitro screening of the crude enzyme catalysis. Specifically, they are G36H, M59K, D109R, and the corresponding nucleotide sequences are shown in SEQ ID NO.2, SEQ ID NO.3, and SEQ ID NO.4 respectively.

[0089] Example 2: In vitro catalytic synthesis of L-isoleucine by wild-type LeuDH and LeuDH mutants

[0090] 1. Construction of recombinant Escherichia coli ILE-001 expressing wild-type LeuDH

[0091] Design recombinant primers for wild-type leuDH as shown in Table 1. Using the synthetic plasmid containing the leuDH gene from Lysinibacillus sphaericus 1593 as a template, with leuDH-up and leuDH-down as primers, DNA polymerase is used for PCR amplification to obtain the wild-type leuDH gene fragment;

[0092] Amplification system: PrimeSTAR Max Premix(2×) 25 μL, template 10 ng, leuDH-up 1.5 μL, leuDH-down 1.5 μL, supplemented with ddH2O to 50 μL; Amplification program: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 55°C for 15 s, extension at 72°C for 40 s, 32 cycles; final extension at 72°C for 5 min.

[0093] Using the pGEX-6P-1 plasmid as a template, with 6P-up and 6P-down as primers, DNA polymerase is used for PCR amplification to obtain the linearized pGEX-6P-1 plasmid fragment;

[0094] Amplification system: PrimeSTAR Max Premix(2×) 25 μL, template 10 ng, 6P-up 1.5 μL, 6P-down 1.5 μL, supplemented with ddH2O to 50 μL; Amplification program: pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 65°C for 15 s, extension at 72°C for 80 s, 32 cycles; final extension at 72°C for 5 min.

[0095] Add 2 μL of DpnI enzyme to the above PCR reaction product, react at 37°C for about 1 h to digest the template plasmid, and then perform agarose gel electrophoresis on the digestion product, and recover the target fragment from the gel, that is, the linearized pGEX-6P-1 plasmid fragment.

[0096] The above-mentioned PCR-amplified leuDH wild-type gene fragment and the linearized plasmid fragment of pGEX-6P-1 were subjected to homologous recombination reaction, transformed into BL21 competent cells, and the recombinant bacteria were spread on an LB plate containing ampicillin (final concentration 100 μg / mL) for culture. Single colonies were picked for colony PCR, and the samples were sent for sequencing verification. The correct single colonies were inoculated into 5 mL of LB liquid medium for overnight culture, and the bacteria were preserved the next day, named ILE-001, and circular plasmid pGEX-leuDH was extracted and named PL-001 (pGEX-6P-1-leuDH).

[0097] 2. Construction of recombinant Escherichia coli ILE-002, ILE-003, and ILE-004 expressing LeuDH mutants

[0098] Primers were designed for the saturated mutant amino acids to introduce the mutation sites. The recombinant primers for leuDH-G36H, leuDH-M59K, and leuDH-D109R are shown in Table 2.

[0099] Using plasmid PL-001 as a template and G36H-up / down, M59K-up / down, or D109R-up / down as primers, PCR amplification was performed using DNA polymerase to obtain the gene fragments of leuDH-G36H, leuDH-M59K, or leuDH-D109R;

[0100] PCR amplification system: PrimeSTAR Max Premix (2×) 25 μL, template 10 ng, upstream primer 1.5 μL, downstream primer 1.5 μL, supplemented with ddH2O to 50 μL;

[0101] PCR amplification program: Pre-denaturation at 98°C for 5 min; denaturation at 98°C for 10 s, annealing at 63°C for 15 s, extension at 72°C for 90 s, 32 cycles; final extension at 72°C for 5 min.

[0102] 2 μL of DpnI enzyme was added to the above PCR reaction product to digest the template plasmid PL-001; then the digested product was subjected to agarose gel electrophoresis, and the target fragment was recovered by gel extraction to obtain the linearized plasmid fragments of PL-001-G36H, PL-001-M59K, or PL-001-D109R (pGEX-6P-1-leuDH-G36H, pGEX-6P-1-leuDH-M59K, pGEX-6P-1-leuDH-D109R).

[0103] The TaKaRa MutanBEST Kit was used for blunt-ending and 5'-end phosphorylation reactions;

[0104] Reaction system: 4.25 μL of the gel extraction product, 0.5 μL of buffer, 0.25 μL of enzyme mix; mix well, after reacting in a water bath at 37 °C for 10 min, react in a water bath at 70 °C for 5 - 10 min to inactivate the enzyme.

[0105] Take 5 μL of the above reaction solution into a centrifuge tube, add 5 μL of Ligation Solution I and mix gently, ligate at 16 °C for more than 1 h to obtain circular plasmids of PL-001-G36H, PL-001-M59K or PL-001-D109R.

[0106] Transform the above circular plasmids into BL21 competent cells, spread the transformation solution on an LB plate containing ampicillin (final concentration of 100 μg / mL) for screening, pick monoclonal colonies for colony PCR, send samples for sequencing verification, and inoculate the correct monoclonal colonies into 5 mL of LB liquid medium for culture and preservation, named ILE-002, ILE-003, and ILE-004 respectively.

[0107] 3. In vitro catalytic screening of wild-type LeuDH and its mutants

[0108] Inoculate 10 μL of the glycerol bacteria expressing wild-type leucine dehydrogenase or its mutants (ILE-001, ILE-002, ILE-003, ILE-004) into 5 mL of LB liquid medium respectively, culture overnight at 37 °C to obtain the primary seed solution. Transfer the primary seed solution to 25 mL of LB liquid medium for culture according to an inoculation amount of 4% (V / V). When OD 600 reaches 0.8, add IPTG with a final concentration of 0.2 mM, induce at 16 °C, 200 - 220 rpm for 20 h, and centrifuge to collect the bacterial cells; add 20 mL of Tris-HCl buffer (pH 7.3) to each bacterial cell, break the bacterial cells under pressure, centrifuge the broken bacterial solution, and collect the supernatant to obtain the crude enzyme solution.

[0109] Using 2-hydroxy-3-methylvaleric acid at 0.5 g / L as the substrate, according to the catalytic system shown in Table 5, the reaction conditions are 30 °C and the catalytic reaction is for 10 minutes.

[0110] Table 5: In vitro enzyme catalytic reaction system

[0111] Component Final Concentration Volume (μL) 2-Hydroxy-3-methylvaleric Acid 0.5 g / L 10 NADH 5 mM 40 Crude Enzyme Solution / 350 <![CDATA[NH4CI-NH4OH buffer(pH 9.5)]]> 200 mM 1600

[0112] Table 6: Characteristic results of in vitro enzyme catalytic reaction

[0113] Strain Characteristic L-Isoleucine Concentration (g / L) ILE-001 Express wild-type leuDH 0.401 ILE-002 Express leuDH-G36H 0.465 ILE-003 Express leuDH-M59K 0.458 ILE-004 Express leuDH-D109R 0.482

[0114] The content of the catalytic product L-isoleucine was detected by high performance liquid chromatography. As shown in Table 6, the results of in vitro crude enzyme catalysis showed that among the leuDH gene saturation mutants, G36H, M59K, and D109R had significantly improved catalytic yields compared to the wild type (as shown in Table 6). The plasmids of the corresponding mutants were extracted and named PL-002, PL-003, and PL-004, respectively.

[0115] Example 3: Fermentation production of L-isoleucine by recombinant Escherichia coli expressing wild-type LeuDH and LeuDH mutants

[0116] 1. Construction of recombinant Escherichia coli expressing wild-type LeuDH / LeuDH mutants

[0117] The recombinant Escherichia coli constructed in the present invention expressing wild-type LeuDH or its mutants can use threonine as a precursor to synthesize L-isoleucine. In this example, Escherichia coli Sval065 was used as the chassis bacterium, which contains the wild-type tdh gene. The threonine dehydrogenase encoded by this tdh gene can catalyze the synthesis of the by-product glycine from threonine. To reduce the accumulation of glycine and direct more carbon flux to the L-isoleucine synthesis pathway, we knocked out the threonine dehydrogenase gene tdh and introduced the genes encoding wild-type leucine dehydrogenase and its mutants, namely LeuDH-WT, leuDH-G36H, leuDH-M59K, and leuDH-D109R, to enhance the catalytic activity of leucine dehydrogenase towards the substrate 2-hydroxy-3-methylvaleric acid and improve the yield of L-isoleucine. The construction of the leuDH gene-edited strains and the design of related plasmids and primers are shown in Table 3 and Table 4, respectively. The specific construction steps are as follows:

[0118] Using Escherichia coli Sval065 as the starting strain, the threonine dehydrogenase gene tdh was knocked out by multi-step homologous recombination and the wild-type leucine dehydrogenase or leucine dehydrogenase mutant gene was inserted at this site; the specific steps are as follows:

[0119] In the first step, using the pRE112 plasmid as a template and tdh-cs-up and tdh-cs-down as primers, a DNA fragment was amplified and named Δtdh-cs for the first step of homologous recombination.

[0120] PCR amplification system: 25 μL of high-fidelity enzyme mixture, 5 - 10 ng of template, 1.5 μL of tdh-cs-up, 1.5 μL of tdh-cs-down, supplemented with ddH2O to 30 μL; PCR amplification program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 10 s, annealing at 56°C for 15 s, extension at 72°C for 1 min, 32 cycles; final extension at 72°C for 5 min, stored at 4°C.

[0121] The above DNA fragment Δtdh-cs was used for the first-step homologous recombination: First, the plasmid pKD46 was electrotransformed into competent cells of Escherichia coli Sval065, and then the DNA fragment Δtdh-cs was electrotransformed into the competent cells of Escherichia coli Sval065 containing the plasmid pKD46.

[0122] Electrotransformation procedure: Prepare 50 μl of competent cells of Escherichia coli Sval065 containing the plasmid pKD46 in advance, add 100 ng of the DNA fragment Δtdh-cs, let it stand on ice for 2 minutes, and then transfer it to a Bio-Rad electroporation cuvette. Use a Bio-Rad electroporator with an electroporation parameter of 2.5 kV. After electroporation, quickly transfer 1 mL of pre-cooled LB medium into the electroporation cuvette, let it stand for 5 min, then transfer it into an EP tube, culture it at 100 rpm and 30 °C for 4 hours, centrifuge the bacterial solution, retain 200 μl of the medium to resuspend the bacteria, spread it on an LB plate with double resistance to ampicillin and chloramphenicol (both at a final concentration of 100 μg / mL), and culture it overnight at 30 °C. The next day, pick monoclonal colonies for PCR verification using the primers yz-tdh-up / yz-tdh-down, send the product with the correct colony PCR band for sequencing, pick the monoclonal colonies with correct results for further culture, and name the successfully constructed strain ILE-005.

[0123] In the second step, using the genomic DNA of Escherichia coli Sval065 as a template, a DNA fragment was amplified with the primers yz-tdh-up / Δtdh-down and named Δtdh, which was used for the second-step homologous recombination. The DNA fragment Δtdh was electrotransformed into ILE-005 containing the plasmid pKD46.

[0124] Electrotransformation procedure: Prepare 50 μl of competent cells of ILE-005 containing the plasmid pKD46 in advance, add 100 - 150 ng of the DNA fragment Δtdh, let it stand on ice for 2 minutes, and then transfer it to a Bio-Rad electroporation cuvette. Use a Bio-Rad electroporator with an electroporation parameter of 2.5 kV. After electroporation, quickly transfer 800 μl of pre-cooled LB medium into the electroporation cuvette, let it stand for 5 min, then transfer it into an EP tube, culture it at 100 rpm and 30 °C for 4 hours, transfer the bacterial solution to 50 mL of LB liquid medium containing 10% sucrose and no sodium chloride, culture it for 24 hours, then streak the bacterial solution on an LB solid medium containing 6% sucrose and no sodium chloride, verify using the primers yz-tdh-up / Δtdh-down, send the monoclonal PCR amplification product for sequencing, pick the monoclonal colonies with correct results for further culture, and name the successfully constructed strain ILE-006.

[0125] Step 3: Using the plasmid PL-001 (pGEX-6P-1-leuDH) of the strain as a template, DNA fragment leuDH-WT was amplified using primers leuDH-universal-up and leuDH-universal-down for homologous recombination.

[0126] Using the plasmid PL-002 (pGEX-6P-1-leuDH-G36H) of the strain as a template, DNA fragment leuDH-G36H was amplified using primers leuDH-universal-up and leuDH-universal-down for homologous recombination.

[0127] Using the plasmid PL-003 (pGEX-6P-1-leuDH-M59K) of the strain as a template, DNA fragment leuDH-M59K was amplified using primers leuDH-universal-up and leuDH-universal-down for homologous recombination.

[0128] Using the plasmid PL-004 (pGEX-6P-1-leuDH-D109R) of the strain as a template, DNA fragment leuDH-D109R was amplified using primers leuDH-universal-up and leuDH-universal-down for homologous recombination.

[0129] DNA fragments leuDH-WT, leuDH-G36H, leuDH-M59K, and leuDH-D109R were respectively electrotransformed into competent ILE-005 cells containing plasmid pKD46. The electrotransformation steps were the same as those described in Step 2. The monoclonal colonies after coating were subjected to PCR amplification, and the products were sent for sequencing. Monoclonal colonies with correct results were picked for further culture, and the successfully constructed strains were named ILE-007, ILE-008, ILE-009, and ILE-010 respectively.

[0130] 2. 5-L fermenter fermentation of L-isoleucine engineering bacteria

[0131] The chassis strain Sval065 and the above constructed strains ILE-006, ILE-007, ILE-008, ILE-009, and ILE-010 were respectively inoculated into a 5-L fermenter containing 2.5 L of fermentation medium for fermentation.

[0132] The components of the fermentation medium were: corn steep liquor 20 g / L, threonine 45 g / L, magnesium sulfate 0.5 g / L, potassium dihydrogen phosphate 1.2 g / L, ammonium sulfate 3 g / L, diammonium hydrogen phosphate 3 / L, ferrous sulfate 5 mg / L, manganese sulfate 5 mg / L, zinc acetate 0.8 mg / L, copper chloride 0.02 mg / L, yeast extract 1 g / L. The solvent was water, and it was sterilized at high temperature for standby.

[0133] (1) Seed culture: 100 μl of the glycerol bacteria to be tested (Sval065, ILE-006, ILE-007, ILE-008, ILE-009, ILE-010) were inoculated into 100 mL of LB liquid medium respectively, and cultured overnight at 37 °C and 220 rpm to obtain a seed solution with an OD600 of 4.

[0134] (2) 5L tank fermentation: Before inoculation, sterilized glucose mother liquor was added to the fermentation medium at a final concentration of 30 g / L, the pH was adjusted to 7.0 with ammonia water, and the temperature was controlled at 37 °C. 100 mL of the above seed solution was inoculated into a 5L tank containing 2.5L of fermentation medium and fermented and cultured under the following fermentation conditions until the production of L-isoleucine no longer increased and then taken out of the tank;

[0135] Fermentation conditions: Dissolved oxygen was controlled in conjunction with stirring speed and aeration. The rotation speed was controlled at 200 - 1500 rpm, the aeration cascade was 0.5 - 5 L / min, the DO was controlled at 25%, the sugar supplementation rate was maintained with residual sugar < 5 g / L, the temperature was automatically controlled at 37 °C, and the pH was automatically controlled at 7.0.

[0136] (3) Liquid phase detection: The detection results of the fermentation end points of different L-isoleucine engineering bacteria are shown in Table 7.

[0137] Table 7: Detection results of the fermentation end points of L-isoleucine strains

[0138]

[0139]

[0140] As shown in Table 7, compared with the host bacteria, the production of L-isoleucine increased by more than 5 times. Compared with the wild-type leuDH strain ILE-007, the production of L-isoleucine in the leuDH mutant strains ILE-008, ILE-009, and ILE-010 all increased.

[0141] The above details the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses, or improvements to the present invention, including changes made using conventional techniques known in the art that are outside the scope disclosed in this application. Some basic features can be applied according to the scope of the following appended claims.

Claims

1. A protein, characterized in that, It is a leucine dehydrogenase with improved enzyme activity obtained by mutating one or more amino acids at positions 36, 59, and 109 on the basis of the wild-type leucine dehydrogenase amino acid sequence shown in SEQ ID NO:

5.

2. The protein according to claim 1, characterized in that, The mutation modes of the amino acids at positions 36, 59, and 109 are as follows: glycine G at position 36 is mutated to histidine H; methionine M at position 59 is mutated to lysine K; aspartic acid D at position 109 is mutated to arginine R.

3. A nucleic acid molecule encoding the protein according to any one of claims 1-2.

4. An expression cassette or recombinant vector containing the nucleic acid molecule according to claim 3.

5. A recombinant microorganism expressing the protein according to any one of claims 1-2.

6. The recombinant microorganism according to claim 5, wherein It is obtained by introducing the nucleic acid molecule according to claim 4 or the expression cassette or recombinant vector according to claim 5 into a host bacterium.

7. The recombinant microorganism according to claim 6, characterized in that, The recombinant microorganism also has a threonine dehydrogenase TDH with reduced or inactivated activity.

8. Use of the protein according to any one of claims 1-2 in any one of the following A1)-A4); or, use of the nucleic acid molecule according to claim 3 in any one of the following A1)-A4); or, use of the expression cassette or recombinant vector according to claim 4 in any one of the following A1)-A4); or, use of the recombinant microorganism according to any one of claims 5-7 in any one of the following A2)-A5): A1) Constructing a recombinant engineering bacterium for producing L-isoleucine; A2) Preparing leucine dehydrogenase; A3) Producing isoleucine; A4) Increasing the yield of L-isoleucine or the sugar-acid conversion rate; A5) Increasing the yield of L-isoleucine or the sugar-acid conversion rate and reducing glycine accumulation.

9. A production method for producing L-isoleucine, characterized in that, The production method is the following B1) or B2): B1) Using leucine dehydrogenase to catalyze 2-keto-3-methylvaleric acid to produce L-isoleucine; The leucine dehydrogenase includes the protein according to any one of claims 1-2; B2) Fermenting and culturing the recombinant microorganism according to any one of claims 5-7, separating, and obtaining L-isoleucine.

10. The production method according to claim 9, characterized in that, The leucine dehydrogenase is a broken bacterial solution obtained by fermenting and culturing the recombinant microorganism according to any one of claims 5-7, inducing the expression of intracellular leucine dehydrogenase, and then centrifuging to collect the bacterial cells; The bacterial cells are broken to obtain it; Preferably, the leucine dehydrogenase is a crude enzyme solution obtained by centrifuging the above broken bacterial solution and collecting the supernatant; Preferably, the leucine dehydrogenase is a pure enzyme solution obtained by purifying the above crude enzyme solution through a protein purification column.

Citation Information

Patent Citations

  • Recombinant Escherichia coli for L-valine production and its applications

    CN113278568B

  • Recombinant Escherichia coli for L-valine production, its construction method and its application

    CN113278641B

  • Recombinant microorganisms for producing L-valine, their construction methods, and applications

    CN113278655B

Cited By

  • Mutant of leucine dehydrogenase as well as preparation method and application of mutant

    CN120424897A